(Edwardsiella tarda) (Paralichthys olivaceus)tlr1 TLR2

48 4 Vol.48, No.4 2017 7 OCEANOLOGIA ET LIMNOLOGIA SINICA Jul., 2017 (Edwardsiella tarda) (Paralichthys olivaceus)tlr1 TLR2 * 1 1 1 1 2 1 1, 2 1 (1. 300387; 2. 300221) Toll,,, TLR1 TLR2, PCR, TLR1 TLR2 (Edwardsiella tarda), (Paralichthys olivaceus), TLR1 TLR2,, TLR1, ; TLR2,, 6h TLR1,, 0 290 (P<0.01) TLR2 1h, 0 17.8 (P<0.01), 1d 14 (P<0.01), TLR1 TLR2,, MyD88 TNF-α IL-1, TLR1 MyD88, TNF-α IL-1, TLR1; TLR2; ; ; ; PCR S917.4 doi: 10.11693/hyhz20170200040 (Paralichthys olivaceus),,, (, 1999),,, (, 2010), Toll (Toll-like receptor, TLRs) (pattern recognition receptor, PRR),,, (, 2006;, 2008;, 2015), TLR1, TLR,,, TLR1 4, TLR1 TLR2 TLR6 *, 14JCZDJC34200,, E-mail: liqingya0914@163.com :,, E-mail: skygh@mail.tjnu.edu.cn : 2017-02-28, : 2017-03-19

4 : (Edwardsiella tarda) (Paralichthys olivaceus)tlr1 TLR2 849 TLR10 (Roach et al, 2005) TLR6 TLR10,, TLR20 TLR21 TLR22 TLR23 (Gao et al, 2013) TLR1 TLR2,,, ;, ;, (Edwardsiella tarda),,,, E. tarda TLR1 cdna (Wu et al, 2012), TLR1 TLR2, PCR, TLR1 TLR2 1 1.1 1.1.1, 10 12cm,, (17 18)(20±2)ºC (Wu et al, 2012;, 2015),,, 1.1.2,, 1.2 实验方法 1.2.1 LB (ph=7), 37ºC, 6000r/min 2min, PBS,, PBS, 10 7 CFU/mL 1.2.2, 100μL,, PBS 100μL, 0h, 1h, 3h, 6h, 12h, 1d, 3d, 6d, 3, 1.2.3 RNA, 50 100mg,, 1mL Trizol RNA, 12000r/min, 4ºC 10min,, 5min, 200μL, 15s, 5min, 12000r/min, 4ºC, 15min,, 500 ml,, 10min, 12000r/min, 4ºC, 10min,,, 1mL 75%, 7500r/min, 4ºC, 5min,, 20μL DEPC, 55ºC, 5min, 80ºC 1.2.4 cdna Sangon Biotech cdna,, TLR1 TLR2 cdna : RNA 2μg, (0.2μg/μL) 1μL, RNase free ddh 2 O, 5 Reaction Buffer 4μL, dntp Mix (10mmol/L) 2μL, RNase Inhibitor (20U/μL) 1μL, M-MuLV RT (200U/μL) 1μL, 20μL 1.2.5 ABI 7500 PCR, cdna, Promega GoTaq qpcr Master Mix, cdna 4μL, (10μmol/L) 0.4μL, (10μmol/L) 0.4μL, GoTaq qpcr Master Mix 10μL, Nuclease-Free Water 9.2μL 24μL, 3, 2 ΔΔCT, Origin 8 1 表 1 Real-Time RT-PCR 所使用的各基因特异性引物 Tab.1 The specific primers of each gene used for Real-Time RT-PCR (5 3 ) TLR1-F TLR1-R TLR2-F TLR2-R MyD88-F MyD88-R TNF-F TNF-R IL-1-F IL-1-R β-actin-f β-actin-r TCCGCACTTCTCATCTTTAT' ATTTCACCACAGCCCTTC ACTTCCTTCCTGGACACTG' TCGTAGCGGCACCAATCA GTGACCCAGAGCCAACT CAACTTACCAGGACAGAGG CAGGGTATGGCTCTTCACG CCCAGGTAGATGGCATTGTA AGCAGCAACCGCAAAGT' TGTAGAACAGAAATCGCACC' AGGTTCCGTTGTCCCG TGGTTCCTCCAGATAGCAC

850 48 2 2.1 TLR1 TLR2 TLR1 TLR2 TLR1,, 1; TLR2,, 2 1h, TLR1, 90 (P<0.01), 6h,,, 290 (P<0.01), TLR1, 4, 6h, TLR1, 20 (P<0.01) 11 (P<0.01) 8.5 (P<0.01), 5 6 7,, 1h,, 4.5 (P<0.05), 3h, TLR1, 9 (P<0.01), 8 TLR2, 1 TLR1 Fig.1 Relative expression of P. olivaceus TLR1 in various tissues 3 TLR1 TLR2 E. tarda Fig.3 Relative expression of P. olivaceus TLR1 and TLR2 in the heart after infection by E. tarda 2 TLR2 Fig.2 Relative expression of P. olivaceus TLR2 in various tissues 2.2 TLR1 TLR2 TLR1, 6h, TLR1,, 6h, 5.8,, 1d, 9.8 (P<0.01) 3, (P<0.05) (P<0.01) * ** TLR1, 4 TLR1 TLR2 E. tarda Fig.4 Relative expression of P. olivaceus TLR1 and TLR2 in the spleen after infection by E. tarda

4 : (Edwardsiella tarda) (Paralichthys olivaceus)tlr1 TLR2 851 5 TLR1 TLR2 E. tarda Fig.5 Relative expression of P. olivaceus TLR1 and TLR2 in the head kidney after infection by E. tarda,, ( 9), TLR2, 1h,, 24 (P<0.01),,, TLR2 6h, 4 (P<0.05), 1d,, 14.5 (P<0.01), TLR2, 3h, TLR2, 8.5 (P<0.01),, 0 6 TLR1 TLR2 E. tarda Fig.6 Relative expression of P. Olivaceus TLR1 and TLR2 in the intestine after infection by E. tarda 8 TLR1 TLR2 E. tarda Fig.8 Relative expression of P. olivaceus TLR1 and TLR2 in the gill after infection by E. tarda 7 TLR1 TLR2 E. tarda Fig.7 Relative expression of P. Olivaceus TLR1 and TLR2 in the muscle after infection by E. tarda 9 TLR1 TLR2 E. tarda Fig.9 Relative expression of P. olivaceus TLR1 and TLR2 in the liver after infection by E. tarda

852 48, TLR2, 3h,, 8.5 (P<0.01),, TLR2 6h,,, 0 10 11 E. tarda TLR1 TLR2 10 TLR1 TLR2 TLR1, TLR2 10 E. tarda TLR1(A) TLR2(B) Fig.10 Relative expression of P. olivaceus TLR1 (A) and TLR2 (B) in various tissues after infection by E. tarda in different durations 2.3 MyD88 MyD88 (myeloid differentiation factor 88), TLR, TLR (, 2010), TLR, TLR3 (Bonnert et al, 1997; Akira et al, 2006) MyD88 TLR, IRAK MyD88 TRAF6, NF-KB, MAPK JNK, TNF, MyD88, MyD88,, MyD88, 3h, 18 (P<0.01),,, MyD88 6h, 12 (P<0.01),, 1d, 6.5 (P<0.01), 3h MyD88, 10 (P<0.01); 3d,, 10.5 (P<0.01) 11 11 E. tarda MyD88 Fig.11 Relative expression of P. olivaceus MyD88 after infection by E. tarda : A. ; B. ; C.

4 : (Edwardsiella tarda) (Paralichthys olivaceus)tlr1 TLR2 853 2.4 TNF-α IL-1,, (, 2010) (TNF) (IL) (INF), TNF-α IL-6 IL-1β IL-8 TLRs, TNF-α IL-1 (tumor necrosis factor, TNF), /,,,, TNF (, 2013),,,,,, TNF-α, 1h, 300 (P<0.01),,, TNF-α 1h, 400 (P<0.01),, 1h, 130 (P<0.01); 6h, TNF-α 225 (P<0.01) (interleukin, IL) IL-1,, IL-1,,, IL-1, 1h, 305 (P<0.01); 6h, 370 (P<0.01),,, IL-1 1h,, 75 (P<0.01),, 6h,, 30 (P<0.01) 12 12 TNF-α IL-1 E. tarda Fig.12 Relative expression of P. olivaceus TNF-α and IL-1 after infection by E. Tarda : A. ; B. ; C. 3 Toll,, TLR1,, TLR1 (Wu et al, 2008), (Wu et al, 2008; Palti et al, 2010; Rebl et al, 2010) TLR2 TLR, TLR2 MyD88, (Li et al, 2016) TLR2 TLR1 TLR6, (pathogen associated molecular patterns, PAMPs) (Fan et al, 2015),

854 48,,, TLR1 TLR2,, TLR1 TLR2, (Jault et al, 2004; Meijer et al, 2004), : TLR1 (Wu et al, 2008); TLR1, (Palti et al, 2010); Poly(I:C),, TLR1 TLR2 (Wei et al, 2011);, TLR2, (Baoprasertkul et al, 2007),, TLR1 TLR2,, TLR1 TLR2 (, 2009) PCR,, 7, TLR1 TLR2, TLR1, ; TLR2,, TLR1 TLR2,, 9, TLR1 (Wei et al, 2011), TLR1 8,, (Wu et al, 2008), TLRs, TLR1 TLR2, TLR1,, TLR1 TLRs MyD88,, MyD88 TLR1, TLR1 MyD88, TNF-α IL-1,, TLRs, TLR (, 2010), TLR20 TLR21 TLR22 TLR23(Wu et al, 2012),, TLR21 (Li et al, 2012; Gao et al, 2013; Yeh et al, 2013;, 2015), TLR TLRs PAMP, TLR3 TLR22 (Matsuo et al, 2008), TLR5 TLR5s (Tsujita et al, 2004), (, 2012) TLR5 TLR5s ; TLR21, TLR9 (Oshiumi et al, 2003; Meijer et al, 2004; Ishii et al, 2007), TLR6 TLR10, TLR1 TLR2 TLR10 TLR6 (, 2011), (Roach et al, 2005), TLR1 TLR2 TLR6 TLR10,,, Toll, Toll (Wu et al, 2012);,, TLRs,,,,, 2010.., (10): 50 51,, 2006. Toll (TLRs)., 33(9): 820 827,,, 2008. Toll., 29(2): 56 60, 2013.. :

4 : (Edwardsiella tarda) (Paralichthys olivaceus)tlr1 TLR2 855, 2011. TLR1 TLR2 MyD88. :, 2010.., 45(5): 21 25,,, 2009. Toll., 31(8): 40 43,,, 2012. TLR5 TLR5S., 33(05): 30 38,,, 2015. (Paralichthys olivaceus)tlr21 (Edwardsiella tarda)., 46(6): 1502 1508,,, 2015. Toll., 39(1): 173 184,, 2010. TLR21., 38(3): 1258 1260, 2010. Toll 4. :,,, 1999.., 8(3): 242 246 Akira S, Uematsu S, Takeuchi O et al, 2006. Pathogen recognition and innate immunity. Cell, 124(4): 783 801 Baoprasertkul P, Peatman E, Abernathy J et al, 2007. Structural characterisation and expression analysis of toll-like receptor 2 gene from catfish. Fish & Shellfish Immunology, 22(4): 418 426 Bonnert T P, Garka K E, Parnet P et al, 1997. The cloning and characterization of human MyD88: a member of an IL-1 receptor related family. FEBS Letters, 402(1): 81 84 Fan Z J, Jia Q J, Yao C L, 2015. Characterization and expression analysis of Toll-like receptor 2 gene in large yellow croaker, Larimichthys crocea. Fish & Shellfish Immunology, 44(1): 129 137 Gao H, Wu L, Sun J S et al, 2013. Molecular characterization and expression analysis of Toll-like receptor 21 cdna from Paralichthys olivaceus. Fish & Shellfish Immunology, 35(4): 1138 1145 Ishii A, Kawasaki M, Matsumoto M et al, 2007. Phylogenetic and expression analysis of amphibian Xenopus Toll-like receptors. Immunogenetics, 59(4): 281 293 Jault C, Pichon, Chluba J, 2004. Toll-like receptor gene family and TIR-domain adapters in Danio rerio. Molecular Immunology, 40(11): 759 771 Li X P, Sun L, 2016. Toll-like receptor 2 of tongue sole Cynoglossus semilaevis: signaling pathway and involvement in bacterial infection. Fish & Shellfish Immunology, 51: 321 328 Li Y W, Luo X C, Dan X M et al, 2012. Molecular cloning of orange-spotted grouper (Epinephelus coioides) TLR21 and expression analysis post Cryptocaryon irritans infection. Fish & Shellfish Immunology, 32(3): 476 481 Matsuo A, Oshiumi H, Tsujita T et al, 2008. Teleost TLR22 recognizes RNA duplex to induce IFN and protect cells from birnaviruses. The Journal of Immunology, 181(5): 3474 3485 Meijer A H, Gabby Krens S F, Medina Rodriguez I A et al, 2004. Expression analysis of the Toll-like receptor and TIR domain adaptor families of zebrafish. Molecular Immunology, 40(11): 773 783 Oshiumi H, Tsujita T, Shida K et al, 2003. Prediction of the prototype of the human Toll-like receptor gene family from the pufferfish, Fugu rubripes, genome. Immunogenetics, 54(11): 791 780 Palti Y, Rodriguez M F, Gahr S A et al, 2010. Identification, characterization and genetic mapping of TLR1 loci in rainbow trout (Oncorhynchus mykiss). Fish & Shellfish Immunology, 28(5 6): 918 926 Rebl A, Goldammer T, Seyfert H M, 2010. Toll-like receptor signaling in bony fish. Veterinary Immunology and Immunopathology, 134(3 4): 139 150 Roach J C, Glusman G, Rowen L et al, 2005. The evolution of vertebrate Toll-like receptors. Proceedings of the National Academy of Sciences of the United States of America, 102(27): 9577 9582 Tsujita T, Tsukada H, Nakao M et al, 2004. Sensing bacterial flagellin by membrane and soluble orthologs of Toll-like receptor 5 in rainbow trout (Onchorhynchus mikiss). The Journal of Biological Chemistry, 279(47): 48588 48597 Wei Y C, Pan T S, Chang M X et al, 2011. Cloning and expression of Toll-like receptors 1 and 2 from a teleost fish, the orange-spotted grouper Epinephelus coioides. Veterinary Immunology and Immunopathology, 141(3 4): 173 182 Wu L, Sun J S, Geng X Y et al, 2012. Molecular cloning and expression analysis of Toll-like receptor 1 cdna in Japanese flounder, Paralichthys olivaceus. Agricultural Science & Technology, 13(12): 2464 2470 Wu X Y, Xiang L X, Huang L et al, 2008. Characterization, expression and evolution analysis of Toll-like receptor 1 gene in pufferfish (Tetraodon nigroviridis). International Journal of Immunogenetics, 35(3): 215 225 Yeh D W, Liu Y L, Lo Y C et al, 2013. Toll-like receptor 9 and 21 have different ligand recognition profiles and cooperatively mediate activity of CpG-oligodeoxynucleotides in zebrafish. Proceedings of the National Academy of Sciences of the United States of America, 110(51): 20711 20716

856 48 EXPRESSION OF TLR1 AND TLR2 GENES OF JAPANESE FLOUNDER PARALICHTHYS OLIVACEUS INDUCED BY EDWARDSIELLA TARDA LI Qing-Ya 1, ZHOU Mi 1, ZHANG Jie 1, ZHENG Jin-Hui 1, GENG Xu-Yun 2, PAN Bao-Ping 1, SUN Jin-Sheng 1, 2, GAO Hong 1 (1. Tianjin Key Laboratory of Animal and Plant Resistance, College of Life Sciences, Tianjin Normal University, Tianjin 300387, China; 2. Tianjin Aquaculture Disease Prevention & Treatment Center, Tianjin 300221, China) Abstract Toll-like receptors (TLRs) are a class of proteins that play an important role in the innate immunity. Toll-like receptor 1 (TLR1) forms a heterodimer with Toll-like receptor 2 (TLR2) to recognize lipopeptides of pathogenic bacteria and initiate host innate immunity system. We detected the mrna levels of TLR1 and TLR2 in various tissues of healthy or Edwardsiella tarda induced Japanese flounder Paralichthys olivaceus by quantitative real time reverse transcription-pcr (RT-qPCR) and discussed the roles of TLR1 and TLR2 in the innate immunity of P. olivaceus. The results indicate that TLR1 and TLR2 were widely expressed in various tissues of healthy P. olivaceus. The highest expression level of TLR1 was observed in spleen, followed by heart, muscle, liver, intestine, gills, and head kidney, and that of TLR2 in intestine, followed by liver, heart, muscle, gills, and spleen. Immunostimulation test shows that TLR1 transcript peaked in level 6h after E. tarda challenge in most tissues; the highest expression level soared to 92.2 fold increase (P<0.01) from that of the initial point in the spleen. Similarly, TLR2 transcript topped in 1h in the spleen for a 17.8 fold increase (P<0.01), and 14 fold increase (P<0.01) in the heart; and then the TLR2 expression stayed. These facts suggest that the TLR1 and TLR2 genes were involved in immune response to E. tarda infection. In addition, expressions of MyD88, TNF-α, and IL-1 genes were up-regulated after E. tarda challenge. Therefore, we believe that E. tarda could up-regulate MyD88 expression via TLR1 pathway and up-regulate ultimately the expression of inflammatory factors TNF-α and the IL-1 genes against pathogen infection. Key words TLR1; TLR2; Paralichthys olivaceus; Edwardsiella tarda; expression; real-time PCR