,, ; 3,, *, Da 84% 80% 77% 78% 82%

Σχετικά έγγραφα
SCIENTIA SILVAE SINICAE. a/ b. oldhamii). The length of cab2bo1 ( GenBank accession

Chalkou I. C. [PROJECT] Ανάθεση εργασιών.

Salmonella produce microrna-like RNA fragment Sal-1 in the infected cells to. facilitate intracellular survival

Shiraia sp. Slf14 III

The toxicity of three chitin synthesis inhibitors to Calliptamus italicus Othoptera Acridoidea

CBF1. Study on CBF1 Gene Transferred from Transgenic Strawberry to Nontransgenic

Apr Vol.26 No.2. Pure and Applied Mathematics O157.5 A (2010) (d(u)d(v)) α, 1, (1969-),,.

α 1 2- Cloning and Expression of alpha 1 2-fucosyltransferase in E. coli BIOTECHNOLOGY BULLETIN

SOD SNP % Cu /Zn-SOD. DAM- BE DNAStar % Mn /Fe-SOD. 6 1SNP /17. 9 bp

LUO, Hong2Qun LIU, Shao2Pu Ξ LI, Nian2Bing

Antimicrobial Ability of Limonene, a Natural and Active Monoterpene

Study on the Strengthen Method of Masonry Structure by Steel Truss for Collapse Prevention

IL - 13 /IL - 18 ELISA PCR RT - PCR. IL - 13 IL - 18 mrna. 13 IL - 18 mrna IL - 13 /IL Th1 /Th2

Supporting Information. Asymmetric Binary-acid Catalysis with Chiral. Phosphoric Acid and MgF 2 : Catalytic

Extract Isolation Purification and Identification of Polysaccharides from Exocarp of Unripe Fruits of Juglans mandshurica

Study on AgrobacteriunΟmediated transformation of tobacco plant with rol C gene

Comparison of carbon-sulfur and carbon-amine bond in therapeutic drug: -S-aromatic heterocyclic podophyllum derivatives display antitumor activity

Studies on the Binding Mechanism of Several Antibiotics and Human Serum Albumin

Supplementary Information for

Nucleotide Sequence of Cloned cd NA for alpha Subunit of Goat Follicle Stimulating Hormone

ER-Tree (Extended R*-Tree)

A new ent-kaurane diterpene from Euphorbia stracheyi Boiss

Identification of Fish Species using DNA Method

Table S1. Summary of data collections and structure refinements for crystals 1Rb-1h, 1Rb-2h, and 1Rb-4h.

Approximation Expressions for the Temperature Integral

D-Glucosamine-derived copper catalyst for Ullmann-type C- N coupling reaction: theoretical and experimental study

Journal of Central South University (Science and Technology) May Bragg TU443 A (2011)

Supporting Information

[11].,, , 316 6, ,., 15.5%, 9.8%, 2006., IDF,, ,500, 2,830.,, ,200.,,, β, [12]. 90% 2,,,,, [13-15].,, [13,

ΕΦΑΡΜΟΓΗ ΕΥΤΕΡΟΒΑΘΜΙΑ ΕΠΕΞΕΡΓΑΣΜΕΝΩΝ ΥΓΡΩΝ ΑΠΟΒΛΗΤΩΝ ΣΕ ΦΥΣΙΚΑ ΣΥΣΤΗΜΑΤΑ ΚΛΙΝΗΣ ΚΑΛΑΜΙΩΝ

Quick algorithm f or computing core attribute

( ) , ) , ; kg 1) 80 % kg. Vol. 28,No. 1 Jan.,2006 RESOURCES SCIENCE : (2006) ,2 ,,,, ; ;

CorV CVAC. CorV TU317. 1

Copper-catalyzed formal O-H insertion reaction of α-diazo-1,3-dicarb- onyl compounds to carboxylic acids with the assistance of isocyanide

Abstract... I. Zusammenfassung... II. 1 Aim of the work Introduction Short overview of Chinese hamster ovary cell lines...

Vol. 31,No JOURNAL OF CHINA UNIVERSITY OF SCIENCE AND TECHNOLOGY Feb

Inhibition of mushroom tyrosinase by flavonoid from Sorbus tianschanica Ruper in Xinjiang

P450 CYP4G19. Prokaryotic Expression of German cockroach Cytochrome P450 CYP4G19 Gene and Preparation of Polyclonal Antibody , ; 2.

þÿ Ç»¹º ³µÃ ± : Ãż²» Ä Â

Optimizing Microwave-assisted Extraction Process for Paprika Red Pigments Using Response Surface Methodology

DNA G7444A, 2. Study on a new point mutation of nt7444 G A in the mitochondrial DNA in a type 2 diabetes mellitus family

,,, (, ) , ;,,, ; -

Free Radical Initiated Coupling Reaction of Alcohols and. Alkynes: not C-O but C-C Bond Formation. Context. General information 2. Typical procedure 2

Chalkou I. C. [PROJECT] Ανάθεση εργασιών.

Αξιολόγηση της αισθητικής αξίας δασογεωργικών και γεωργικών συστημάτων

Supporting Information

SUPPLEMENTARY INFORMATION

Advance in Nanorealgar Studies

ΙΩΑΝΝΗ ΑΘ. ΠΑΠΑΪΩΑΝΝΟΥ

Supporting Information. Generation Response. Physics & Chemistry of CAS, 40-1 South Beijing Road, Urumqi , China. China , USA

Congruence Classes of Invertible Matrices of Order 3 over F 2

Chalkou I. C. [PROJECT] Ανάθεση εργασιών.

J. of Math. (PRC) Banach, , X = N(T ) R(T + ), Y = R(T ) N(T + ). Vol. 37 ( 2017 ) No. 5

Research on Economics and Management

Supporting Information. Research Center for Marine Drugs, Department of Pharmacy, State Key Laboratory

Metal-free Oxidative Coupling of Amines with Sodium Sulfinates: A Mild Access to Sulfonamides

High mobility group 1 HMG1

Gro wth Properties of Typical Water Bloom Algae in Reclaimed Water

HIV HIV HIV HIV AIDS 3 :.1 /-,**1 +332

Gateway cdna. cdna. pdest TM ~ cfu/ ml ~ cfu bp

Journal of the CUN(Natural Sciences Edition) ...

ΤΕΧΝΟΛΟΓΙΚΟ ΠΑΝΕΠΙΣΤΗΜΙΟ ΚΥΠΡΟΥ ΣΧΟΛΗ ΓΕΩΠΟΝΙΚΩΝ ΕΠΙΣΤΗΜΩΝ ΒΙΟΤΕΧΝΟΛΟΓΙΑΣ ΚΑΙ ΕΠΙΣΤΗΜΗΣ ΤΡΟΦΙΜΩΝ. Πτυχιακή εργασία

Tan Xiaofeng Chen Hongpeng Zhang Dangquan Zeng Yanling Li Wei Jiang Yao Xie Lushan Hu Xiaoyi Hu Fangming. and Technology Changsha )

Reading Order Detection for Text Layout Excluded by Image

ph Maillard MRPs maillard reaction products Maillard ph kDa Maillard Maillard DOI /j. issn

Research on explaining porosity in carbonate reservoir by capture cross section method

Table of Contents 1 Supplementary Data MCD

30s 56 60s 72 60s dntp cm s s s 23

Electronic Supplementary Information (ESI)

Supporting Information. Enhanced energy storage density and high efficiency of lead-free

Accumulation of Soil Arsenic by Panax notoginseng and Its Associated Health Risk

Resistance monitoring and target gene cloning of Bemisia tabaci Q-biotype from Jiangsu Province

Supporting Information

Differences in Contents of Neutral Aroma Components and Sensory Evaluation in Air-cured Burley Leaves from Different Curing Barns

Nguyen Hien Trang* **

No. 7 Modular Machine Tool & Automatic Manufacturing Technique. Jul TH166 TG659 A

1 (forward modeling) 2 (data-driven modeling) e- Quest EnergyPlus DeST 1.1. {X t } ARMA. S.Sp. Pappas [4]

(1) A lecturer at the University College of Applied Sciences in Gaza. Gaza, Palestine, P.O. Box (1514).

Science of Sericulture

Resurvey of Possible Seismic Fissures in the Old-Edo River in Tokyo

2 PbO 2. Pb 3 O 4 Sn. Ti/SnO 2 -Sb 2 O 4 -CF/PbO x SnO 2 -Sb PbO 2. Sn-Sb 1:1. 1 h. Sn:Sb=10:1. PbO 2 - CeO 2 PbO 2. [8] SnO 2 +Sb 2 O 4 _

Σχέση στεφανιαίας νόσου και άγχους - κατάθλιψης

Supplementary Information. Living Ring-Opening Polymerization of Lactones by N-Heterocyclic Olefin/Al(C 6 F 5 ) 3

A Systematic Review of Procalcitonin for Early Detection of Septicemia of Newborn

Preparation and Application of Amorphous Alloy Catalyst

ΕΘΝΙΚΟ ΜΕΤΣΟΒΙΟ ΠΟΛΥΤΕΧΝΕΙΟ

ΠΕΡΙΛΗΨΗ. Λέξεις κλειδιά: Υγεία και συμπεριφορές υγείας, χρήση, ψυχότροπες ουσίες, κοινωνικό κεφάλαιο.

Study on the Solubility of Kiwi Fruit Seed Oil in Supercritical Carbon Dioxide

College of Life Science, Dalian Nationalities University, Dalian , PR China.

ΠΟΛΥΤΕΧΝΕΙΟ ΚΡΗΤΗΣ ΣΧΟΛΗ ΜΗΧΑΝΙΚΩΝ ΠΕΡΙΒΑΛΛΟΝΤΟΣ

Supporting information. An unusual bifunctional Tb-MOF for highly sensing of Ba 2+ ions and remarkable selectivities of CO 2 /N 2 and CO 2 /CH 4

Supporting Information

Correction of chromatic aberration for human eyes with diffractive-refractive hybrid elements

Novel and Selective Palladium-Catalyzed Annulation of 2-Alkynylphenols to Form 2-Substituted 3-Halobenzo[b]furans. Supporting Information

,HLA2B2704,, The Technique of Producing HLA2B2704 Gene Transgenic Mice. Chinese Journal of Biochemistry and Molecular Biology HLA2 B2704 ,1,2 Q33,Q78

Schedulability Analysis Algorithm for Timing Constraint Workflow Models

Η οικολογία της σχολικής τάξης ΙΙ

90 [, ] p Panel nested error structure) : Lagrange-multiple LM) Honda [3] LM ; King Wu, Baltagi, Chang Li [4] Moulton Randolph ANOVA) F p Panel,, p Z

, DYY-8B, ; : Centrifuge 11 R. min

Identification of Salmonella,Campylobacter jejuni and Enterohemorrhagic E.coli by Denaturing High-performance Liquid Chromatography

Transcript:

2009 28 2 216 222 Genomics and Applied Biology, 2009, Vol.28, No.2, 216 222 Research Report NTA 1,2 3 2* 1* 1,, 100083; 2,,, 100102; 3,, 100037 *, gaojian@icbr.ac.cn; xinshen77@126.com RT-PCR NTA NTA 698 bp 516 bp 172 5.84 18 615.19 Da 84% 80% 77% 78% 82% alpha-d (QXDXNXVXY), NTA,,, Cloning and Sequence Analysis of the Lectin Ortholog NTA from Chinese Narcissus (Narcissus tazetta var. Chinensis Roem) and Structure Prediction the Protein Liu Wenfeng 1,2 Hou Chenglin 3 Gao Jian 2* Shen Xin 1* 1 Beijing Forestry University, College of Biological Sciences and Biotechnology, Beijing, 100083; 2 International Centre for Bamboo and Rattan, Key Laboratory of Bamboo and Rattan Science and Technology of the SFA, Beijing, 100102; 3 Capital Normal University, College of Life Science, Beijing, 100037 * Corresponding authors, gaojian@icbr.ac.cn; xinshen77@126.com Abstract Lectins are carbohydrate-binding proteins which are important in immune responses. A full-length cdna of a lectin gene designated as NTA was cloned from Chinese Narcissus with the method of RT-PCR. With a size of 698 bp including an 516 bp open reading frame, the NTA encode a precursor lectin with 172 amino acids. The pi and M.W. of the protein NTA were predicted to be 5.84 and 18 615.19 Da, respectively. The homologous analysis showed that the sequence similarity between NTA and those from species as Narcissus hybrid cultivar agglutinin, Galanthus nivalis agglutinin, Clivia miniata agglutinin, Lycoris radiata agglutinin and Hippeastrum vittatum agglutinin were 84%, 80%, 77%, 78%, 82%, respectively. The prediction of the protein structure indicated that tertiary protein structure of lectin from Narcissus was similar to that of Narcissus pseudonarcissus, containing three functional domains specific for agglutination with the consensus sequence motif QXDXNXVXY involved in alpha-d-mannose recognition. Narcissus tazetta var. Chinensis Roem, NTA, Gene cloning, Sequence analysis, Protein structure pre- Keywords diction www.genoapplbiol.org/doi/10.3969/gab.028.000216 948 (2006 4 C07)

NTA 217 Cloning and Sequence Analysis of the Lectin Ortholog NTA from Chinensis Narcissus, 2003;, 2001;, 1999) zga (Ye et al., 2008) (, 2001) Hilder (1995) GNA (, 2006) (GNA) (Narcissus pseudonarcissus) (NPL) (, 2005) (HIV) (FIV) (Lopez et al., 2003) (Narcissus tazetta var. Chinensis Roem) (, 2001) 1 1.1 18~25 (, 2006) RNA 7 (monocot mannose-binding lectin, MBL) 1.2 2 Taq DNA pmd18 T 3' Full RACE (TaKaRa) RT-PCR (galanthus nivalis agglutinin, GNA) (Promega) Trizol reagent (Invitrogen) DNA ( ) Sigma GNA 1.3 RNA cdna (, 1998) (, 2001) RNA Invitrogen Trizol reagent GNA 0.1 g 1.5 ml RNase 4 (, Trizol 1 ml 5 min 200 μl 1998;, 2002;, 2000; Poppy, 1997; 15 s 2~3 min 12 000 g

218 Genomics and Applied Biology www.genoapplbiol.org 4 15 min pmd18 T (E. 500 μl 10 min 12 000 g 4 cdna Promega RT-PCR coli) TOP10 PCR 10 min 1 ml 75% 7 500 g 4 5 min 100 μl DEPC-ddH 2 O 2 28S 18S 2.1 NTA 5' 3' RACE A 260 / 280 RNA RNA 80 lectin LE01F LE01R RNA cdna Kit PCR PCR 1% 300 bp 20 3' RACE cdna TaKaRa 3' Full RACE ( 1A) PCR RACE-PCR 20 lectin 5' 327 bp 1.4 NTA LE02F lectin RNA 3' RACE LE01F (5' TACAAAATGGCTAAGTcDNA 3' RACE-PCR 1% CAAGT 3') LE01R (5' ACCATTCTCGCCTCCAG 3' RACE-PCR 500 bp ( 1B) TGT 3') cdna PCR 532 bp 94 4 min 35 94 30 s 56 30 s 72 1 min 72 10 min 2.2 NTA PCR 1 μl 5' 3' 4 μl pmd18 T 698 bp lectin (Escherichia coli) TOP10 519 bp PCR RNA NTA LE02F cdna PCR (5' GACAAGCCTATCTGGGCAACC 3') lectin 3' RACE cdna ( 1C) 94 3 min 30 94 30 s 57 PCR 1 D 30 s 72 1 min 72 10 min PCR ( 2) lectin 1 μl 4 μl 516 bp 172 1 PCR : A: NTA 5' (327 bp, ); B: 3' RACE-PCR (532 bp, ); C: 1~3: NTA PCR ( ); D: NTA PCR, 1~2: ( ) Figure 1 PCR products checked by electrophoresis Note: A: NTA gene 5' fragment PCR product (327 bp, marked with arrow); B: 3' RACE-PCR products (532 bp, marked with arrow); C: 1~3: PCR products of NTA gene ORF (marked with arrow); D: Lawn PCR of NTA gene ORF, 1~2: Positive clones (marked with arrow)

NTA 219 Cloning and Sequence Analysis of the Lectin Ortholog NTA from Chinensis Narcissus 2 NTA Figure 2 The cdna sequence and its coding amino acids sequence of the NTA of Chinese Narcissus 18 26~131 615.19 Da 5.84 NTA 2.2 NTA lectin (NPL) ( 5B) (Sauerborn et al., 1999) 5A 5B NCBI Blast NTA NTA 25 28 (Lycoris radiate) (Clivia miniata) (Hippeastrum vittatum) (Pang et al., 2002) NTA NTA alpha-d ( 2) 82% NTA 51~59 82~90 114~122 NTA (Narcissus hybrid cultivar) ( 5C ) ( 5 D) QXDXNXVXY 3 (AAA33549 ) (JE0136) (Hester and Wright, 1996; Chandra et al., 1999) (Clivia miniata) (AAA19913) (Lycoris radiata) (BAD98797) 3 (Amaryllis vittata) (agglutinin, AAP57409) 84% 80% 77% 78% 82% Blast DNAMAN DNAStar Cluster W NTA ( 3) lectin 172 NCBI ( 4) NTA NTA 82% NTA 2.3 77% NTA NCBI SWISS MODEL (MBL) NTA ( 5 A) NTA

220 Genomics and Applied Biology www.genoapplbiol.org 3 NTA lectin : (AAA33549); (JE0136); (AAA19913); (BAD98797); (AAW22055); (AAP57409); Figure 3 Multiple alignment of the proteins encoded by NTA and other lectin proteins Note: Narcissus hybrid cultivar (AAA33549); Galanthus nivalis (JE0136); Clivia miniata (AAA19913); Lycoris radiata (BAD98797); Lycoris sp. (AAW22055); Amaryllis vittata (AAP57409); The same as below 4 NTA lectin : (AAP37975); (AAW22055); (AAO595-06); (BAD67183); (AAW48531); (AAW82332) Figure 4 Phylogenetic tree analysis of the proteins encoded by NTA and other lectin proteins Note: Zephyranthes grandiflora (AAP37975); Lycoris sp. (AAW22-055); Crinum asiaticum var. sinicum (AAO59506); Dioscorea polysachya (BAD67183); Allium sativum (AAW48531); Polygonatum roseum (AAW82332) 5 Figure 5 Tertiary protein structure of lectin from Chinensis Narcissus and Narcissus pseudonarcissus

NTA 221 Cloning and Sequence Analysis of the Lectin Ortholog NTA from Chinensis Narcissus NTA (GNA) (NPL) (HIV) (FIV) ExPasy SWISS MODEL (Lopez et al., 2003) NTA 3 QXDXNXVXY 3 Chandra N.R., Ramachandraiah G., Bachhawat K., Dam T.K., 4 Surolia A., and Vijayan M., 1999, Crystal structure of a beta-prism dimeric mannose-specific agglutinin from garlic: quaternary fold 3 association and carbohydrate specificity, J. Mol. Biol., 285 (3): 1157-1168 12 (Hester and Wright, 1996) Guo W.J., Li Y., Tang K.X., Dong Z., Ye M.M., and Shen D.L., 1998, Preliminary study of the introduction and expression of GNA gene in lettuce (L. sativa), Fudan Xuebao (Journal NTA of Fudan University (Natural Science), 37(4): 564-567 ( NPL GNA,,,,,, 1998, GNA 4 (L. sativa), ( ), 37(4): 564-567) beta-prism Hester G., and Wright C.S., 1996, The mannose-specific bulb fold lectin from Galanthus nivalis (snowdrop) binds mono- and dimannosides at distinct sites. Structure analysis of refined NTA complexes at 2.3 A and 3.0 A resolution., J. Mol. Biol., 262 (4): 516-531 Hilder V.A., Powell K.S., Gatehuse A.M.R., Gatehouse J.A., Gatehouse L.N., Shi Y., Hamilton W.D.O., Merryweather A., Newell C.A., Timans J.C., Peumans W.J., Damme E., and (Stagonospora curtisii) Boulter D., 1995, Expression of snowdrop lectin in transgenic tobacco plants results in added protectin against aphids, Transgenic Research, 4(1): l8-25 Hu Y.H., 2001, A biological study of Lectin, Jiangxi Jiaoyu Xueyuan Xuebao (Journal of Jiangxi Institute of Education), 22(6): 47-49 (, 2001,,, 22(6): 47-49) Li F.L., Xu P.Z., Xiao Y., Zhang H.Y., Wang X.D., and Wu X.J., 2006, Plant lectin and its application in the genetic engineering of plant resistance to insects, Anhui Nongye Kexue (Journal of Anhui Agricultural Science), 34(3): 430-432,439 (,,,,,, 2006, (MBL),, (MBL) 34(3): 430-432,439) Li Q.J., Dong Y.T., and Shi B., 2002, Advances on the insect-resistance gene of plant, Linye Keji (Forestry Science and Technology), 27(2): 22-25 (,,, 2002, (MSLs),, 27(2): 22-25) N Liu W.B., Liang F., and Chang T.J., 2000, Construction of a plant

222 Genomics and Applied Biology www.genoapplbiol.org medial expression vector containing snowdrop lectin (GNA) ueyuan Xuebao (Journal of Ningxia Agricultural College), gene for Agrobacterium tumefaciens mediated transformation, 22(2): 25-27 (,,,, 2001, Shangqiu Shifan Xueyuan Xuebao (Journal of,, 22(2): 25-27) Shangqiu Teachers College), 2(16): 100-104 (,, Sauerborn M.K., Wright L.M., Reynolds C.D., Grossmann J.G.,, 2000, and Rizkallah P.J., 1999, Insights into carbohydrate recognition by Narcissus pseudonarcissus lectin: the crystal struc- (GNA),, 2(16):100-104) Lopez S., Armand-Ugon M., Bastida J., Viladomat F., Este J.A., Stewart D., and Codina C., 2003, Anti-human immunodeficiency ture at 2 魡 resolution in complex with alpha1 3 mannobiose, J. Mol. Biol, 290: 185-199 Wang Z.B., Li X.Y., and Guo S.D., 1998, PIant lectins and ansus virus type 1 (HIV 1) activity of lectins from Narcisti-insect genetic engineering, Shengwu Jishu Tongbao species, Planta Med., 69(2): 109-112 Luo S.L., and Zhangsun D.T., 2001, Snowdrop lectin gene and its application, Shengwuxue Tongbao (Bulletin of Biology), 36 (Biotechnology Bulletin), (2): 5-l0 (,,, 1998,,, (2): 5-l0) (12): 9-10 (,, 2001, Ye S.H., Chen S., Zhang F., Wang W., Tian Q., Liu J.Z., Chen F.,,, 36(12): 9-10) Ming K., Wan S.Q., and Gu D.J., 2003, Advances in researches of the introduction and expression of snowdrop lectin gene on insect-resistant transgenic plants, Shijie Nongyao (World and Bao J.K., 2008, Transgenic tobacco expressing Zephyranthes grandiflora agglutinin confers enhanced resistance to aphids, Appl Biochem Biotechnol (online) Zhao Y.S., 2001, The biological function and application of Pesticides), 25(5): 27-30 (,,, 2003, lectin, Anhui Nongye Daxue Xuebao (Journal of Anbui A-,, 25(5): gricultural University (Natural Science Edition)), 28 (4): 27-30) 445-447 (, 2001,, Pang Y.Z., Yao J.H., Shen G.A., Tang K.X., and Tan F., 2002, Molecular cloning of lectin gene from Zephyranthes Candida, Journal of Southwest China Normal University (Natural Science Edition), 27(3): 433-436 (Chinese Journal In English) Poppy G.M., 1997, Tritrophie interactions: Improving ecological understanding and biological control? Endeavour, 21 (2): 61-65 Qu L., Wu B., CaoY.L., and Luo Q., 2001, Discussion on issue in study on transgenic Chinese wolfberry, Ningxia Nongx-, 28(4): 445-447) Zhu Y., 2005, The function and application of agglutinin, Shuichan Kexue (Fisheries Science), 24(12): 48-49 (, 2005,,, 24(12): 48-49) Zhu Y., Zhu Z., and Xu H.L., 1999, Cloning and sequencing of snowdrop lectin cdna and polymorphism analysis, Gaojishu Tongxun (High Technology Letters), 9(9): 36-41 (,,, 1999,,, 9(9): 36-41)