2009 28 2 216 222 Genomics and Applied Biology, 2009, Vol.28, No.2, 216 222 Research Report NTA 1,2 3 2* 1* 1,, 100083; 2,,, 100102; 3,, 100037 *, gaojian@icbr.ac.cn; xinshen77@126.com RT-PCR NTA NTA 698 bp 516 bp 172 5.84 18 615.19 Da 84% 80% 77% 78% 82% alpha-d (QXDXNXVXY), NTA,,, Cloning and Sequence Analysis of the Lectin Ortholog NTA from Chinese Narcissus (Narcissus tazetta var. Chinensis Roem) and Structure Prediction the Protein Liu Wenfeng 1,2 Hou Chenglin 3 Gao Jian 2* Shen Xin 1* 1 Beijing Forestry University, College of Biological Sciences and Biotechnology, Beijing, 100083; 2 International Centre for Bamboo and Rattan, Key Laboratory of Bamboo and Rattan Science and Technology of the SFA, Beijing, 100102; 3 Capital Normal University, College of Life Science, Beijing, 100037 * Corresponding authors, gaojian@icbr.ac.cn; xinshen77@126.com Abstract Lectins are carbohydrate-binding proteins which are important in immune responses. A full-length cdna of a lectin gene designated as NTA was cloned from Chinese Narcissus with the method of RT-PCR. With a size of 698 bp including an 516 bp open reading frame, the NTA encode a precursor lectin with 172 amino acids. The pi and M.W. of the protein NTA were predicted to be 5.84 and 18 615.19 Da, respectively. The homologous analysis showed that the sequence similarity between NTA and those from species as Narcissus hybrid cultivar agglutinin, Galanthus nivalis agglutinin, Clivia miniata agglutinin, Lycoris radiata agglutinin and Hippeastrum vittatum agglutinin were 84%, 80%, 77%, 78%, 82%, respectively. The prediction of the protein structure indicated that tertiary protein structure of lectin from Narcissus was similar to that of Narcissus pseudonarcissus, containing three functional domains specific for agglutination with the consensus sequence motif QXDXNXVXY involved in alpha-d-mannose recognition. Narcissus tazetta var. Chinensis Roem, NTA, Gene cloning, Sequence analysis, Protein structure pre- Keywords diction www.genoapplbiol.org/doi/10.3969/gab.028.000216 948 (2006 4 C07)
NTA 217 Cloning and Sequence Analysis of the Lectin Ortholog NTA from Chinensis Narcissus, 2003;, 2001;, 1999) zga (Ye et al., 2008) (, 2001) Hilder (1995) GNA (, 2006) (GNA) (Narcissus pseudonarcissus) (NPL) (, 2005) (HIV) (FIV) (Lopez et al., 2003) (Narcissus tazetta var. Chinensis Roem) (, 2001) 1 1.1 18~25 (, 2006) RNA 7 (monocot mannose-binding lectin, MBL) 1.2 2 Taq DNA pmd18 T 3' Full RACE (TaKaRa) RT-PCR (galanthus nivalis agglutinin, GNA) (Promega) Trizol reagent (Invitrogen) DNA ( ) Sigma GNA 1.3 RNA cdna (, 1998) (, 2001) RNA Invitrogen Trizol reagent GNA 0.1 g 1.5 ml RNase 4 (, Trizol 1 ml 5 min 200 μl 1998;, 2002;, 2000; Poppy, 1997; 15 s 2~3 min 12 000 g
218 Genomics and Applied Biology www.genoapplbiol.org 4 15 min pmd18 T (E. 500 μl 10 min 12 000 g 4 cdna Promega RT-PCR coli) TOP10 PCR 10 min 1 ml 75% 7 500 g 4 5 min 100 μl DEPC-ddH 2 O 2 28S 18S 2.1 NTA 5' 3' RACE A 260 / 280 RNA RNA 80 lectin LE01F LE01R RNA cdna Kit PCR PCR 1% 300 bp 20 3' RACE cdna TaKaRa 3' Full RACE ( 1A) PCR RACE-PCR 20 lectin 5' 327 bp 1.4 NTA LE02F lectin RNA 3' RACE LE01F (5' TACAAAATGGCTAAGTcDNA 3' RACE-PCR 1% CAAGT 3') LE01R (5' ACCATTCTCGCCTCCAG 3' RACE-PCR 500 bp ( 1B) TGT 3') cdna PCR 532 bp 94 4 min 35 94 30 s 56 30 s 72 1 min 72 10 min 2.2 NTA PCR 1 μl 5' 3' 4 μl pmd18 T 698 bp lectin (Escherichia coli) TOP10 519 bp PCR RNA NTA LE02F cdna PCR (5' GACAAGCCTATCTGGGCAACC 3') lectin 3' RACE cdna ( 1C) 94 3 min 30 94 30 s 57 PCR 1 D 30 s 72 1 min 72 10 min PCR ( 2) lectin 1 μl 4 μl 516 bp 172 1 PCR : A: NTA 5' (327 bp, ); B: 3' RACE-PCR (532 bp, ); C: 1~3: NTA PCR ( ); D: NTA PCR, 1~2: ( ) Figure 1 PCR products checked by electrophoresis Note: A: NTA gene 5' fragment PCR product (327 bp, marked with arrow); B: 3' RACE-PCR products (532 bp, marked with arrow); C: 1~3: PCR products of NTA gene ORF (marked with arrow); D: Lawn PCR of NTA gene ORF, 1~2: Positive clones (marked with arrow)
NTA 219 Cloning and Sequence Analysis of the Lectin Ortholog NTA from Chinensis Narcissus 2 NTA Figure 2 The cdna sequence and its coding amino acids sequence of the NTA of Chinese Narcissus 18 26~131 615.19 Da 5.84 NTA 2.2 NTA lectin (NPL) ( 5B) (Sauerborn et al., 1999) 5A 5B NCBI Blast NTA NTA 25 28 (Lycoris radiate) (Clivia miniata) (Hippeastrum vittatum) (Pang et al., 2002) NTA NTA alpha-d ( 2) 82% NTA 51~59 82~90 114~122 NTA (Narcissus hybrid cultivar) ( 5C ) ( 5 D) QXDXNXVXY 3 (AAA33549 ) (JE0136) (Hester and Wright, 1996; Chandra et al., 1999) (Clivia miniata) (AAA19913) (Lycoris radiata) (BAD98797) 3 (Amaryllis vittata) (agglutinin, AAP57409) 84% 80% 77% 78% 82% Blast DNAMAN DNAStar Cluster W NTA ( 3) lectin 172 NCBI ( 4) NTA NTA 82% NTA 2.3 77% NTA NCBI SWISS MODEL (MBL) NTA ( 5 A) NTA
220 Genomics and Applied Biology www.genoapplbiol.org 3 NTA lectin : (AAA33549); (JE0136); (AAA19913); (BAD98797); (AAW22055); (AAP57409); Figure 3 Multiple alignment of the proteins encoded by NTA and other lectin proteins Note: Narcissus hybrid cultivar (AAA33549); Galanthus nivalis (JE0136); Clivia miniata (AAA19913); Lycoris radiata (BAD98797); Lycoris sp. (AAW22055); Amaryllis vittata (AAP57409); The same as below 4 NTA lectin : (AAP37975); (AAW22055); (AAO595-06); (BAD67183); (AAW48531); (AAW82332) Figure 4 Phylogenetic tree analysis of the proteins encoded by NTA and other lectin proteins Note: Zephyranthes grandiflora (AAP37975); Lycoris sp. (AAW22-055); Crinum asiaticum var. sinicum (AAO59506); Dioscorea polysachya (BAD67183); Allium sativum (AAW48531); Polygonatum roseum (AAW82332) 5 Figure 5 Tertiary protein structure of lectin from Chinensis Narcissus and Narcissus pseudonarcissus
NTA 221 Cloning and Sequence Analysis of the Lectin Ortholog NTA from Chinensis Narcissus NTA (GNA) (NPL) (HIV) (FIV) ExPasy SWISS MODEL (Lopez et al., 2003) NTA 3 QXDXNXVXY 3 Chandra N.R., Ramachandraiah G., Bachhawat K., Dam T.K., 4 Surolia A., and Vijayan M., 1999, Crystal structure of a beta-prism dimeric mannose-specific agglutinin from garlic: quaternary fold 3 association and carbohydrate specificity, J. Mol. Biol., 285 (3): 1157-1168 12 (Hester and Wright, 1996) Guo W.J., Li Y., Tang K.X., Dong Z., Ye M.M., and Shen D.L., 1998, Preliminary study of the introduction and expression of GNA gene in lettuce (L. sativa), Fudan Xuebao (Journal NTA of Fudan University (Natural Science), 37(4): 564-567 ( NPL GNA,,,,,, 1998, GNA 4 (L. sativa), ( ), 37(4): 564-567) beta-prism Hester G., and Wright C.S., 1996, The mannose-specific bulb fold lectin from Galanthus nivalis (snowdrop) binds mono- and dimannosides at distinct sites. Structure analysis of refined NTA complexes at 2.3 A and 3.0 A resolution., J. Mol. Biol., 262 (4): 516-531 Hilder V.A., Powell K.S., Gatehuse A.M.R., Gatehouse J.A., Gatehouse L.N., Shi Y., Hamilton W.D.O., Merryweather A., Newell C.A., Timans J.C., Peumans W.J., Damme E., and (Stagonospora curtisii) Boulter D., 1995, Expression of snowdrop lectin in transgenic tobacco plants results in added protectin against aphids, Transgenic Research, 4(1): l8-25 Hu Y.H., 2001, A biological study of Lectin, Jiangxi Jiaoyu Xueyuan Xuebao (Journal of Jiangxi Institute of Education), 22(6): 47-49 (, 2001,,, 22(6): 47-49) Li F.L., Xu P.Z., Xiao Y., Zhang H.Y., Wang X.D., and Wu X.J., 2006, Plant lectin and its application in the genetic engineering of plant resistance to insects, Anhui Nongye Kexue (Journal of Anhui Agricultural Science), 34(3): 430-432,439 (,,,,,, 2006, (MBL),, (MBL) 34(3): 430-432,439) Li Q.J., Dong Y.T., and Shi B., 2002, Advances on the insect-resistance gene of plant, Linye Keji (Forestry Science and Technology), 27(2): 22-25 (,,, 2002, (MSLs),, 27(2): 22-25) N Liu W.B., Liang F., and Chang T.J., 2000, Construction of a plant
222 Genomics and Applied Biology www.genoapplbiol.org medial expression vector containing snowdrop lectin (GNA) ueyuan Xuebao (Journal of Ningxia Agricultural College), gene for Agrobacterium tumefaciens mediated transformation, 22(2): 25-27 (,,,, 2001, Shangqiu Shifan Xueyuan Xuebao (Journal of,, 22(2): 25-27) Shangqiu Teachers College), 2(16): 100-104 (,, Sauerborn M.K., Wright L.M., Reynolds C.D., Grossmann J.G.,, 2000, and Rizkallah P.J., 1999, Insights into carbohydrate recognition by Narcissus pseudonarcissus lectin: the crystal struc- (GNA),, 2(16):100-104) Lopez S., Armand-Ugon M., Bastida J., Viladomat F., Este J.A., Stewart D., and Codina C., 2003, Anti-human immunodeficiency ture at 2 魡 resolution in complex with alpha1 3 mannobiose, J. Mol. Biol, 290: 185-199 Wang Z.B., Li X.Y., and Guo S.D., 1998, PIant lectins and ansus virus type 1 (HIV 1) activity of lectins from Narcisti-insect genetic engineering, Shengwu Jishu Tongbao species, Planta Med., 69(2): 109-112 Luo S.L., and Zhangsun D.T., 2001, Snowdrop lectin gene and its application, Shengwuxue Tongbao (Bulletin of Biology), 36 (Biotechnology Bulletin), (2): 5-l0 (,,, 1998,,, (2): 5-l0) (12): 9-10 (,, 2001, Ye S.H., Chen S., Zhang F., Wang W., Tian Q., Liu J.Z., Chen F.,,, 36(12): 9-10) Ming K., Wan S.Q., and Gu D.J., 2003, Advances in researches of the introduction and expression of snowdrop lectin gene on insect-resistant transgenic plants, Shijie Nongyao (World and Bao J.K., 2008, Transgenic tobacco expressing Zephyranthes grandiflora agglutinin confers enhanced resistance to aphids, Appl Biochem Biotechnol (online) Zhao Y.S., 2001, The biological function and application of Pesticides), 25(5): 27-30 (,,, 2003, lectin, Anhui Nongye Daxue Xuebao (Journal of Anbui A-,, 25(5): gricultural University (Natural Science Edition)), 28 (4): 27-30) 445-447 (, 2001,, Pang Y.Z., Yao J.H., Shen G.A., Tang K.X., and Tan F., 2002, Molecular cloning of lectin gene from Zephyranthes Candida, Journal of Southwest China Normal University (Natural Science Edition), 27(3): 433-436 (Chinese Journal In English) Poppy G.M., 1997, Tritrophie interactions: Improving ecological understanding and biological control? Endeavour, 21 (2): 61-65 Qu L., Wu B., CaoY.L., and Luo Q., 2001, Discussion on issue in study on transgenic Chinese wolfberry, Ningxia Nongx-, 28(4): 445-447) Zhu Y., 2005, The function and application of agglutinin, Shuichan Kexue (Fisheries Science), 24(12): 48-49 (, 2005,,, 24(12): 48-49) Zhu Y., Zhu Z., and Xu H.L., 1999, Cloning and sequencing of snowdrop lectin cdna and polymorphism analysis, Gaojishu Tongxun (High Technology Letters), 9(9): 36-41 (,,, 1999,,, 9(9): 36-41)