ISSN 100727626 CN 1123870ΠQ Chinese Journal of Biochemistry and Molecular Biology 2008 2 24(2) :148 152 Raldh2 E10175 1),2), 1) 3 ( 1), 130024 ; 2), 130021) Raldh2 1 E61752E 8125, (011 mgπg ), Raldh2 E10175,., 2 (marker gene) Fgf8, 2 Shh Tbx4 Pitx1 Raldh2 E10175., Raldh2 E10175. ; ; ; ; Q81 Raldh2 knock2out Embryos at E10175 Rescued by Retinoic Acid Develop Normal Hindlimbs GAO Yuan2Qi 1),2), ZHAO Xian2Ling 1) 3 ( 1) School of Life Sciences, Northeast Normal University, Changchun 130024, China ; 2) Basic School of Medical Sciences, Jilin University, Changchun 130021, China) Abstract Retinaldehyde dehydrogenase22 (RALDH2) catalyzes retinoic acid (RA) synthesis. Raldh2 knock2 out embryos have no limb buds development, but their embryos at E10175 develop small forelimbs and morphological normal hindlimbs when pregnant female Raldh2 heterozygous knock2out mice were rescued by the food containing retinoic acid (011 mgπg food) from E6175 to E8125. The results of hybridization in situ showed that the expression of proximo2distal marker gene Fgf 8, antero2posterior marker gene Shh and hindlimb specific marker gene Tbx4 and Pitx1 was normal in the hindlimbs of RA rescued Raldh2 knock2out embryos at E10175. This indicated that RA can rescue the normal hindlimbs development of Raldh2 knock2out embryo at E10175. Key words retinoic acid ; retinaldehyde dehydrogenase ; limb bud development ; rescue ; mice (apical ectodermal ridge, AER) (zone of polarizing activity, ZPA) [1]. AER, 2 (proximal2distal axis, Pr2D). AER, [2,3]. (fibroblast growth factor, FGF) AER, AER [4,5]. ZPA, 2 ( anterior2 posterior, A2P ), Sonic hedgehog [6]. AER ZPA [7,8]. (retinoic acid, RA) A,.,,, RA [9,10]. Cyp26 b1 [11], 2 RA 2 :2007208221, :2007210224 (No. 30470903) 3 :Tel : 0431285099627, E2mail : xianling29 @yahoo. com Received : August 21, 2007 ; Accepted :October 24, 2007 Supported by National Natural Science Foundation of China (No. 30470903) and Funding of Research Initiation for Oversea Returning Chinese Scholars 3 Corresponding author Tel : 0431285099627 E2mail : xianling29 @yahoo. com
2 : Raldh2 E10175 149. RA 2, RA beads 3, 10 gπml K PBST 15 min,, 2 42322222324 ( 2 mgπml PBST 5 min. PBST 2 22324), ZPA [12]., 012 % 4 % 30 min., ( retinaldehyde PBST 2, 2 (50 %,ph dehydrogenase, RALDH) 510 5 SSC,1 %SDS, 50 g,50 gπml. RALDH1 RALDH2 RNA), 65 2 3 h. RALDH3, RALDH2, 1 gπml RNA 65., 65 RA. Raldh2 [13,14] 2, 30 min. ph 715,,, MABT [518 % (maleic acid), 4135 % NaCl,. Raldh2 011 % Tween20] 2, 15 min. 1 %, 1 h, 20 % 1 % 2, h.,, [15,16]. PBST,4. MABT 3, 1 h., NTMT ( 011 molπl NaCl, 011 molπl Tris2HCl,pH 915, [17 19]. RA, 0105 molπl MgCl 2, 1 % Tween20) 2, 30 min. Raldh2 E10175 BM purple, PBST.,. 1 111 RA PCR SDS DEPC NaCl Tris MgCl 2 Tween20 PBS tablet Sigma. K Promega. PCR master RNA (blocking reagent) BM purple Roche. 100 bp DNA ladder marker BioPioneer. 1. 2 Raldh2 Raldh2 G. Duester.. Raldh2 ( Raldh2 KO) Timed mating. 12 015 d( E015). 1. 3 RA 50 mg RA 1 ml DMSO. E6175 E7125 E7175, RA (011 mgπg ), Raldh2. E8125,, Raldh2 E10175. 1. 4 Wilkison [20] : PBS 2 4 %,4. PBST( 011 % Tween20 PBS) 25 % 50 % 75 % 100 %, 75 % 50 % 25 %. 6 %H 2 O 2 1 h,pbst 115 (yolk sac), K 55, DNA. PCR :P1 Raldh2 2 3, : 5 2GAAGCAGACAAGGTGTGTATTG23 ; P2 Raldh2 3 5, : 5 2 CCTTGTCTATATCCACCTGTTA 23. P3 ( hygromycin ) 5, 5 2 GCCGACCTATTGCATCTCCCG23 ; P4 3, : 5 2GCCATGTAGTGTATTGACCGATTCC 2 3. PCR : 94 5 min ; 94 30 s, 60 30 s, 72 1 min, 40 ;72 10 min. PCR 2 %. 1. 6 RNA Fgf8 Shh Tbx4 and Pitx1 RNA DNA G. Matin, A. McMahon, V. Papaioannou M. Logan. DNA, Roche RNA. 2 211, DNA PCR. Raldh2, Raldh2 3 4. P1 P2 WT (wild type) Raldh2
150 24 Fig. 1 Genotype of embryos was analyzed by PCR 1 7 :PCR results of yolk sac DNA from rescued embryos of the same litter M: 100 bp DNA ladder marker ; 1 : Wild type, 240 bp ; 2, 3 and 7 : Homozygous knock2out, 186 bp ; 4, 5 and 6 : Heterozygous knock2out, 186 bp and 240 bp out) 186 bp DNA. Het (heterozygous knock2out) WT KO DNA. PCR Fig. 1. 212 Fgf8 Shh RA Raldh2 E10175 E10175 WT KO Wilkison [20] Fgf8 Shh RNA., E10175 KO, WT. Fgf8 E10175 KO AER( n = 4 of 4) Shh ZPA ( n = 5 of 5) WT (Fig. 2). 213 Tbx4 Pitx1 RA Raldh2 E10175 E10175 WT KO Wilkison [20] Tbx4 Pitx1 RNA., Tbx4 ( n = 6 of 6) Pitx1 ( n = 5 of 5) WT KO (Fig. 3). Fig. 2 The expression of Fgf8 and Shh in hindlimb of Raldh2 KO embryos at E10175 rescued by RA from E6175 to E8125 Whole mount in situ hybridization analysis of wild type ( WT) and RA rescued Raldh2 KO embryos at E10175 with probe of Fgf8 (A,B), Shh (C, D) showed that expression of Fgf8 in AER and Shh in ZPA is normal. AER : apical ectodermal ridge ; ZPA : zone of polarizing activity ; f, forelimb ; h : hindlimb ; WT: wild type ; KO, knock2out ; res : rescue 2 3 240 bp DNA. P3 P4 KO (homozygous knock2 Fig. 3 The expression of Tbx4 and Pitx1 in hindlimb of Raldh2 KO embryos at E10175 rescued by RA from E6175 to E8125 Whole mount in situ hybridization analysis of wild type ( WT) and RA rescued Raldh2 KO embryos at E10175 with probe of Tbx4 (A,B), Pitx1 ( C, D ) showed that expression of Tbx4 and Pitx1 in hindlimb mesenchyme is normal. f, forelimb ; h : hindlimb ; WT: wild type ; KO, knock2out ; res : rescue
2 : Raldh2 E10175 151 3. RA [13,14],RA [11], RA [21,22] RA. Raldh2,. Mef2 c Raldh2 [23], RA (e6175 8125) Raldh2.,E10175, 2 (marker gene) Fgf8 2 Shh Tbx4 Pitx1 Raldh2 E10175. Raldh2 E10175. E10175,. E10175,, [15,16].,,. Raldh2, RA. RA (e6175 8125), RA RA RA., e6175,.,ra, WT ( ),., E10175 RA RA. Raldh3 [24], RA Raldh2 E10175 ( ), Raldh3 RA, E10175., Raldh2ΠRaldh3 (double knock2out),.,, Fgf8 Shh dhand Meis2 Hoxd11 Hoxd12., Tbx5 [17,18], Tbx4 Pitx1 [19].,., microrna mir2196 Hoxb8 mrna [25],. RA, RA, Raldh2 E10175,., RA, RA Cyp26 b1 [11] VAD (vitamin A deficiency) [25]. Raldh2 E10175,. (30470903). G. Matin ( Fgf8), A. McMahon ( Shh), V. Papaioannou( Tbx4) M. Logan ( Pitx1) RNA. Gregg Duester Raldh2 +Π-. ( References) [ 1 ] Johnson R L, Tabin J C. Molecular models for vertebrate limb development[j ]. Cell, 1997, 90(6) : 9792990 [ 2 ] Saunders J W Jr. The proximo2distal sequence of origin of the parts of the chick wing and the role of the ectoderm [J ]. J Exp Zool, 1998, 282(6) : 6282668 [ 3 ] Summerbell D. A quantitative analysis of the effect of excision of the AER from the chick limb2bud [J ]. J Embryo Exp Morphol, 1974, 32 (3) : 6512660 [ 4 ] Niwander L, Tickle C, Vogel A, et al. Fgf4 replaces the apical ectodermal ridge and directs outgrowth and patterning of limb [J ]. Cell, 1993, 75(3) : 5792587 [ 5 ] Lewandoski, M, Sun X, Martin G R. Fgf8 signaling from AER is essential for normal limb development [J ]. Nat Genet, 2000, 26 (4) : 4602463 [ 6 ] Riddle R D, Johnson R L, Laufer E, et al. Sonic hedgehog mediates the polarizing activity of the ZPA[J ]. Cell, 1993, 75(7) : 140121416 [ 7 ] Niwander L, Jeffrey S, Martin G R, et al. A positive feedback loop coordinates growth and patterning in the vertebrate limb [J ]. Nature, 1994, 371(6498) : 6092612 [ 8 ] Laufer E, Nelson C E, Johnson R L, et al. Sonic hedgehog and Fgf4 act through a signaling cascade and feedback loop to integrate growth and patterning of developing limb bud[j ]. Cell, 1994, 79 (6) : 9932 1003 [ 9 ] Brockes J P. Amphibian limb regeneration : rebuilding a complex structure[j ]. Science, 1997, 276(5309) : 81287 [10] Crawford K, Stocum D L. Retinoic acid proximalizes level2specific properties responsible for intercalary regeneration in axolotl limbs[j ]. Development, 1988, 104(4) : 7032712 [11 ] Yashiro K, Zhao X, Uehara M, et al. Regulation of retinoic acid distribution is required for proximodistal patterning and outgrowth of the developing mouse limbs [J ]. Dev Cell, 2004, 6(3) : 4112422 [12] Tickle C, Alberts B, Wolpert L, et al. Local application of retinoic
152 24 acid to the limb bond mimics the action of the polarizing region [J ]. Nature, 1982, 296(5857) : 5642566 [13] Niederreither K, Subbarayan V, Dolle P, et al. Embryonic retinoic acid synthesis is essential for early mouse post2implantation development [J ]. Nat Genet, 1999, 21(4) : 444 2448 [14] Mic F A, Haselback R J, Cuenca A E, et al. Novel retinoic acid generating activities in the neural tube and heart identified by conditional rescue of Raldh2 null mutant mice [ J ]. Development, 2002, 129(9) : 227122282 [15] Mic F A, Sirbu I Q,Duester G.. Retinoic acid synthesis controlled by Raldh2 is required early for limb bud initiation and then later as a proximodistal signal during apical ectodermal ridge formation [J ]. J Biol Chem, 2004, 279(25) : 26698226706 [16] Niederreither K, Vermont J, Schuhbaur B, et al. Embryonic retinoic acid synthesis is required for forelimb growth and anteroposterior patterning in the mouse [J ]. Development, 2002, 129 (15) : 35632 3574 [17] Rallis C, Bruneau B G, Del Bunono J, et al. Tbx5 is required for forelimb bud formation and continued outgrowth [J ]. Development, 2003, 130(12) : 274122751 [18] Agarwal P, Wylie J N, Galceran J, et al. Tbx5 is essential for forelimb bud initiation following patterning of the limb field in the mouse embryo [J ]. Development, 2002, 130(3) : 6232633 [19] Logan M, Tabin CJ. Role of Pitx1 upstream of Tbx4 in specification of hindlimb identity[j ]. Science, 1999, 283(5408) : 173621739 [20] Wilkison D G. Whole mount in situ hybridization of vertebrate embryos. In situ hybridization : A practical Approach [ M]. Oxford : IRL Press, 1992 : 75283 [21] Lohnes D M, Mark C, Mendelsohn P, et al. Function of the retinoic acid receptors ( RARs) during development ( I) Craniofacial and skeletal abnormalities in RAR double mutants [ J ]. Development, 1994, 120(10) : 272322748 [22] Kastner P, Mark M, Chambon C. Nonsteroid nuclear receptors : What are genetic studies telling us about their role in real life? [J ]. Cell, 1995, 83(6) : 8592869 [23],,. Raldh2 [J ] ( Gao Yuan2Qi, Su Xun2Rui, Zhao Xian2Ling. The rescue of limb bud initiation in Raldh2 mutant [J ]. J Mol Sci ), 2007,23(2) : 96298 [24] Gruu F, Hirose Y, Kawauchi, S, et al. Aldehyde dehydrogenase 6, a cytosolic retinaldehyde dehydrogenase prominently expressed in sensory neuroepithelia during development [J ]. J Biol Chem, 2000, 275(52) : 41210241218 [25] Hornsein E, Mansfield J H, Yekta S, et al. The microrna mirna2 196 acts upstream of Hoxb8 and Shh in limb development [J ]. Nature, 2005, 438(7068) : 6712674 [26] Stratford T, Logan C, Zile M, et al. Abnormal anteroposterior and dorsoventral patterning of the limb in the absence of retinoids [J ]. Mech Dev, 1999, 81(122) : 1152125