20 4 2004 7 Chinese Journal of Biotechnology Vol. 20 No. 4 July 2004 2 1,2 3 3 1 1,2 3 1 (, 214036) 2 (, 210097) 2, Thermotoga maritima, Thermotoga T. maritima 2, AGA AGGAUA, BL212CodonPlus(DE3)2RIL, 20 % 5 ; Ni 2 +,, 511, 5511 %, TB, OD 600 017018 IPTG 5h, 2,,, Q814 A 100023061 (2004) 0420554207, 517, 42O2, 20 %30 %, [1 ] 25 %50 %,, 2, 21,4, 1,32 1,2242O2, [1,5, ],,, 2 [2 ] (endo 21,42xyla2 Thermotoga maritima nase, EC 3121118),, 2 5590, [6-10 ] ( 21,42xylosidase,EC 31211137),,, ( 2L2arabinofuranosidase, EC 31211155) 2D2 ( 2D2glucuronidase, EC 312111139) ( EC3111116) [3,4 ], :2003-11-28, :2004-04-05 : 211 3 Tel :86-510-5879781 ; Fax :86-510-5869645 ; E-mail : wl. shao @pub. wx. jsinfo. net 3 3 :Tel :86-25-83598838 ;Fax :86225283598838,,
4 : 2 555,, T. maritima : 015 %, 80,, 8h xynb 2 11212 : DNA DNA [7-10 ] agua,, DNA, 2, [ 11 ] DNA T7 pet, Qiagen,T. maritima 2 11213 PCR agua : Gen2, BL212CodonPlus Bank agua,n (5 2 (DE3)2RIL agua,ccgttccatggactacaggatgtgc23 ) 2 Nco, C ( 5 2CCGCTCGAGCG2, GATATATCTTTCTTCCCTT23 ) Xho 1 111 ; 94 50s, 62 115 min, 72 11111 : T. maritima 3 min, 35 72 10 min, ATCC43589, E. coli JM109 JM109 ( DE3 ) Promega ( Wisconsin, WI, USA), pet228a ( + ) pet220b E. coli BL21 (DE3) BL212CodonPlus (DE3)2RIL Novagen 11112 : Xho, Nco, T4 DNA Pyrobest DNA, 11215 DNA : Sanger,,Rapid Affinity Purification Kit Novagen ; K IPTG ; 42 11216 : O2 2D2 21,42 pet228a ( + )2aguA BL212CodonPlus Sigma ; QIAprep Spin Plasmid Miniprep Kit QIAquick Gel Extraction Kit,37 ;500 L Qiagen 011 g, ( [6,10 ] ) 15 ml, ph 710 2 Na 2 S 015 gπl, 100 ml 42O2MeGlcA,,, PCR : 95 5min, Pyrobest DNA 11214 : PCR pet228a ( + ) Nco Xho,T4, pet228a ( + )2aguA pet228a ( + )2aguA agua Nco Xho, pet220b, pet220b2agua (DE3)2RIL, Kna Cam LB 100 ml Kna Cam LB,37 112 OD 600 017018, IPTG 11211 : LB 1mmolΠL, agua TB, SOC, ; IPTG : (Amp ) 50 100 1mmolΠL, 5h, agua gπml, ( Kna) 30gΠmL, (Cam) 60gΠmL, [11 ] 11217 2 ( [ 10, T. maritima ( 12]) : 2 42O2 ) : 015 g, ( resazurin) 1mg, 2 % 42O2 2D2 NaCl 28 g, MgSO 4 7H 2 O 315 g, MgCl 2 6H 2 O 217 g, 0105 mgπml 21,42,55 KCl 0133 g, NH 4 Cl 0125 g, CaCl 2 010855 g, 16 h, 50 15, - 20 MeGlcAX 2,
556 20 [13,, (Sigma Inc. ) ] 10min,,620nm 2 211 agua 1mol 2 1 6 PCR,2 kb agua 2 ph pet228a ( + )2aguA Sanger, min ph ph 415 810 100 mmolπl Tris2,pH 815, 910 100 mmolπl Tris2HCl ph 517 Tris2 5min ; 55,65,75,85,95 1 h(ph 517 Tris2 ), 11218 (1) : pet228 ( + )2aguA E. coli BL212CodonPlus(DE3)2RIL, 1 % 015 % 1 %NaCl pet228a ( + )2aguAΠNco, Xho ; 6 : PCR amplified fragments 01003 % Kna 01006 % Cam, 212 37, 200rΠmin, 2 1 3 1 % 4 250 ml Kna pet220b2agua Nco Xho Cam LB 1L 37,, 5 pet228a ( + )2aguA 220 rπmin OD 600 016018 IPTG, Nco Xho 018 mmolπl, 4 h,4,5 000 g PCR ( 20 min 1), agua pet220b (2) : pet228a ( + ) (5mmolΠL 20mmolΠL Hris2HCl, ph 719), ( French Pressure,Thermo), 9 600 g 20 min, 70 20 min,9 600 g 30 min, (3) Ni 2 + : 0145m (Novagen) (116cm 2cm), (60mmolΠL 20mmolΠL Tris2HCl, ph 719), (1molΠL 20 mmolπl Tris2HCl, ph 719), 015 mlπmin, 1 ml, 3,SDS2 PAGE 11219 SDS2PAGE : 12 %, R250, FR200 Fig. 2 Construction of plasmid pet220b2agua 112110 : Bradford and pet228a ( + )2aguA 2 ph, ph 40 PCR [10 ] 1 DNA Fig. 1 Agarose gel electrophoresis of DNA 1 : 2 EcoT141 digeast DNA marker ; 2 : pet220bπnco, Xho ; 3 : pet220b2aguaπnco, Xho ;4 :pet228a ( + )ΠNco, Xho ; 5 : 2
4 : 2 557 213 agua 214 BL212CodonPlus ( DE3) 2RILΠpET228a pet220b2agua pet228a ( + )2 agua JM109 (DE3) BL21 (DE3) BL212CodonPlus(DE3)2RIL, IPTG, (DE3)2RILΠpET228a ( + )2aguA,, SDS2 LB ( PAGE( 12 %), 4), 12 h 3, agua, OD 600,5 h, pet220b,, OD 600 pet228a ( + ), LB 1, JM109 (DE3) BL21 (DE3),TB pet228a ( + )2aguA BL212CodonPlus (DE3)2RIL, 72kD, ; ( 1), T. Maritima 5, 10 [10 ], AguA 20 %, agua pet228a ( + ) 3 SDS2PAGE Fig. 3 SDS2polyacrylamide gel (12 %) of 2glucuronidase after induced expression 1 :molecular mass markers ; 2 : E. coli BL212CodonPlus (DE3) 2 RILΠpET228a ( + ) ; 3 : E. coli JM109 (DE3)ΠpET228a ( + )2 agua ; 4 : E. coli BL21 (DE3)ΠpET228a ( + )2aguA ; 5 : E. coli BL212CodonPlus ( DE3)2RILΠpET228a ( + )2aguA ; 6 : purified products; 7 : E. coli BL212CodonPlus ( DE3 ) 2RILΠpTrc99A2 agua ; 8 : E. coli BL212CodonPlus(DE3) 2RIL ΠpET220b2aguA IPTG, 1 2 Table 1 Analysis of 2glucuronidase from engineered strain Expressed product Enzyme activity Π(uΠmg) BL212CodonPlus(DE3) 2RILΠpET228a( +) BL212CodonPlus(DE3) 2RILΠpET228a( +)2aguA Wild strain 010 913 211 ( + )2aguA BL212CodonPlus 4 BL212CodonPlus(DE3) 2RILΠ pet228a ( + )2aguA Fig. 4 Growth curve of recombinant BL212CodonPlus (DE3)2RILΠpET228a ( + )2aguA 5a,, IPTG 5 h,,,, OD 600 01815 3105 5120 6166, IPTG, 5 h, 5b,IPTGOD 600 01815, OD 600 3105,, OD 600 017310, ( 2), OD 600 017018 215 IPTG BL212CodonPlus ( DE3) 2 RIL ΠpET228a ( + )2aguA, 70 20min, 0145m Poly2His,SDS2PAGE,, 90 %,, ( 6)
558 20 5 Fig. 5 The optimum induction conditions of the expression of the recombinant enzyme A :effect of induction duration on the synthesis of 2glucuronidase ; B : effect of induction time on the synthesis of 2glucuronidase 2 Table 2 Effect of induction time on the synthesis of 2glucuronidase No. OD 600 a OD 600 b Enzyme activityπ(uπml) Specific activityπ(uπmg) 1 01714 11030 11192 913 2 11249 31285 11147 312 3 1176 3146 11071 219 4 21115 31075 01811 216 5 2177 5118 01833 115 6 31925 5115 01852 116 a :cell density before induction ; b : cell density in the end of induction 610, 85, 85 1h 70 % NaCl 2 6 2 SDS2PAGE, NaCl 012 Fig. 6 SDS2polyacrylamide gel (12 %) of thermostable 2glucuronidase purification steps 1 :molecular mass markers ; 2 : crude extract of E. coli BL212CodonPlus (DE3)2RIL ΠpET228a ( + ) ; 3 :crude extract of E. coli BL212Condon Plus(DE3)2RILΠpET228a ( + )2aguA ; 4 : crude extract of E. coli BL212 CodonPlus(DE3)2RILΠpET228a ( + )2aguA after heat precipitation ; 5 : immobilized metal affinity chromatography 3, 511, 5511 % 216 2, (72a, b, c), ph molπl ( 72d ), T. maritima 2 3 2 Table 3 Purification of thermostable 2glucuronidase from engineered Strain Step Total proteinπmg Specific activityπ(uπmg) Total activityπu RecoveryΠ% Purification fold Crude extract 12311 419 61018 100 1 Heat treatment 3917 1115 45518 7416 213 Immobilized metal affinity 1315 2419 33612 5511 511
4 : 2 559 3 7 2 ph(a) (b) (c) NaCl (d) Fig. 7 The optimal ph (a), the optimal temperature (b) and thermostability (c) of expressed 2glucuronidase and inhibiting effect from NaCl (d), pet220b2, agua BL212CodonPlus(DE3)2RIL,, pet220b T. maritima 2,, T7 Thermotoga 2 [10 ], pet228a ( + ), BL212CodonPlus (DE3)2RIL,, 2, TB, BL212CodonPlus 20 %,1L 90 % (DE3)2RILΠpET228a ( + )2aguA 40mg, 1315mg, 6163, agua pt727,10l, [10 313mg ] AguA, 2 ;, [16, pet228a, ] ( + )2aguA,, E. coli JM109 (DE3) BL21 (DE3), 2 2,, AguA 70 20min BL212CodonPlus (DE3)2RIL,, 90 %, pet228a ( + )2aguA 7416 % 2,, AGG AGA AUA CCC 914 % AGGAGA agua REFERENCES( ) 85 % BL212CodonPlus ( DE3) 2 RIL (AGA AGG) [ 2 ] Xue YM ( AUA CUA CCC, trna,argu trna iley trna leuw trna, AGAΠAGG AUA CUA, agua BL212CodonPlus (DE3)2RIL, agua AGA AGG AUA CCC [14,15 ] [ 1 ] Sunna A, Autranikian G. Xylanolytic enzymes from fungi and bacte2 ria. Critical Review in Biotechology, 1997, 17(1) :39-67 ),Mao ZG ( ),Liu HL ( ) et al. Advances in the studies on 2glucuronidase. Forestry Chemistry and Industry ( ),2002,22(4) :75-79 [ 3 ] Xue YM ( ),Shao WL ( ),Mao ZG ( ). The xylan2degrading enzymes system from microorganism. ( ), 2003,13 (1) : 36-38 Biotechnology [ 4 ] Shao WL ( ), Xue YM ( ). Molecular biotechnology
560 20 in exploiting the resource of hemicellulose. Journal of Food Science and Biotechnology ( ), 2002, 21(1) :88-93 [ 5 ] Beg QK, Kapoor M, Mahajan L et al. Microbial xylanases and their industrial applications : a review. Appl Microbiol Biotechnol, 2001, 56 : 326-338 [ 6 ] Rober H, Thomas AL, Helmut K et al. Thermotoga maritima sp. nov. represents a new genus of unique extremely thermophilic eubac2 teria growing up 90. Arch Microbiol, 1986,144 : 324-333 [ 7 ] Christoph W, Wolfgang L. Two extremely thermostable xylanases of the hyperthermophilic bacterium Thermotoga maritima MSB81 Appl Environ Microbiol, 1995, 61 : 1810-1815 [ 8 ] David JS,Liam CW,Rosalind AR et al. Sequence and expression of xylanase gene from sp strain Fjss32B. 1 and characterization of recom2 binant enzyme and its activity on kraft pulp. Appl Environ Microbiol, 1995, 61 :4110-4113 [ 9 ] Jiang ZQ ( ),Li LT ( ),Lin Q ( ) et al. Clo2 ning and expression of an xynb gene in E. coli. from the extreme2 thermophilic thermotoga maritima. Chin J Appl Environ Biol ( ), 2002, 8 (3) :280-284 [10 ] Ruile P, Winterhalter C, Liebl W. Isolation and analysis of a gene encoding 2glucuronidase, an enzyme with a novel primary structure involved in the breakdown of xylan. Mol Microbiol, 1997, 23 :267-279 [11 ] Sambrook J, Fritsch EF, Maniatis T. Molecular Cloning : A Labora2 tory Manual. 2 nd ed, New York : Cold Spring Harbor Laboratory Press, 1989 [12 ] Milner Y, Avigad G. A copper reagent for the determination of hexu2 ronic acids and certain ketohexoses. Carbohydr Res, 1967, 4 :359-361 [13 ] Bradford MM. A rapid and sensitive method for the quantitation of microgrom quantities of protein utilizing the principle of protein2dye2 binding. Anal Biochem, 1976,72 : 5848-5853 [14 ] Spanjiaard RA, Chen K, Walker JR et al Frame shift suppression at tandem AGA and AGG dodons by cloned trna genes : assigning a codon to argu trna and T4 trna Arg. Nucleic Acids Res, 1990, 18 : 5031-5036 [15 ] Spanjiaard RA, Duin J. Translation of the sequence AGG2AGGyields 50 % ribosomal frameshift. Proc Natl Acad Sci USA, 1988, 85 : 7967-7971 [16 ] Li YY( ). Gene Expression Technology. Beijing : China Sci2 ence Press, 2001 Expression and Purification of Thermostable 2Glucuronidase from Thermotoga maritima XUE Ye2Min MAO Zhong2Gui SHAO Wei2Lan 3 ( The Key Laboratory of Industrial Biotechnology, Ministry of Education, Southern Yangtze Univercity, Wuxi 214036, China) Abstract The xylanolytic enzymes found in Thermotoga maritima showed extremely high thermostability and considerable po2 tential in industrial application. Yet expression level of the genes encoding these enzymes was very low. The 2glucuronidase gene agua from T. maritima ATCC 43589 was cloned and expressed in several E. coli strains with different vector. The 2glu2 curonidase was overexpressed in E. coli BL212CodonPlus(DE3) 2RIL with plasmid pet228a( + ), and made up about 20 % of the total proteins present in the intracellular soluble fraction. The results proved the assumption that rare codons for arginine (AGAΠAGG) and isoleucine (AUA) affect the expression of agua gene from hyperthermophilic bacterium T. maritima in E. coli. Purification procedure included two steps, heat treatment and immobilized metal affinity chromatography, and over 1315mg of pure enzyme was obrained from 1L of induced culture. The purified enzyme showed a single band on SDS polyacrylamide gel electrophoresis with a purification of 511 fold, and a yield of 5511 %. The optimum activity of recombinant 2glucuronidase was found at ph 610 and 85,the enzyme retained 70 % of its activity after 1 h of incubation at 85. The induction conditions for expression of recombinant strain BL212CodonPlus ( DE3) 2RILΠpET228a2aguA were studied on induction time and duration by IPTG. The results showed that the activity of thermostable 2glucuronidase reach the maximum in 52hour after inducted at the ex2 ponential phase ( OD 600 of 017018). Key words Thermotoga maritima, 2glucuronidase, gene overexpression, recombinant enzyme purification, characterization Received : 1122822003 This work was supported by Grant from 211 Fund of Ministry of Light Industry of Country. 3 Corresponding author. Tel : 86251025879781 ; Fax : 86251025869645 ; E2mail : wl. shao @pub. wx. jsinfo. net