Expression of Porcine SFRP4 and Its Effect on Differentiation of Preadipocytes via Inhibitor SP600125

ISSN 1007-7626 CN 11-3870 / Q http / / cjbmb bjmu edu cn Chinese Journal of Biochemistry and Molecular Biology 2012 5 28 5 455 ~ 463 SFRP4 SP600125 * 712100 4 secreted frizzled-related protein 4 SFRP4 Wnt Solexa PCR RT-qPCR SFRP4 JNK SP600125 JNK SFRP4 mrna SFRP4 P < 0 01 SFRP4 SFRP4 SP600125 PPARγ FABP4 ATGL Perilipin P < 0 01 SFRP4 4 SP600125 Q78 Q246 Expression of Porcine SFRP4 and Its Effect on Differentiation of Preadipocytes via Inhibitor SP600125 GUAN Hua ZHENG Jia-Meng CHEN Zong-Zheng SONG Zi-Yi YANG Hao YANG Gong-She * Laboratory of Animal Fat Deposition and Muscle Development College of Animal Science and Technology Northwest A&F University Yangling 712100 Shaanxi China Abstract Secreted frizzled-related protein 4 SFRP4 was the regulator of Wnt signaling pathway The expression of SFRP4 in fat tissues of different genotype pigs and in different growth periods were explored by high-throughout sequencing Solexa and real-time quantity PCR RT-qPCR The effect on differentiation of preadipocyte and the expression level of SFRP4 were explored by inhibitor SP600125 in JNK signaling pathway The results showed that expression level of SFRP4 was higher in fat tissues of obese-type than that in the lean-type Expression level of SFRP4 in the porcine fat tissue and adipocyte was influenced by ages and was higher in fat but lower in other tissues SP600125 promoted the adiocytes to differentiate and significantly increased expression levels of PPARγ FABP4 ATGL Perilipin but the SFRP4 expression level was inhibited significantly This research provides a new reference for screen the key genes in adipocyte differentiation Key words secreted frizzled-related protein 4 high-throughput sequencing preadipocyte inhibitor SP600125 differentiation 2012-01-09 2012-03-15 No 2009ZX08009-157B * Tel 029-87092430 E- mail gsyang999@ hotmail com Received January 9 2012 Accepted March 15 2012 Supported by Genetically Modified Organisms Breeding Major Projects No 2009ZX08009-157B * Corresponding author Tel 029-87092430 E- mail gsyang999@ hotmail com

456 28 4 secreted frizzled- related protein 4 SFRP4 1997 Rattner 1 1 2 SFRP4 1 Wnt 15 Wnt 2 5 10 4 / cm 2 SFRP4 3 4 ~ 9 60 mm 10% 10 DMEM / F12 37 5% CO 2 1 d 2 d 1 SFRP4 Fzd5 Wnt7a 100% 15 μmol / L Wnt7a JNK SP600125 24 h 48 h 72 h 11 3 DMSO 3 JNK RNA 12 ~ 13 JNK SFRP4 1 3 14 Ouchi 16 PBS I SFRP4 37 30 min 1 000 r / min 5 min SFRP4 adipocyte AD PCR AD SVF RNA RT-qPCR SFRP4 SFRP4 mrna mrna 1 4 Solexa 17 JNK RNA 1 ~ 2 g Oligo dt beads SP600125 JNK RNA mrna cdna 4 JNK SFRP4 Nla III cdna Illumina 1 1 1 3 3 1 5 ~ adapter 2 5 kg 0 5% 0 5 hn 1 Clean Tag Clean tag Clean tag 3 240 4 180 4 Clean tag Trizol RT TaKaRa RTqPCR DMEM / 1 5 PCR F12 I Gibco DMEM / F12 Hyclone PVDF ECUL Invtrogen SFRP4 anti-goat β-actin p-jnk anti-mouse Santa Cruz JNK SP600125 Sigma stromal vascular fractions SVF adapter1 Mme I 3' 20 3 ' Illumina adapter2 Primer GX1 Primer GX2 PCR 6% TBE PAGE 85 Illumina Clean tag β-actin SFRP4 PPARγ FABP4 ATGL Perilipin RT-qPCR NCBI Table 1

5 SFRP4 SP600125 457 Table 1 Primer sequences and parameters for RT- qpcr amplification of the related genes Gene GenBank accession number Primer sequence 5'-3' Length / bp β-actin AF054837 FP GGACTTCGAGCAGGAGATGG 138 RP AGGAAGGAGGGCTGGAAGAG SFRP4 NM_001128465 1 FP TGCCAGTGTCCTCACATCCTAC 168 RP GACTGTCCTCTGCTGCTCCTG PPARγ NM_214379 FP AGGACTACCAAAGTGCCATCAA 142 RP GAGGCTTTATCCCCACAGACAC Perilipin NM_214200 1 RP CAGCCAAGGAAGAGTCAGC 107 FR CCTGGAAGGTGTGTTGAGAG FABP4 NM_001002817 1 RP GAGCACCATAACCTTAGATGG 121 FP AAATTCTGGTAGCCGTGACA ATGL NM_001098605 1 RP CCTCATTCCACCTGCTCTCC 90 FP GTGATGGTGCTCTTGAGTTCGT - 70 SP600125 DMSO RNA 1 8 cdna SPSS18 0 One-way 1 RT cdna ANOVA SYBR Green I ± Mean ± SE PCR 2 20 μl cdna 1 μl FP RP 1 μl ReaulMasterMix / SYBR solution 9 μl ddh 2 O 20 μl PCR 95 3 min 95 30 s 61 30 s 72 30 s Solexa 3 240 35 72 SFRP4 mrna C t β-actin SFRP4 PPARγ FABP4 Perilipin ATGL PCR Fig 1A - 3 2 CT PCR 3 240 β-actin 1 6 O PBS 3 4% O 3 2 3 30 min 3 240 SFRP4 1 7 Western mrna SFRP4 Fig 2A PCR 100 mg 1 ml 18 1 5 ml 2 1 SFRP4 SFRP4 SFRP4 mrna Fig 1B 37 30 min PBS 10 min 3 2 2 SFRP4 Solexa 180 SFRP4 mrna SFRP4 PBS 1 200 μl Fig 2B 2 3 SFRP4 4 PCR 180 12 000 r / min 10 min SFRP4 mrna 100 5 min SFRP4

458 28 Fig 1 Variation of abundance for SFRP4 in pig fat tissues of different growing phases Two RNA pools of subcutaneous adipose tissue one from 3 days old pigs one from 240 days pigs were used in the expression analysis of SFRP4 All experiments repeated three times Both Solexa sequencing and RT-qPCR analysis revealed that SFRP4 expression level was increased as the age increasing P < 0 01 n = 3 A Expression level of SFRP4 in 3 days old and 240 days old pig fat tissues by Solexa sequencing analysis P < 0 01 n = 3 B Relative expression level of SFRP4 in 3 days old 240 days old pig fat tissues by RT-qPCR P < 0 01 n = 3 Fig 2 Variation of abundance for SFRP4 in different breed pig fat tissues Two RNA pools of subcutaneous adipose tissues one from four 180 days old pigs lean type and one from four 240 days old pigs obese type were used in the expression analysis of SFRP4 All experiments repeated three times Both Solexa sequencing and RT-qPCR analysis revealed that SFRP4 was much higher expressed in obese type porcine fat tissue than in lean type porcine fat tissue P < 0 01 n = 3 A Expression levels of SFRP4 in lean type and obese type porcine fat tissues by Solexa sequencing analysis P < 0 01 n = 3 B Relative expression levels of SFRP4 in lean type and obese type pig fat tissues by RT-qPCR P < 0 01 n = 3 Fig 3A mrna Fig 4C Fig 3B 2 4 SFRP4 2 4 1 Fig 4D 24 h 2 4 2 SFRP4 SFRP4 Fig 4A RT-qPCR Western 80% 0 d 2 d 3 2 d 4 d 6 d 8 d 2 d 0 d 2 d 4 d 6 d 8 d AD Fig 4B 8 d O SVF RT-qPCR SFRP4 mrna

5 SFRP4 SP600125 459 Fig 3 Relative expression levels of SFRP4 in normal pig tissues lean type Collected 180 days various white pig tissues WAT white adipocyte tissue Heart Liver Spleen Lung Kidney S muscle Skeletal muscle and Brain and extracted total RNA and total protein SFRP4 expression levels were determined in different tissues by RT-qPCR and Western blotting and calculated with the 2 - CT method as normalization with β-actin All experiments repeated three times The expression level of SFRP4 is highest in WAT A The mrna expression level of SFRP4 qualified by RT-qPCR n = 3 B Western blot analysized the SFRP4 protein level of various tissues n = 3 Fig 5 Expression of SFRP4 during the pig adipocyte differentiation in vitro Preadipocytes separated from adipose of piglets were directly plated in DMEM / F12 medium differentiated induced and harvested at various time points as indicated extracted total RNA and total protein SFRP4 expression levels were determined by RT-qPCR and - Western blotting and calculated with the 2 CT method as normalization with β-actin All experiments were repeated three times A C RT-qPCR and Western blotting qualified the time course mrna and protein expression levels of SFRP4 Whole cells were harvested at 0 2 4 6 8 days after inducing differentiation The results indicated that the expression levels of SFRP4 increased gradually reached peak at the 8 days P < 0 05 n = 3 B SFRP4 transcript levels in adipocyte AD and stromal vascular fractions SVF isolated from white adipose tissues of 3 days pig as measured by RT-qPCR analysis and expressed relative to β-actin The SVF mrna expression level of SFRP4 were higher than AD P < 0 05 n = 3 SFRP4 0 d 2 5 JNK Fig 5 A Fig 5C 2 5 1 SP600125 JNK SFRP4 mrna SP600125 JNK Fig 5B JNK SFRP4 DMEM / F12 15μmol / L SP600125

460 28 Fig 4 Morphology observation of porcine primary adipocytes A Adipocytes were cultured in vitro for 24 hours showing stretched fibroblast-like or triangle cell phenotypes B Adipocytes were differentiated in the early stage for 2 days showing small lipid droplet in cytoplasm C Adipocytes were differentiated into mature stage for 8 days Some small lipid droplets fusing into big lipid droplets D Differentiated adipocytes stained by oil red O Lipid droplets were stained red by oil red O 24 h 48 h 72 h 24 h Fig 6A 6D 48 h Fig 6E Fig 6B 72 h Fig 6F Fig 6C 2 5 2 SP600125 SFRP4 SP600125 24 h JNK Fig 6B SFRP4 mrna Fig 7A 7B PPARγ FABP4 Perilipin ATGL mrna 48 h P < 0 01 Fig 7C Fig 6 Morphology observation of porcine primary adipocytes treated with SP600125 Primary cultured porcine preadipocytes were treated with 15 μmol / L SP600125 or DMSO for 72 hours and observed the lipid accumulation by treated with SP600125 or DMSO All experiments were repeated three times The results indicated that SP600125 promote preadipocyte adipogenesis A Treated with DMSO for 24 hours B Treated with DMSO for 48 hours C Treated with DMSO for 72 hours D Treated with SP600125 for 24 hours E Treated with SP600125 for 48 hours F Treated with SP600125for 72 hours JNK mrna SFRP4 SFRP4 3 SFRP4 SFRP4

5 SFRP4 SP600125 461 Fig 7 SP600125 down-regulate SFRP4 mrna levels and promote the porcine preadipocyte differentiation spontaneously Isolated preadipocytes from adipose tissues were directly plated in DMEM / F12 medium when confluenced 100% added 15 μmol / L SP600125 or DMSO control into DMEM / F12 medium and cultured for 24 48 and 72 hours A Gene expression of SFRP4 was quantified by RT-qPCR and expressed relative to β-actin levels The SFRP4 expression level was decreased significantly as relative to control n = 3 * P < 0 05 * * P < 0 01 B Whole cell extracts were analysized by Western blotting The changes of SFRP4 p-jnk expression were showed in control and SP600125 treated group the SFRP4 and p- JNK protein level were decreased significantly as relative to control C Gene expression of PPARγ FABP4 Perilipin ATGL were quantified by RT-qPCR and expressed relative to β-actin levels The gene expression levels were all increased as relative to control n = 3 * P < 0 05 * * P < 0 01 PCR SFRP4 Yam 20 PCR SFRP4 SFRP4 Northern SFRP4 SFRP4

462 28 SFRP4 SFRP4 SFRP5 Ouchi 16 II SFRP4 PCR PCR SFRP5 JNK SP600125 Western SFRP4 mrna SFRP5 SFRP4 PPARγ FABP4 SFRP5 ATGL Perilipin SFRP4 JNK SFRP4 SFRP4 21-24 References 25-28 29 SFRP4 Wang 30 SFRP4 domain of frizzled receptors J SFRP4 7 2859-2863 SFRP4 mrna SFRP4 cancer J Park 31 Suzuki 32 SFRP4 2010 47 2 263-271 3 SFRP4 SFRP2 SFRP4 3T3-L1 SFRP2 33 SFRP2 98 34 SP600125 cancer cells J Cancer Res 2008 68 8 2570-2575 JNK PCR PPARγ FABP4 ATGL Perilipin mrna JNK PPARγ FABP4 ATGL Perilipin SFRP4 mrna JNK SFRP4 SFRP4 1 Rattner A Hsieh JC Smallwood PM et al A family of secreted proteins contains homology to the cysteine-rich ligand-binding Proc Natl Acad Sci 1997 94 2 Suzuki H Watkins DN Jair KW et al Epigenetic inactivation of SFRP genes allows constitutive WNT signaling in colorectal Nat Genet 2004 36 4 417-422 3 Cho HY Choi HJ Sun HJ et al Transgenic mice overexpressing secreted frizzled-related proteins sfrp 4 under the control of serum amyloid P promoter exhibit low bone mass but did not result in disturbed phosphate homeostasis J Bone 4 Stamper B D Park S S Beyer R P et al Differential Expression of Extracellular Matrix-Mediated Pathways in Single- Suture Craniosynostosis J PLoS One 2011 6 10 e26557 5 Zhang Y Chen FQ Sun YH et al Effects of DNMT1 silencing on malignant phenotype and methylated gene expression in cervical cancer cells J J Exp Clin Cancer Res 2011 30 1 6 Ting AH Suzuki H Cope L et al A requirement for DICER to maintain full promoter CpG island hypermethylation in human 7 Easwaran HP Van Neste L Cope L et al Aberrant silencing of cancer-related genes by CpG hypermethylation occurs independently of their spatial organization in the nucleus J Cancer Res 2010 70 20 8015-8024 8 Romaker D Puetz M Teschner S et al Increased expression of secreted frizzled-related protein 4 in polycystic kidneys J J Am Soc Nephrol 2009 20 1 48-56 9 Jacob F Ukeqjini K Nixdorf S et al Loss of secreted frizzledrelated protein 4 correlates with an aggressive phenotype and

5 SFRP4 SP600125 463 predicts poor outcome in ovarian cancer patients J PLoS One 2012 7 2 e31885 10 Moran A Akcan Arikan A Mastragelo MA et al Prevention of trauma and hemorrhagic shock-mediated liver apoptosis by activation of stat3alpha J Int J Clin Exp Med 2008 1 3 213-247 11 Carmon K S Loose D S Development of a bioassay for detection of Wnt-binding affinities for individual frizzled receptors J Anal Biochem 2010 401 2 288-294 12 Tominaga S Yamaguchi T Takahashi S et al Negative regulation of adipogenesis from human mesenchymal stem cells by Jun N-terminal kinase J Biochem Biophys Res Commun 2005 326 2 499-504 13 Fu L Tang T Miao Y et al Stimulation of osteogenic differentiation and inhibition of adipogenic differentiation in bone marrow stromal cells by alendronate via ERK and JNK activation J Bone 2008 43 1 40-47 14 beta-catenin in human colorectal carcinoma J Cancer Lett J Yang GS Zhang HW Bai L et al Pig A ideal study animal model of obesity and diabeties 2006 231 1 129-137 27 Huang D Yu B Deng Y et al SFRP4 was overexpressed in J Prog Nat Sci 2008 18 5 481-487 15 3 395-401 J Qu Chang-Qing Zhang Guo -Hua Chen Fen-Fen et al Primary culture of porcine preadipocyte J J Agric Biotechnol 2005 13 5 649-653 16 Ouchi N Higuchi A Ohashi K et al Sfrp5 is an antiinflammatory adipokine that modulates metabolic dysfunction in obesity J Science 2010 329 5990 454-457 17 TCTP J Cardiovasc Res 2000 45 3 720-728 J Li 30 Wang S Krinks M Lin K et al Frzb a secreted protein Xin- Jian Yang Hao Cheng Jia et al Expression of porcine expressed in the Spemann organizer binds and inhibits Wnt-8 TCTP and its effect on differentiation of adipocytes J Chin J Biochem Mol Biol 2011 27 5 444-451 18 Sambrook J Russell DW Molecular Cloning A Laboratory Manual 3rd ed New York Cold Spring Harbor Laboratory Press 1989 J DW 3 M Beijing Science Press 2002 19 PGC-1 SREBP-1c downregulated during differentiation of porcine mesenteric J J Anim Sci 2008 86 12 3367-3376 J 33 Bennett CN Ross SE Longo KA et al Regulation of Wnt Gao Xiao-Juan Ji Hong Chang Zhi-Guang et al Interaction of PGC-1 and SREBP- 1c during porcine adipocyte differentiation J Chin J Biochem Mol Biol 2011 27 6 533-539 20 Yam JW Chan KW Ngan ES et al Genomic structure alternative splicing and tissue expression of rfrp / sfrp-4 the rat frizzled related protein gene J Gene 2005 357 1 55-62 21 White L Suganthini G Friis R et al Expression of secreted frizzled-related protein 4 in the primate placenta J Reprod Biomed Online 2009 18 1 104-110 22 Constantinou T Baumann F Lacher MD et al SFRP-4 abrogates Wnt-3a-induced beta-catenin and Akt / PKB signalling and reverses a Wnt-3a-imposed inhibition of in vitro mammary differentiation J J Mol Signal 2008 3 1 10-23 23 Drake JM Friis RR Dharmarajan AM et al The role of sfrp4 a secreted frizzled-related protein in ovulation J Apoptosis 2003 8 4 389-397 24 Hsieh M Mulders SM Friis RR Expression and localization of secreted frizzled-related protein-4 in the rodent ovary evidence for selective up-regulation in luteinized granulosa cells J Endocrinology 2003 144 10 4597-4606 25 Fox S Dharmarajan A WNT signaling in malignant mesothelioma J Front Biosci 2006 11 9 2106-2112 26 Feng Han Q Zhao W Bentel J et al Expression of sfrp-4 and colorectal carcinoma J J Cancer Res Clin Oncol 2010 136 28 Drake J Shearwood AM White J et al Expression of secreted frizzled-related protein 4 SFRP4 in primary serous ovarian tumours J Eur J Gynaecol Oncol 2009 30 2 133-141 29 Schumann H Holtz J Zerkowski HR et al Expression of secreted frizzled related proteins 3 and 4 in human ventricular myocardium correlates with apoptosis related gene expression J Cell 1997 88 3 757-766 31 Park JR Jung JW Lee YS et al The roles of Wnt antagonists Dkk1 and SFRP4 during adipogenesis of human adipose tissuederived mesenchymal stem cells J Cell Prolif 2008 41 6 859-874 32 Suzuki S Sembon S Iwamoto M et al Identification of genes signaling during adipogenesis J Biol Chem 2002 277 34 30998-31004 34 Hu E Zhu Y Fredrickson T et al Tissue restricted expression of two human Frzbs in preadipocytes and pancreas J tutive WNT signaling in Biochem Biophys Res Commun 1998 24 2 287-293