Chinese Journal of Biochemistry and Molecular Biology. ( OsSUT2) 6314 kd, E2mail : edu. cn

Σχετικά έγγραφα
α 1 2- Cloning and Expression of alpha 1 2-fucosyltransferase in E. coli BIOTECHNOLOGY BULLETIN

ER-Tree (Extended R*-Tree)

Angioarrestin( harp1) C FD

P450 CYP4G19. Prokaryotic Expression of German cockroach Cytochrome P450 CYP4G19 Gene and Preparation of Polyclonal Antibody , ; 2.

Shiraia sp. Slf14 III

Journal of the CUN(Natural Sciences Edition) ...

Copper-catalyzed formal O-H insertion reaction of α-diazo-1,3-dicarb- onyl compounds to carboxylic acids with the assistance of isocyanide

Identification of Fish Species using DNA Method

Science of Sericulture

, Litrrow. Maxwell. Helmholtz Fredholm, . 40 Maystre [4 ], Goray [5 ], Kleemann [6 ] PACC: 4210, 4110H

Resurvey of Possible Seismic Fissures in the Old-Edo River in Tokyo

CK2, Basic Medical Sciences and Clinics (4) ( Π ) pt727 ( CIP), (TSR) 6 ( POP6) ( IPTG),, A,

Molecular Cloning of MUC1ΠY and Soluble Expression of Its

Nguyen Hien Trang* **

( ) , ) , ; kg 1) 80 % kg. Vol. 28,No. 1 Jan.,2006 RESOURCES SCIENCE : (2006) ,2 ,,,, ; ;

Chinese Journal of Biochemistry and Molecular Biology ERR . I2 (TNNI2) GST2TNNI2, 1. 1

A facile and general route to 3-((trifluoromethyl)thio)benzofurans and 3-((trifluoromethyl)thio)benzothiophenes

Gro wth Properties of Typical Water Bloom Algae in Reclaimed Water

A summation formula ramified with hypergeometric function and involving recurrence relation

Cellular Physiology and Biochemistry

,HLA2B2704,, The Technique of Producing HLA2B2704 Gene Transgenic Mice. Chinese Journal of Biochemistry and Molecular Biology HLA2 B2704 ,1,2 Q33,Q78

IL - 13 /IL - 18 ELISA PCR RT - PCR. IL - 13 IL - 18 mrna. 13 IL - 18 mrna IL - 13 /IL Th1 /Th2

, SLC26A4 HEK 293. The construction of wild-type SLC26A4 gene expression vector and the expression in HEK293 cells

Chinese Journal of Biochemistry and Molecular Biology CK2 252

Antimicrobial Ability of Limonene, a Natural and Active Monoterpene

Introduction to Bioinformatics

The toxicity of three chitin synthesis inhibitors to Calliptamus italicus Othoptera Acridoidea

,,, (, ) , ;,,, ; -

ΤΕΧΝΟΛΟΓΙΚΟ ΠΑΝΕΠΙΣΤΗΜΙΟ ΚΥΠΡΟΥ ΣΧΟΛΗ ΓΕΩΠΟΝΙΚΩΝ ΕΠΙΣΤΗΜΩΝ ΒΙΟΤΕΧΝΟΛΟΓΙΑΣ ΚΑΙ ΕΠΙΣΤΗΜΗΣ ΤΡΟΦΙΜΩΝ. Πτυχιακή εργασία

Stress Relaxation Test and Constitutive Equation of Saturated Soft Soil

Journal of Shanghai Normal University Natural Sciences Feb SNAT2. HEK293T Western blot SNAT2 - HA Q 31 A

Studies on the Binding Mechanism of Several Antibiotics and Human Serum Albumin

Supplementary Information for

Differences in Contents of Neutral Aroma Components and Sensory Evaluation in Air-cured Burley Leaves from Different Curing Barns

Salmonella produce microrna-like RNA fragment Sal-1 in the infected cells to. facilitate intracellular survival

Supporting Information. Asymmetric Binary-acid Catalysis with Chiral. Phosphoric Acid and MgF 2 : Catalytic

Extract Isolation Purification and Identification of Polysaccharides from Exocarp of Unripe Fruits of Juglans mandshurica

Preparation and Characterization of a Novel Recombinant Imaging Agent Directing Thrombus

Copper-Catalyzed Oxidative Dehydrogenative N-N Bond. Formation for the Synthesis of N,N -Diarylindazol-3-ones

1 (forward modeling) 2 (data-driven modeling) e- Quest EnergyPlus DeST 1.1. {X t } ARMA. S.Sp. Pappas [4]

Optimizing Microwave-assisted Extraction Process for Paprika Red Pigments Using Response Surface Methodology

1., Specificity and Epitope Mapping of Four Monoclonal Antibodies. against SARS-CoV Nucleocapsid Protein

PCR. Site-directed Mutagenesis of Sumf 1 Gene of Mouse Based on Overlap Extension PCR and Construction of Eukaryotic Expression Vector

SUPPORTING INFORMATION

Abstract... I. Zusammenfassung... II. 1 Aim of the work Introduction Short overview of Chinese hamster ovary cell lines...

Correction of chromatic aberration for human eyes with diffractive-refractive hybrid elements

Supporting Information

Mean bond enthalpy Standard enthalpy of formation Bond N H N N N N H O O O

8Q5SAC) 8Q5SAC UV2Vis 8500 ( ) ; PHS23C ) ;721 ( ) :1 4. ;8Q5SAC : molπl ;Britton2Robinson Q5SAC BSA Britton2Robinson,

Development of the Nursing Program for Rehabilitation of Woman Diagnosed with Breast Cancer

BGP TRACP-5b BGP TRACP-5b P 0.05

Congruence Classes of Invertible Matrices of Order 3 over F 2

Design and Fabrication of Water Heater with Electromagnetic Induction Heating

30s 56 60s 72 60s dntp cm s s s 23

ΠΡΟΣΚΛΗΣΗ ΕΚΔΗΛΩΣΗΣ ΕΝΔΙΑΦΕΡΟΝΤΟΣ

HIV HIV HIV HIV AIDS 3 :.1 /-,**1 +332

Chinese Journal of Biochemistry and Molecular Biology. (growth inhibitory factor,gif, 2Sepharose 4B PC12,

Emulsifying Properties of Egg Yolk as a Function of Diacylglycerol Oil

Nov Journal of Zhengzhou University Engineering Science Vol. 36 No FCM. A doi /j. issn

http / /xuebao. jxau. edu. cn. orfh79 orfh79 pet - 28a - orfh79 pgex5x orfh79

Quantum dot sensitized solar cells with efficiency over 12% based on tetraethyl orthosilicate additive in polysulfide electrolyte

Basic & Clinical Medicine PLGA MUC1 MUC1 IC 50 MUC1 +

ΚΛΙΜΑΤΟΛΟΓΙΑ CLIMATOLOGY

College of Life Science, Dalian Nationalities University, Dalian , PR China.

Lecture 2: Dirac notation and a review of linear algebra Read Sakurai chapter 1, Baym chatper 3

Ara h 2. pet - 32a + Origami. Western blotting ELISA SDS - PAGE Ara h 2 F - Ara h 2. IgE

ΙΩΑΝΝΗ ΑΘ. ΠΑΠΑΪΩΑΝΝΟΥ

Electronic Supplementary Information

Lewis Acid Catalyzed Propargylation of Arenes with O-Propargyl Trichloroacetimidate: Synthesis of 1,3-Diarylpropynes

VBA Microsoft Excel. J. Comput. Chem. Jpn., Vol. 5, No. 1, pp (2006)

Accumulation of Soil Arsenic by Panax notoginseng and Its Associated Health Risk

Neutralization E#ects of Acidity of Rain by Cover Plants on Slope Land

To whom correspondence should be addressed: Dr. Beat Schwaller, Unit of Anatomy,

ΤΕΧΝΟΛΟΓΙΚΟ ΠΑΝΕΠΙΣΤΗΜΙΟ ΚΥΠΡΟΥ ΣΧΟΛΗ ΕΠΙΣΤΗΜΩΝ ΥΓΕΙΑΣ ΤΜΗΜΑ ΝΟΣΗΛΕΥΤΙΚΗΣ ΠΤΥΧΙΑΚΗ ΕΡΓΑΣΙΑ ΕΠΗΡΕΑΖΕΙ ΤΗΝ ΠΡΟΛΗΨΗ ΚΑΡΚΙΝΟΥ ΤΟΥ ΜΑΣΤΟΥ

ect of Modified Wheat Starches on the Textural Properties of Baked Products, such as Cookies

TGFp FSH INH INH

Research on Economics and Management

Nucleotide Sequence of Cloned cd NA for alpha Subunit of Goat Follicle Stimulating Hormone

VSC STEADY2STATE MOD EL AND ITS NONL INEAR CONTROL OF VSC2HVDC SYSTEM VSC (1. , ; 2. , )

Main source: "Discrete-time systems and computer control" by Α. ΣΚΟΔΡΑΣ ΨΗΦΙΑΚΟΣ ΕΛΕΓΧΟΣ ΔΙΑΛΕΞΗ 4 ΔΙΑΦΑΝΕΙΑ 1

(Pseudorabies,PR) , ge. , ( Pichia pastoris) ppic9k, ,Multi2Copy Pichia Expression Kit Invitrogen, Vol. 42 October No. 5

*,* + -+ on Bedrock Bath. Hideyuki O, Shoichi O, Takao O, Kumiko Y, Yoshinao K and Tsuneaki G

encouraged to use the Version of Record that, when published, will replace this version. The most /BCJ

Supporting Information

CorV CVAC. CorV TU317. 1

Εφαρμογές της τεχνολογίας επίγειας σάρωσης Laser στις μεταφορές

Enzymatic Synthesis of Dithiolopyrrolone Antibiotics Using Cell-Free Extract of Saccharothrix

[11].,, , 316 6, ,., 15.5%, 9.8%, 2006., IDF,, ,500, 2,830.,, ,200.,,, β, [12]. 90% 2,,,,, [13-15].,, [13,

«ΘΕΜΑΤΑ ΑΣΤΙΚΟΥ ΣΧΕΔΙΑΣΜΟΥ» ΔΙΔΑΣΚΟΥΣΕΣ: ΒΑΪΟΥ Ντ., ΜΑΝΤΟΥΒΑΛΟΥ Μ., ΜΑΥΡΙΔΟΥ Μ. «Gentrification Friendly» γειτονιές στο κέντρο της Αθήνας(;)

Distribution of Mercury and Selenium in the Proteins of Porcine Liver and Kidney Under Different Mercury Exposure Level

ΜΕΤΑΠΤΥΧΙΑΚΗ ΕΡΕΥΝΗΤΙΚΗ ΔΙΑΤΡΙΒΗ

ΠΕΡΙΛΗΨΗ. Λέξεις κλειδιά: Υγεία και συμπεριφορές υγείας, χρήση, ψυχότροπες ουσίες, κοινωνικό κεφάλαιο.

SCITECH Volume 13, Issue 2 RESEARCH ORGANISATION Published online: March 29, 2018

Reading Order Detection for Text Layout Excluded by Image

: Monte Carlo EM 313, Louis (1982) EM, EM Newton-Raphson, /. EM, 2 Monte Carlo EM Newton-Raphson, Monte Carlo EM, Monte Carlo EM, /. 3, Monte Carlo EM

100102; 2. Fe Cu Hg. Rapid multi-elemental analysis on four precious Tibetan medicines based on LIBS technique

Reaction of a Platinum Electrode for the Measurement of Redox Potential of Paddy Soil

Homomorphism of Intuitionistic Fuzzy Groups

MSM Men who have Sex with Men HIV -

1 h, , CaCl 2. pelamis) 58.1%, (Headspace solid -phase microextraction and gas chromatography -mass spectrometry,hs -SPME - Vol. 15 No.

Transcript:

ISSN 100727626 CN 1123870ΠQ 2005 12 Chinese Journal of Biochemistry and Molecular Biology 21 (6) :846 851 ( OsSUT2),,,,, (, 100875) Expression of a Fusion Protein Containing Non2transmembrane Region for Rice Sucrose Transporter 2 ( OsSUT2) in E coli and Generation of Its Polyclonal Antibody ZHAO Wei, WANG Xin2Sheng, LI Xiao2Rong, CHENG Wei,CHEN Xing, WANG Ying2Dian 3 ( College of Life Sciences, Beijing Normal University, Beijing 100875, China) Abstract Sucrose transporter is a functional protein family related to the sucrose transportation and signal transduction in plants Using DNA recombination technology, it was prepared the specific antibody of rice sucrose transporter (OsSUT2) based on its typical sequence of hydrophilic non2transmembrane to provide efficient molecular tool in the research on the physiological function of this protein The cdna sequences of the hydrophilic non2transmembrane region of central loop (CL) and TACL ( Transmembrane and Apoplast regions and CL) of OsSUT2 were sub2cloned into the fusion expression vector pqe40 having dihydrofolate reductase (DHFR) to construct recombinant plasmid pqe402ossut22cl and pqe402 OsSUT22TACL, respectively The pqe402ossut22cl can be highly expressed in E coli M15, especially in E coli BL21 plyss However, the pqe402ossut22tacl cannot be expressed in E coli M15 DHFR2OsSUT22CL purified with SDS2PAGE gel was injected into rabbit to obtain the produce antiserum The specificity of obtained antibody was tested by Western blotting It was indicated that the raised antibody can specifically identify OsSUT2, and it can be efficiently used in the research on the physiological function of OsSUT2 Key words rice sucrose transporter 2, fusion protein, prokaryotic expression, antibody Q78,S13 3 1 (SUT1) Π, 4 (SUT4) [1 ] 2 (SUT2) [6 ] SUT2 (OsSUT2) [2 ] ( sucrose transporter, SUT) 6314 kd, 80, SUT, [3 5 ] : 2005201225, :2005203231 (No1 30270797), 12, 3 Tel :010258808195 ; :010258809077 E2mail :ydwang @bnu edu cn 6 6 Received : January 25,2005 ;Accepted : March 31,2005 Supported by National Natural Science Foundation of China (No 30270797), 3 : Π 595, 3 Corresponding author Tel : Tel : 010258808195 ; Fax : 010258809077 E2mail : ydwang @bnu edu cn

6 : (OsSUT2) 847 [7 ],, SUT p GEM2T2easy p GEX, SUT ( Bgl Nde [6,8 ], Sal Xho ) T4 DNA, Promega ;Pyrobest Taq DNA TaKaRa ; PCR OsSUT2 ; 2D2, ( IPTG) SIGMA ; OsSUT2, ; OsSUT2, ; (NC ) Western, Amersham Pharmacia ; Western OsSUT2 Blotting ; 1 111 pqe40 E coli M15 QIAGEN, E coli BL21plysS OsSUT22TACL (204,, E coli DH5 112 OsSUT2 OsSUT2, OsSUT22CL (83, 8 kd) OsSUT22CL 22 kd) cdna (Fig 1) Fig 1 The predicted structure models of OsSUT2, OsSUT22CL and OsSUT22TACL OsSUT2 contains 12 transmembrane domains indicated with columns and an extra central loop indicated with CL ; OsSUT22TACL contains an central loop, two transmembrane domains indicated with TM and two regions outside cell indicated with AL pqe40 OsSUT2 (DHFR),, OsSUT22CL OsSUT22TACL cdna pqe40, pqe402ossut22cl pqe402 OsSUT22TACL, OsSUT22CL cdna pqe402ossut22cl : 5 2 p GEX, GST2OsSUT22CL 113 OsSUT2 pqe40 p GEX, GG AGATCT GAGATCCCGCTGGAACCA23,

5 2GG GTCGACTCAATGCCTCATGCTAGTCAA23, [9 Bgl Sal ; ] pqe402ossut22tacl : 116 5 2GG AGATCT TGGATGGCTGTTGGAAACGT2 3, 5 2GG GTCGAC TCATAGCAAACC AAATGCACCTT23, Bgl DHFR2OsSUT22CL, Sal ; p GEX2OsSUT22 CL 848 21 : 5 2GGCATATG GAGATCCCG CTGGAACCA23, 5 2GG CTCGAGTCAATGCCTCATGCTA GTCAA23, ( ELISA) Nde Xho, 1 20 000, 114 pqe402ossut22cl pqe402ossut22 TACL pgex2ossut2 2CL 100 mg 6 d RNA,, 100 l (50 mmolπl OsSUT2 OsSUT22CL OsSUT22TACL Tris2HCl, 5 mmolπl EDTA, 5 mmolπl Na2 p GEM2T2easy, diethyldithiocarbamate, 1 mmolπl NaHSO 3, 100 gπml DH 5 PMSF, ph 810),4 13 000 rπmin 15 min, DNA, Bgl Sal, 100 g pqe40,, 12 % SDS2PAGE,200 ma pqe402ossut22cl pqe402ossut22tacl, NC (4,1 h) 115 % p GEX2OsSUT22CL 3 % PBST ( + 10 % M15 BL21 plyss, Tween 20,pH 712) 1 h 1 500 GST2OsSUT22CL 115 NC 1 h,pbst pqe402ossut22cl pqe402ossut22 IgG 1 h,pbst 5 min 3,BCIPΠNBT TACL M15 BL21 plyss (52 242 232 Π ) 4, 5 ml LB 10 min ( 100 mgπl ), 37 1 50 2 LB ( 100 mgπl ),37 211 300 rπmin 3 4 h, A 600 016, IPTG 1 mmolπl,37 28 300 rπmin 4 h 1 ml (2 000 g 5 min), Bgl Sal Fig 2 SDS2PAGE,12 % SDS2PAGE, pqe402ossut22cl 250 bp, ImageMasterR VDS, pqe402ossut22tacl 600 bp DE (Amersham Pharmacia) DNA, OsSUT22CL p GEX2OsSUT22CL OsSUT22TACL, DHFR BL21 plyss 37, 300 rπmin 4 p GEX2OsSUT22CL h, 12 % SDS2PAGE, DNA, Nde Xho, 250 bp GST2OsSUT22CL, GST2 ( Fig 2) DNA, OsSUT22CL, 5 mgπl 1 500 4 16 h, pqe402ossut22cl BL21 plyss 12 % SDS2PAGE,, 013 015 mgπ, 10 d 117 Westhern, pqe402ossut22cl pqe402ossut22tacl DNA, 1 % GST OsSUT22CL

6 : (OsSUT2) 849 Fig 2 Restriction analysis of the vectors pqe402ossut22cl, pqe2 OsSUT22TACL and pgex2ossut22cl 1 : DNA marker ; 2 : pqe402ossut22cl digested by Bgl and Sal ; 3 : pqe402ossut22tacl digested by Bgl and Sal ; 4 : p GEX2OsSUT22TACL digested by Nde and Xho Arrowheads indicate the products digested by enzymes Digested products were separated on 1 % agarose gel (Fig 3) 212 D HFR2OsSUT22CL, D HFR2OsSUT22TACL pqe402ossut22cl BL21 plyss GST2OsSUT22CL, 1 mmolπl IPTG pqe402ossut22cl M15 DHFR2 OsSUT22CL pqe402ossut22 TACL M15, 37, BL21 plyss DHFR2OsSUT2 2CL 28, 1 mmolπl IPTG (Fig 4A), Fig 3 37, DHFR2OsSUT22CL M15 pqe402ossut22cl M15 12 %, BL21 plyss, 34 kd, 31 % Fig 4B,p GEX2, pqe402ossut22tacl M15 OsSUT22CL BL21 plyss, (48 kd) GST2OsSUT22CL, 28, pqe402 Fig 3 Expression of DHFR2OsSUT22CL and DHFR2OsSUT22TACL Induced by IPTG in E coli M15 1 : Standard protein ; 2 : DHFR2OsSUT22TACL uninduced by IPTG at 37 ; 3 : DHFR2OsSUT22TACL induced by IPTG at 37 ; 4 : DHFR2 OsSUT22TACL uninduced by IPTG at 28 ; 5 : DHFR2OsSUT22TACL induced by IPTG at 28 ; 6 : DHFR2OsSUT22CL uninduced by IPTG at 37 ; 7 : DHFR2OsSUT22CL induced by IPTG at 37 Arrowhead indicates DHFR2OsSUT22CL The 100 g per lane of total protein was separated on 12 % SDS2PAGE OsSUT22TACL M15 Fig 4 Expression of DHFR2OsSUT22CL and GST2OsSUT22CL Induced by IPTG in E coli BL21 plyss and E coli M15 (A) 1 : Standard protein ; 2 : DHFR2OsSUT22CL in BL21 plyss uninduced ; 3 : DHFR2OsSUT22CL in BL21 plyss induced by IPTGfor 4 hours ; 4 : DHFR2OsSUT22CL in M15 uninduced ; 5 : DHFR2OsSUT22CL in M15 induced by IPTGfor 4 hours (B) 1 : Standard protein ; 2 : GST2OsSUT22CL in BL21 plyss uninduced ; 3 : GST2OsSUT22CL in BL21 plyss induced by IPTGfor 4 hours Arrowheads indicate DHFR2OsSUT22CL and GST2OsSUT22CL, respectively Total protein of 100 g per lane was separated on 12 % SDS2PAGE Standard protein is given at the left

850 21 214 OsSUT2,, 12 % SDS2PAGE NC,, Fig 5, OsSUT2,, 64 kd, OsSUT2,, GST2OsSUT22CL M15, DHFR2OsSUT22CL,64 kd (Fig15) Fig 5 The specificity analysis on the anti2ossut2 serum by Western blotting 1 : Incubation with pre2immune serum ; 2 : Incubation with anti2ossut2 serum ; 3 : Incubation with anti2ossut2 serum pretreated by 5 mgπl GST2 OsSUT22CL Arrowhead indicates the objective band of OsSUT2 Total protein of 100 g per lane, which was extracted from the rice caryopses at the 6th day after heading, was separated on 12 % SDS2PAGE 3,Western,,, OsSUT2 (Fig 5) GST2OsSUT22CL,OsSUT22CL,, OsSUT2, OsSUT2 ( ),, ( E coli) OsSUT2, ( References),, OsSUT2,,, DHFR2OsSUT22TACL,, DHFR2OsSUT22 TACL (Fig 3), OsSUT2,,, OsSUT2,, DHFR2 OsSUT22CL, M15 12 %, BL21 plyss, 31 % ( Fig 4), BL21 plyss DHFR2OsSUT22CL BL21 plyss T7, [10, ], DHFR2OsSUT22CL 1 Sheen J, Zhou L, Jyun2Chyun J Sugars as signaling molecules Curr Opin Plant Biol, 1999, 2 : 410 418 2 Chiou T, Bush D R Sucrose is a signal molecule in assimilate partitioning Proc Natl Acad Sci USA, 1998, 95 : 4784 4788 3 Riesmeier J W, Willmitzer L, Frommer W B Evidence for an essential role of the sucrose transporter in phloem loading and assimilate partitioning EMBO J, 1994, 13 : 1 7

6 : (OsSUT2) 851 4 Lalonde S, Boles E, Hellmann H, Barker L, Patrick J W, Frommer W B,Ward J M The dual function of sugar carriers : transport and sugar sensing Plant Cell, 1999, 11 : 707 726 5 K hn C, Hajirezaei M R, Fernie A R, Tunali U R, Czechowski T, Hirner B, Frommer W B The sucrose transporter StSUT1 localizes to sieve elements in potato tuber phloem and influences tuber physiology and development Plant Physiol, 2003, 131 : 102 113 6 Barker L, K hn C, Weise A, Schulz A, Gebhardt C, Hirner B, Hellmann H, Schulze W, Ward J M, Frommer W B SUT2, a putative sucrose sensor in sieve elements Plant Cell, 2000, 12 : 1153 1164 7 Rico L, Dieter L Strategies for prokaryotic expression of eukaryotic membrane proteins Traffic, 2001, 2 : 99 104 8 Weise A, Barker L, K hn C, Lalonde S, Buschmann H, Frommer W B, Ward J M New subfamily of sucrose transporters, SUT4, with low affinityπhigh capacity localized in enucleate sieve elements of plants Plant Cell, 2000, 12 : 1345 1356 9 Chiristian K, Ruth S, Norbert S, Gertrud L AmSUT1, a sucrose transporter in collection and transport phloem of the putative symplastic phloem loader Alonsoa meridionalis 214 Plant Physiol, 2004, 134 : 204 10,,, ( Shen Yi2Jun, Yao Jian2Er, Yi Jin2Hua, Su Yong Advance in high density cultivation of recombinant E coli Pharm Biotechnol),2000, 7 (4) : 243 247 H Science, 3,, H CFH,,CFH, CFH,CFH,,, CFH, CFH, CFH, CFH 7 1,,1 CFH CFH 3, CFH,,,,,,3 3,, CFH CFH,, CFH, CFH CFH, CFH ( N Seppa : Science News,March 12,2005,Vol 167,p 163)