42 5 2002 10 Acta Microbiologica Sinica Vol. 42 October No. 5 2002 Ea ge 3 33 ( 430070) : ge,, ge, GS115, G418, ge, Western blotting 33kD ELISA, ge, : ge,,, :Q93914 :A :000126209 (2002) 0520543207 (Pseudorabies,PR), [1 ] PR,gE ge [2 ] ge2elisa [1,3 ], [3 ], ( Pichia pastoris), [4,5 ],, P. pastoris [6 8 ], ge ppic9k,,, ge2elisa 1 111 ge psdm1178k+ [9 ],pmd218t,multi2copy Pichia Expression Kit Invitrogen, 3 (962C01204203) 33 : (1974 - ),,,, :2001212212, :2002204215
544 42 Top 10F, P. pastoris GS115 ( his4) ppic9k Pierce T4 DNA 112 ge Mettenleiter, IgG Sigma Ea ge Bartha IgG 113 11311 : Ea ge [9 ], ppic9k P5, EcoRV, [ 9 ] P2, psdm1178k+ ge ( N2 ), 696bp, ge 39 267 P5 (24mer) :5 ACCGAT ATCCCGAGTCCCTCGGCC23 P2 (27mer) :5 TTTGAA TTCTTAGTACCAGTCCAGCGT23 :95 5min, :95 1min 55 1min 72 1min, 35 72 10 min,018 % PCR, PCR pmd218t,, pte696,, EcoRV EcoRI, 696bp SnaBI EcoRI ppic9k, Top10F, p9k696 ( 1) 11312 : LiCl GS115 ( his4), LiCl GS115 MD,30 2 3d 11313 (PCR) : MD, MD,30 250rΠmin, 48h,, [10 ] DNA,, 3 PCR 11314 : PCR, OD 600, 10 5 G418 YPD (2mgΠmL 4mgΠmL), 11315 : 2mL BMGY,28 (250rΠmin) 36h 2 000rΠmin 5min, 10mL BMMY,28 6d 24h 1 % 11316 :SDS2PAGE [ 11 ], 2, 12 %SDS2PAGE, 30 LΠ Western2blotting : SDS2PAGE, ge IgG,,X 11317 ELISA : ge696 ( ),4, ge (
5 : Ea ge 545 1 p9 KGE696 Fig. 1 Construction of recombinant plasmid p9kge696 Ea ) ge ( Bartha ), 1 100, IgG2HRP(1 6 000), TMB, 1 %SDS, OD 600 2 211 PCR 11211 DM1178K+, 2 018 % 700bp,, pmd218t, pte696, ( 3), psdm1178k+ ge ( ) 212 p9 KGE696 EcoRV EcoRI pte696 SanBI EcoRI ppic9k, p9kge696 EcoRI ppic9k BamHI
546 42,pPIC9K 280bp 9kb, ge ( 4 2 3 ) 980bp 2 PCR Fig. 2 Agarose electrophoresis of PCR product 1. DNA marker (DL2 000) ; 2. PCR product ; 3. Negative control. 3 pte696 Fig. 3 Identification of recombinant plasmid pte696 1. DNA marker (DL2 000) ; 2. pte696 ( - )ΠEcoRI + EcoRV ; 3. pte696 ( + )ΠEcoRI + EcoRV ; 4. pte696 ( - )ΠEcoRI ; 5. pte696 ( + )ΠEcoRI ; 6. DNA marker (DL15 000). Western2blot, 33kD 4 p9 KGE696 ( 6) 26kD, Fig. 4 Identification of recombinant expression Plasmid p9kge696 ge 4 N 1. DNA marker (DL15 000) ;, 2,3. p9kge696πbamhi + EcoRI ; 4. ppic9kπbamhi + EcoRI. 213 G418, 4mgΠmL G418, GgE696 214 GgE696 24h, 12 % SDS2PAGE,,,,, 5 ( 5) 215 ELISA GgE696 ge ( Ea ), OD 600 1 2 6, 1 2 12 Ea, G9K Ea ( OD 630 012) Bartha,, ( ) GgE696
5 : Ea ge 547, ge 5 SDS2PAGE ( ) Fig. 5 SDS2PAGE analysis of the expression product (sliver stain) 1. Expression supernatant of strain G9K; 2 7. Induced supernatant of strain GgE696 (1 6d). 8. Protein standard(mbi). 6 Western2blot Fig. 6 Western2blot analysis of expression product 1,2. supernatant of strain GgE696 ; 3, supernatant of stain G9K. 3 ge,, [12,13 ] ge ge ge [1,2,12,13 ] ge I,gE 6, 5 N 52 283 [14,15 ],ge, [3 ], P. pastoris ge, ( ) ge N,,,, [3,12 ], ge,,, Pichia pastoris P. pastoris, C 12gΠL [16 ], P. pastoris [5,8 ], G418 GgE696, ge696,ge696
548 42 P. pastoris,,, (LiCl PEG) [17 ],,,,,, LiCl,, ppic9k, G418 [18 ],, P. pastoris,,, ph01 P. pastoris [4 8 ], ge (30 238 ) P. pastoris,,,,, ge ge,,,,,, ge2elisa [ 1 ] van Oirschot J T, Howwers D J, Rziha h J, et al. Journal of Virological Methods,1988,22 :191 206. [ 2 ] Elbers A R W, Braamskamp J, Dekkers L J M, et al. Vet Quart,2000,22 :103 107. [ 3 ] Kimman T G,Leeuw O, Kochan G, et al. Clinical and Diagnostic Laboratory Immunology,1996,3 (2) :167 174. [ 4 ] Cregg J M, Vedvick T S, Raschke W G. BioΠTechnology,1993,11 :905 910. [ 5 ] Sreekrishna K, Brankamp R G, Kropp K E, et al. Gene,1997,190 :55 62. [ 6 ] Lal S K, Tulasiram P, Jameel S. Gene 1997,190,63 67. [ 7 ] Scorer C A, Buckholz R G, Clare J J, et al. Gene,1993,136,111 119. [ 8 ] Hollenbery C P, Gellissen G. Current Opinion in Biotechmology 1997,8 :554 560. [ 9 ],,,.,2002,33 (2) :174 179. [10 ] Holm C, Meeks2Wagner D W, Fangman W L, et al. Gene,1986,42 :169 173. [11 ] Sambrook J, Fritsch E F, Maniatis T. Molecular Cloning :A Laboratory Manual,2nd ed. New York :Cold Spring Harbor Labo2 ratory Press,1989. [12 ] Mettenleiter T C. Veterinary Research,2000,31 :99 115. [13 ] Jacobs L. Archives of Virology, 1994,137 :209 228. [14 ] Jacobs J, Melon R H, Gielkens A L J, et al. Journal of General Virology,1990,71,881 887. [15 ] Fuchs W, Rziha H J, Lukacs N, et al. Journal of General Virology,1990,71 :1141 1151. [16 ] Clare J J, Rayment F B, Ballantine S P, et al. Biotechnology,1991,9 :455 460. [17 ] Romanos M. Current Opinion in Biotechnology, 1995,6 :527 533. [18 ] Scorer M A, Clare J J, McCombie W R, et al. Biotechnology, 1994,12 :181 184.
5 : Ea ge 549 Expression of Major Antigenic Domain of Glycoprotein E of Pseudorabies Virus Ea Strain in Pachia pastoris 3 Qin Yali Chen Huanchun Tang Yong He Qigai Xu Yindi ( Laboratory of Animal Virology, College of animal sciences and veterinary medicine, Huazhong Agricultural University, Wuhan 430070, China) Abstract : Glycoprotein E of Pseudorabies Virus is known to be an important diagnostic antigen in pseudorabies eradication campaign. In order to obtain the antigen in large quantity, the truncated ge gene encoding the major antigenic domains of ge was expressed and secreted in the methylotrophic yeast, Pichia pastoris. The truncated ge gene was amplified by PCR from psk1178k + plasmid harboring ge full length DNA. The ge fragment was then inserted into ppic9k vector and fused with the 2factor signal sequence to construct an expression plasmid p9kge696. After transforming p9kge696 into GS115 cell by LiCl method, the transformants were screened by G418 for multi2copy recombinants. By using methanol as inducer the truncated ge protein was secreted into culture medi2 um. Western2blotting analysis showed that the molecular mass of the expression product was a 33kD. ELISA indicated that the recombinant protein had good antigenicity and could be used as di2 agnostic antigen in the serological detection of ge antibodies in swine. Key words : Pseudorabies virus, ge, Pichia pastoris, Expression, ELISA 3 Project of Chinese National Programs for Science and Technology Development (962C01204203), 2003 144,,,,,!!!