Research Paper. glda. glda AT glda-wt. glda-4 pet- 32a + E. coli U / ml E. coli-wt U / ml 3 A Q814

Σχετικά έγγραφα
α 1 2- Cloning and Expression of alpha 1 2-fucosyltransferase in E. coli BIOTECHNOLOGY BULLETIN

Rapid determination of soluble reactive silicate in seawater by flow injection analysis with spectrophotometric detection and its application

ER-Tree (Extended R*-Tree)

1 h, , CaCl 2. pelamis) 58.1%, (Headspace solid -phase microextraction and gas chromatography -mass spectrometry,hs -SPME - Vol. 15 No.

Antimicrobial Ability of Limonene, a Natural and Active Monoterpene

BL21 (D E3)2p E T28a ( + )2bgl 2

Inhibition of mushroom tyrosinase by flavonoid from Sorbus tianschanica Ruper in Xinjiang

Nguyen Hien Trang* **

Optimizing Microwave-assisted Extraction Process for Paprika Red Pigments Using Response Surface Methodology

8Q5SAC) 8Q5SAC UV2Vis 8500 ( ) ; PHS23C ) ;721 ( ) :1 4. ;8Q5SAC : molπl ;Britton2Robinson Q5SAC BSA Britton2Robinson,

IL - 13 /IL - 18 ELISA PCR RT - PCR. IL - 13 IL - 18 mrna. 13 IL - 18 mrna IL - 13 /IL Th1 /Th2

College of Life Science, Dalian Nationalities University, Dalian , PR China.

Studies on the Binding Mechanism of Several Antibiotics and Human Serum Albumin

HIV HIV HIV HIV AIDS 3 :.1 /-,**1 +332

Γεωπονικό Πανεπιςτήμιο Αθηνών Τμήμα Αξιοποίηςησ Φυςικών Πόρων και Γεωργικήσ Μηχανικήσ

Shiraia sp. Slf14 III

Electronic Supplementary Information

N 2 O 15 N NH + NH 3 Rittenberg mg mmol L - 1 CuSO mg. 10 mol L. Pre-Concentration device PreCon

The toxicity of three chitin synthesis inhibitors to Calliptamus italicus Othoptera Acridoidea

Supplementary Information. Living Ring-Opening Polymerization of Lactones by N-Heterocyclic Olefin/Al(C 6 F 5 ) 3

Science of Sericulture

Computational study of the structure, UV-vis absorption spectra and conductivity of biphenylene-based polymers and their boron nitride analogues

Resurvey of Possible Seismic Fissures in the Old-Edo River in Tokyo

Comparison of carbon-sulfur and carbon-amine bond in therapeutic drug: -S-aromatic heterocyclic podophyllum derivatives display antitumor activity

9-amino-(9-deoxy)cinchona alkaloids-derived novel chiral phase-transfer catalysts

LUO, Hong2Qun LIU, Shao2Pu Ξ LI, Nian2Bing

Electrolyzed-Reduced Water as Artificial Hot Spring Water

2 PbO 2. Pb 3 O 4 Sn. Ti/SnO 2 -Sb 2 O 4 -CF/PbO x SnO 2 -Sb PbO 2. Sn-Sb 1:1. 1 h. Sn:Sb=10:1. PbO 2 - CeO 2 PbO 2. [8] SnO 2 +Sb 2 O 4 _

Quantum dot sensitized solar cells with efficiency over 12% based on tetraethyl orthosilicate additive in polysulfide electrolyte

Αξιολόγηση Ημιαγώγιμων Υμενίων Σεληνιούχου Καδμίου Σε Υπόστρωμα Νικελίου Για Φωτοβολταϊκές Εφαρμογές

Supporting Information

Identification of Fish Species using DNA Method

*,* + -+ on Bedrock Bath. Hideyuki O, Shoichi O, Takao O, Kumiko Y, Yoshinao K and Tsuneaki G

Gro wth Properties of Typical Water Bloom Algae in Reclaimed Water

E#ects of Drying on Bacterial Activity and Iron Formation in Acid Sulfate Soils

ΜΕΛΕΤΗ ΤΗΣ ΗΛΕΚΤΡΟΝΙΚΗΣ ΣΥΝΤΑΓΟΓΡΑΦΗΣΗΣ ΚΑΙ Η ΔΙΕΡΕΥΝΗΣΗ ΤΗΣ ΕΦΑΡΜΟΓΗΣ ΤΗΣ ΣΤΗΝ ΕΛΛΑΔΑ: Ο.Α.Ε.Ε. ΠΕΡΙΦΕΡΕΙΑ ΠΕΛΟΠΟΝΝΗΣΟΥ ΚΑΣΚΑΦΕΤΟΥ ΣΩΤΗΡΙΑ

Enzymatic Synthesis of Dithiolopyrrolone Antibiotics Using Cell-Free Extract of Saccharothrix

ΜΕΛΕΤΗ ΑΠΟΤΙΜΗΣΗΣ ΠΑΡΑΓΟΜΕΝΗΣ ΕΝΕΡΓΕΙΑΣ Φ/Β ΣΥΣΤΗΜΑΤΩΝ ΕΓΚΑΤΕΣΤΗΜΕΝΩΝ ΣΕ ΕΛΛΑ Α ΚΑΙ ΤΣΕΧΙΑ

Quantitative chemical analyses of rocks with X-ray fluorescence analyzer: major and trace elements in ultrabasic rocks

Study on the Strengthen Method of Masonry Structure by Steel Truss for Collapse Prevention

ΕΦΑΡΜΟΓΗ ΕΥΤΕΡΟΒΑΘΜΙΑ ΕΠΕΞΕΡΓΑΣΜΕΝΩΝ ΥΓΡΩΝ ΑΠΟΒΛΗΤΩΝ ΣΕ ΦΥΣΙΚΑ ΣΥΣΤΗΜΑΤΑ ΚΛΙΝΗΣ ΚΑΛΑΜΙΩΝ

Electronic Supplementary Information

Neutralization E#ects of Acidity of Rain by Cover Plants on Slope Land

Reaction of a Platinum Electrode for the Measurement of Redox Potential of Paddy Soil

Supporting Information

Supporting Information. Asymmetric Binary-acid Catalysis with Chiral. Phosphoric Acid and MgF 2 : Catalytic

ΑΠΟΜΟΝΩΣΗ, ΤΑΥΤΟΠΟΙΗΣΗ ΜΕΘΑΝΟΤΡΟΦΩΝ ΜΙΚΡΟΟΡΓΑΝΙΣΜΩΝ ΚΑΙ ΒΙΟΛΟΓΙΚΗ ΜΕΤΑΤΡΟΠΗ ΜΕΘΑΝΙΟΥ ΣΕ ΜΕΘΑΝΟΛΗ

Optimization of fermentation process for achieving high product concentration high yield and high productivity

Comparison of Evapotranspiration between Indigenous Vegetation and Invading Vegetation in a Bog

17 min R A (2009) To probe into the thermal property the mechanism of the thermal decomposition and the prospective

30s 56 60s 72 60s dntp cm s s s 23

Screening of Respiration-deficient Saccharomyces cerevisiae Strains with Sugar-and Thermo-tolerances

Mitomycin C application for the prevention of postoperative synechiae formation at the anterior commissure.

Comparative Study on Determinations of BTEX in Soils from Industrial Contaminated Sites

( ) , ) , ; kg 1) 80 % kg. Vol. 28,No. 1 Jan.,2006 RESOURCES SCIENCE : (2006) ,2 ,,,, ; ;

PE CVVH PE+HP HP+CVVH HP+CVVH+PE CVVH. ENLAV of HCO - 3 ENLAV-HCO ± μmol /L HP+PE HP+CVVH HP+CVVH+PE

ΜΕΤΑΠΤΥΧΙΑΚΗ ΕΡΕΥΝΗΤΙΚΗ ΔΙΑΤΡΙΒΗ

Schedulability Analysis Algorithm for Timing Constraint Workflow Models

Conductivity Logging for Thermal Spring Well

Supporting information. An unusual bifunctional Tb-MOF for highly sensing of Ba 2+ ions and remarkable selectivities of CO 2 /N 2 and CO 2 /CH 4

Supplementary Table 1. Construct List with key Biophysical Properties of the expression

GS3. A liner offset equation of the volumetric water content that capacitance type GS3 soil moisture sensor measured

High order interpolation function for surface contact problem

JOURNAL OF MICROBIOLOGY May 2011 Vol. 31 No. 3. PCR bp BCCP. pet-28a Escherichia coli BL21 DE3 Ni-NTA

Study of In-vehicle Sound Field Creation by Simultaneous Equation Method

c Key words: cultivation of blood, two-sets blood culture, detection rate of germ Vol. 18 No

A strategy for the identification of combinatorial bioactive compounds. contributing to the holistic effect of herbal medicines

ΤΕΧΝΟΛΟΓΙΚΟ ΠΑΝΕΠΙΣΤΗΜΙΟ ΚΥΠΡΟΥ ΣΧΟΛΗ ΓΕΩΠΟΝΙΚΩΝ ΕΠΙΣΤΗΜΩΝ ΒΙΟΤΕΧΝΟΛΟΓΙΑΣ ΚΑΙ ΕΠΙΣΤΗΜΗΣ ΤΡΟΦΙΜΩΝ. Πτυχιακή εργασία

Electronic Supplementary Information (ESI)

Heterobimetallic Pd-Sn Catalysis: Michael Addition. Reaction with C-, N-, O-, S- Nucleophiles and In-situ. Diagnostics

Extract Isolation Purification and Identification of Polysaccharides from Exocarp of Unripe Fruits of Juglans mandshurica

Copper-catalyzed formal O-H insertion reaction of α-diazo-1,3-dicarb- onyl compounds to carboxylic acids with the assistance of isocyanide

: Monte Carlo EM 313, Louis (1982) EM, EM Newton-Raphson, /. EM, 2 Monte Carlo EM Newton-Raphson, Monte Carlo EM, Monte Carlo EM, /. 3, Monte Carlo EM

Σχέση µεταξύ της Μεθόδου των ερµατοπτυχών και της Βιοηλεκτρικής Αντίστασης στον Υπολογισµό του Ποσοστού Σωµατικού Λίπους

Supporting Information

Studies on Synthesis and Biological Activities of 2( 1 H21,2,42 Triazol212yl)2 2Arylthioethyl Substituted Phenyl Ketones

Acknowledgements... 3 Contents... I Figures... VII Tables... IX Abbreviations... X

EPS. DOI / j. issn EXTRACTION OF EXTRACELLULAR POLYMERIC SUBSTANCES FROM ACTIVATED SLUDGE IN MEMBRANE BIOREACTOR

Autoxidation of Commercial Edible Oils and Emulsified Liquid Type Dressing by the Simple Method for the Determination of Peroxide Value

MSM Men who have Sex with Men HIV -

Abstract... I. Zusammenfassung... II. 1 Aim of the work Introduction Short overview of Chinese hamster ovary cell lines...

,,, (, ) , ;,,, ; -

«Χρήσεις γης, αξίες γης και κυκλοφοριακές ρυθμίσεις στο Δήμο Χαλκιδέων. Η μεταξύ τους σχέση και εξέλιξη.»

Identification of Salmonella,Campylobacter jejuni and Enterohemorrhagic E.coli by Denaturing High-performance Liquid Chromatography

Direct Transformation of Ethylarenes into Primary Aromatic Amides with N-Bromosuccinimide and I 2 -aq NH 3

Research on Economics and Management

ph Maillard MRPs maillard reaction products Maillard ph kDa Maillard Maillard DOI /j. issn

Jesse Maassen and Mark Lundstrom Purdue University November 25, 2013

Synthesis of Imines from Amines in Aliphatic Alcohols on Pd/ZrO 2 Catalyst at Ambient Conditions

Cellular Physiology and Biochemistry

A new ent-kaurane diterpene from Euphorbia stracheyi Boiss

Protease-catalysed Direct Asymmetric Mannich Reaction in Organic Solvent

Electronic Supplementary Information DFT Characterization on the Mechanism of Water Splitting Catalyzed by Single-Ru-substituted Polyoxometalates

ΜΕΛΕΤΗ ΤΗΣ ΠΛΑΣΤΙΚΟΤΗΤΑΣ ΑΡΓΙΛΟΥΧΩΝ ΜΙΓΜΑΤΩΝ ΜΕ ΠΡΟΣΘΗΚΗ ΣΙΔΗΡΑΛΟΥΜΙΝΑΣ ΑΠΟ ΤΗ ΔΙΕΡΓΑΣΙΑ BAYER

CYPRUS UNIVERSITY OF TECHNOLOGY Faculty of Geotechnical Sciences and Environmental Management Department of Environmental Science and Technology

MnZn. MnZn Ferrites with Low Loss and High Flux Density for Power Supply Transformer. Abstract:

Correction of chromatic aberration for human eyes with diffractive-refractive hybrid elements

encouraged to use the Version of Record that, when published, will replace this version. The most /BCJ BIOCHEMICAL JOURNAL

Lewis Acid Catalyzed Propargylation of Arenes with O-Propargyl Trichloroacetimidate: Synthesis of 1,3-Diarylpropynes

ΔΙΕΡΕΥΝΗΣΗ ΤΗΣ ΣΕΞΟΥΑΛΙΚΗΣ ΔΡΑΣΤΗΡΙΟΤΗΤΑΣ ΤΩΝ ΓΥΝΑΙΚΩΝ ΚΑΤΑ ΤΗ ΔΙΑΡΚΕΙΑ ΤΗΣ ΕΓΚΥΜΟΣΥΝΗΣ ΤΕΧΝΟΛΟΓΙΚΟ ΠΑΝΕΠΙΣΤΗΜΙΟ ΚΥΠΡΟΥ ΣΧΟΛΗ ΕΠΙΣΤΗΜΩΝ ΥΓΕΙΑΣ

Transcript:

Acta Microbiologica Sinica 51 4 504-509 4 April 2011 ISSN 0001-6209 CN 11-1995 / Q http / / journals. im. ac. cn / actamicrocn Research Paper 1 1 1 1 2* 1 361021 2 361005 glda glda AT AT PCR glda-wt glda-4 pet- 32a + pet-glda-4 E. coli BL21 DE3 E. coli-4 glda-wt E. coli-wt glda-4 glda-wt 2 5 6 4 AT 53. 3% 80. 0% E. coli-4 191. 3 U / ml E. coli-wt 48. 3 U / ml 3 AT Q814 A 0001-6209 2011 04-0504-06 glycerol dehydrogenase GDH EC 1. 1. 1. 6 glda Klebsiella Citrobacters 6-9 Clostridia 1 10-12 NAD + 13-14 dihydroxyacetone DHA Downstream Box DB NADH SD 1 3- DB A 2 1 2-3 4 T DB DHA AT 5 15 21076172 30770059 2010H6023 * Tel + 86-592-2185869 E-mail fbs@ xmu. edu. cn 1986 - E-mail tang3433@ sina. com 2010-11-04 2011-01-07

. / 2011 51 4 505 Klebsiella pneumoniae pet-glda glda Escherichia coli PCR glda-4 E. coli-wt glda 94 5 min 94 1 min 63 1. 5 min 72 glda 1. 5 min 30 72 15 min glda DB AT 1. 3 pmd-glda-4 2 5 6 4 glda-4 pmd-18t PCR glda-4 E. coli-4 glda E. coli BL21 DE3 Ⅰ 1 1. 1 1. 1. 1 E. coli DH5α DH5α E. coli BL21 DE3 E. coli BL21 DE3 pet-32a + Novagen. Inc E. coli-4 E. coli-4 E. coli BL21 DE3 / pet-glda pmd18-t 1. 5 1. 1. 2 ExTaq DNA E. coli-4 BamHⅠ XhoⅠ T 4 DNA marker marker 2 mg / ml 5 h 1 g PCR Thermo 1. 6 GDH 1. 2 glda-4 glda AT 2 5 6 4 glda-4 glda 1-6 5 - ATGCGCACTTATTTGAGG-3 glda-4 1-6 5 -ATGAGAACTTATTTAAGA-3 45 glda-4 340 nm primer premier 5 1 min 6 s Primer 1 5-1 ε 340nmNADH = 6. 3 L / m NADH / CGTCGGATCCTACATGAGAACTTATTTAAGAGTGAA cm AGGAAT-3 BamH Ⅰ 1 μmol 1 U Primer 2 5 -AATGCTCGAGCGAAT VT ΔA / Δt EA = 1 TAACGCGCCAGCCAC-3 XhoⅠ ε Vs primer1 primer2 E. coli DH5α BamHⅠ Xho 1. 4 pet-glda-4 glda-4 pet-32a + T 4 pet-glda-4 E. coli 75 μg / ml LB 2 h 5 ml ph 7. 4 4 Ahrens K 9 10 30 mmol / L NH4 2 SO 4 0. 2 mol / L 2 mmol / L NAD + 1 μmol / L Fe NH4 2 SO4 2 0. 1 mol / LK 2 CO 3 ph 12. 0 3 ml E A U / ml V T

506 Longpan Tang et al. / Acta Microbiologica Sinica 2011 51 4 V S V T V S ml ΔA / Δt 1. 7 Bradford 16 1. 8 E. coli BL21 DE3 E. coli-wt E. coli-4 10% R-250 2 2. 1 glda-4 2. 3 4 glda-4 E. coli-wt E. coli-4 1133 bp PCR 1% 1. 5 h 3 h 4 h 5 h 6 h 1000-2000 bp 2 1. 5 h pmd-glda-4 pet-glda-4 1. 5 h 1. 5 h glda-4 glda glda-4 2. 2 SDS-PAGE glda-4 E. coli-wt E. coli-4 1 1 Type glda glda-4 Table 1 Comparison of the expression product of E. coli-wt and E. coli-4 Enzyme activity / U / ml Protein concentration / mg / ml E. coli-wt 48. 3 2. 21 21. 9 E. coli-4 191. 3 2. 971 67. 4 Specific activity / U / mg Fig. 1 SDS-PAGE analysis of the crude extracts. M protein marker 1 product of E. coli BL21 DE3 2 product of E. coli - WT with glda 3 product of E. coli - 4. 6 1. 9 E. coli-wt E. coli- 4 1. 5 h 3 h 4 h 5 h 6 h 1 SDS-PAGE 34 kda 20. 4 kda 2 E. coli-wt E. coli-4 54 kda 1 SDS- Fig. 2 Comparison of the speed of producing the GDH of PAGE glda glda-4 E. coli-wt and E. coli-4.

. / 2011 51 4 507 3 DB AT DB Stenstr m 17 E. coli 2 A E. coli DB 1 6 16S rrna 1469-1483 13 AT DB mrna 16S rrna propandediol oxidoreductase on bioconversion of glycerol into 1 3-propandediol by Klebsiella pneumoniae under micro-aerobic conditions. Bioprocess and Biosystems Engineering 2009 32 3 313-320. 2 Menzel K Ahrens K Zeng AP Deckwer W. Kinetic glda 2 6 AT PCR glda dynamic and pathway studies of glycerol metabolism by Klebsiella pneumoniae in anaerobic Continuous Culture IV. Enzymes and fluxes of pyruvate metabolism. glda-4 Biotechnology and Bioengineering 1998 60 5 617-626. 191. 3 U / ml E. 3 Lee W Dasilva NA. Application of sequential integration coli-wt for metabolic engineering of 1 2-propanediol production 48. 3 U / ml 15 3 in yeast. Metabolic Engineering 2006 8 1 58-65. 1995 Daniel 7 glda E. coli ECL707 6. 67 U / mg coli for the efficient conversion of glycerol to ethanol and 2006 Yamada-Onodera 19 E. coli HB101 0. 55 U / mg 351. thermophilus Nudix ndx3 3 6 Journal of Wuxi University of Light Industy 2005 AT AT 24 1 1-5. 8. 3% 41. 7% ndx3 E. coli 7 Daniel R Stuertz K Gottschalk G. Biochemical and 10 DB AT molecular characterization of the oxidative branch of 53. 3% 80. 0% glycerol utilization by Citrobacter freundii. Journal of AT DB E. coli-wt E. coli-4 1 Zhao L Zheng Y Ma X Wei DZ. Effects of overexpression of glycerol dehydrogenase and 1 3-4 Shams Yazdani S Gonzalez R. Engineering Escherichia co-products. Metabolic Engineering 2008 10 6 340- glda-4 5 Kawashima K Itoh H Chgate J. Nonenzymatic browning reactions of dihydroxyacetone with amino acids or their 67. 4 U / mg 10 esters. Agricultural and Biological Chemistry 1980 44 100 glda DB AT 7 1595-1599. E. coli 6. Nishikubo 20 Thermus. bacteriology 1995 177 15 4392-4401.

508 Longpan Tang et al. / Acta Microbiologica Sinica 2011 51 4 8 Ruzheinikov SN Burke J Sedelnikova S Baker PJ Taylor R Bullough PA Muir NM Gore MG Rice DW. Glycerol Dehydrogenase Structure Specificity and Mechanism of a Family III Polyol Dehydrogenase. 9 789-802. Structure 2001 9 9 Malaoui H Marczak R. Separation and characterization of the 1 3-propanediol and glycerol dehydrogenase activities from Clostridium butyricum E5 wild-type and mutant D. Journal of Applied Microbiology 2001 90 6 1006-1014. 10 Katrlík J Mastihuba V Vo tiar I efčovičová J tefucaa V Gemeiner P. Amperometric biosensors based on two different enzyme systems and their use for glycerol determination in samples from biotechnological fermentation process. Analytica Chimica Acta 2006 516 1 11-18. 11 Gonzalez R Murarka A Dharmadi Y Yazdani SS. A new model for the anaerobic fermentation of glycerol in enteric bacteria trunk and auxiliary pathways in Escherichia coli. Metabolic Engineering 2008 10 8 234-245. 12 Zhao L Zheng Y Ma X Zhang J Wei GD Wei DZ. Over-expression of glycerol dehydrogenase and 1 3- propanediol oxidoreductase in Klebsiella pneumoniae and their effects on conversion of glycerol into 1 3- propanediol in resting cell system. Journal of Chemical Technology and Biotechnology 2009 84 4 626-632. 13 Sprengart ML Fuchs E Porter AG.. The downstream box an effcient and independent translation initiation signal in E. coli. The EMBO Journal. 1996 15 3 665-674. 14 Etchegaray JP Inouye M. Translational enhancement by an element downstream of the initiation codon in Escherichia coli. The Journal of Biologic Chemistry 1999 274 15 10079-10085. 15.. Chinese Journal of Biotechnology 2008 24 3 495-499. 16.. 2000 42-47. 17 Gonzalez EI Isaksson LA. A codon window in mrna downstream of the initiation codon where NGG codons give strongly reduced gene expression in Escherichia coli. Nucleic Acids Research 2004 32 17 5198-5205. 18 Qing G Xia B Inouye M. Enhancement of translation initiation by A / T-rich sequences downstream of the initiation codon in Escherichia coli. Journal of Molecular Microbiology and Biotechnology 2003 6 3-4 133-144. 19 Yamada-Onodera K Nakajima A Tani Y. Purification characterization and gene cloning of glycerol dehydrogenase from Hansenula ofunaensis and its expression for production of optically active diol. Journal of Bioscience and Bioengineering 2006 102 6 545-551. 20 Nishikubo T Nakagawa N Kuramitsu S Masui R. Improved heterologous gene expression in Escherichia coli by optimization of the AT-content of codons immediately downstream of the initiation codon. Journal of Biotechnology 2005 120 4 341-346.

. / 2011 51 4 509 Expression of glycerol dehydrogenase gene in Escherichia coli by codon optimization Longpan Tang 1 Jincong Yu 1 Danfeng Dai 1 Baishan Fang 1 2* 1 Key Laboratory for Industrial Biotechnology of Fujian Higher Education Huaqiao University Xiamen 361021 China 2 Department of Chemical and Biochemical Engineering College of Chemistry and Chemical Engineering Xiamen University Xiamen 361005 China Abstract Objective To improve expression level of glycerol dehydrogenase gene glda in Escherichia coli by means of codon optimization. Methods For immediately downstream region of initiation codon in glda we designed optimized sequence by choosing higher AT-content synonymous in order that this region's AT-content was increased without changing the corresponding amino acids. Then we had wild gene glda-wt site-directed mutagenesis depending on mega-primers PCR so that physically optimized gene glda-4 was acquired. We cloned glda-4 into pet-32a + to construct expression plasmid pet-glda-4 which was transformed into Escherichia coli BL21 DE3 for gaining engineering bacteria E. coli-4 by contrast engineering bacteria involved glda-wt named E. coli-wt. After E. coli-4 and E. coli-wt were fermented in shake flasks we measured enzyme activities of expression products with glycerol as substrate. Results Four glda-4's bases in the second fifth and sixth codon were different with glda-wt so AT-content of the optimized gene was up to 80. 0% higher than the wild gene's 53. 3%. Furthermore enzyme activity of E. coli-4's crude extract was 191. 3 U / ml more three times than E. coli-wt's 48. 3 U / ml. Conclusion This optimization scheme was quick and easy but indeed increased dehydrogenase's activity. It possible becomes a universal method to improve heterogenous expression level of target genes. Keywords glycerol dehydrogenase GDH AT- content heterologous expression codon optimization Escherichia coli Supported by the National Natural Science Foundation of China 21076172 30770059 * Corresponding author. Tel + 86-592-2185869 E-mail fbs@ xmu. edu. cn Received 4 November 2010 / Revised 7 January 2011