ΜΕΛΕΤΗ ΓΕΝΕΤΙΚΩΝ ΠΟΛΥΜΟΡΦΙΣΜΩΝ ΚΑΙ ΤΡΟΠΙΣΜΟΥ HIV-1 ΣΤΕΛΕΧΩΝ ΟΡΟΘΕΤΙΚΩΝ

Μέγεθος: px
Εμφάνιση ξεκινά από τη σελίδα:

Download "ΜΕΛΕΤΗ ΓΕΝΕΤΙΚΩΝ ΠΟΛΥΜΟΡΦΙΣΜΩΝ ΚΑΙ ΤΡΟΠΙΣΜΟΥ HIV-1 ΣΤΕΛΕΧΩΝ ΟΡΟΘΕΤΙΚΩΝ"

Transcript

1 ΑΡΙΣΤΟΤΕΛΕΙΟ ΠΑΝΕΠΙΣΤΗΜΙΟ ΘΕΣΣΑΛΟΝΙΚΗΣ ΣΧΟΛΗ ΕΠΙΣΤΗΜΩΝ ΥΓΕΙΑΣ ΤΜΗΜΑ ΙΑΤΡΙΚΗΣ ΤΟΜΕΑΣ ΒΙΟΛΟΓΙΚΩΝ ΕΠΙΣΤΗΜΩΝ ΚΑΙ ΠΡΟΛΗΠΤΙΚΗΣ ΙΑΤΡΙΚΗΣ Α ΕΡΓΑΣΤΗΡΙΟ ΜΙΚΡΟΒΙΟΛΟΓΙΑΣ Διευθυντής: Καθηγητής Νικόλαος Μαλισιόβας Πανεπ. Έτος: Αριθμ. Διατριβής: 3019 ΜΕΛΕΤΗ ΓΕΝΕΤΙΚΩΝ ΠΟΛΥΜΟΡΦΙΣΜΩΝ ΚΑΙ ΤΡΟΠΙΣΜΟΥ HIV-1 ΣΤΕΛΕΧΩΝ ΟΡΟΘΕΤΙΚΩΝ ΖΩΗ -ΑΝΝΑ Α. ΑΝΤΩΝΙΑΔΟΥ ΙΑΤΡΟΣ ΔΙΔΑΚΤΟΡΙΚΗ ΔΙΑΤΡΙΒΗ ΥΠΟΒΛΗΘΗΚΕ ΣΤΟ ΤΜΗΜΑ ΙΑΤΡΙΚΗΣ ΤΗΣ ΣΧΟΛΗΣ ΕΠΙΣΤΗΜΩΝ ΥΓΕΙΑΣ ΤΟΥ ΑΡΙΣΤΟΤΕΛΕΙΟΥ ΠΑΝΕΠΙΣΤΗΜΙΟΥ ΘΕΣΣΑΛΟΝΙΚΗΣ ΘΕΣΣΑΛΟΝΙΚΗ 2014

2

3 Η ΤΡΙΜΕΛΗΣ ΕΠΙΤΡΟΠΗ ΜΑΛΙΣΙΟΒΑΣ ΝΙΚΟΛΑΟΣ ΦΡΑΝΤΖΙΔΟΥ ΦΙΛΑΝΘΗ ΝΙΚΟΛΑΪΔΗΣ ΠΑΥΛΟΣ ΚΑΘΗΓΗΤΗΣ ΟΜΟΤΙΜΗ ΚΑΘΗΓΗΤΡΙΑ ΚΑΘΗΓΗΤΗΣ Η ΕΠΤΑΜΕΛΗΣ ΕΠΙΤΡΟΠΗ ΜΑΛΙΣΙΟΒΑΣ ΝΙΚΟΛΑΟΣ ΦΡΑΝΤΖΙΔΟΥ ΦΙΛΑΝΘΗ ΝΙΚΟΛΑΪΔΗΣ ΠΑΥΛΟΣ ΚΥΡΙΑΖΗΣ ΓΕΩΡΓΙΟΣ ΔΙΖΑ-ΜΑΤΑΦΤΣΗ ΕΥΔΟΞΙΑ ΣΚΟΥΡΑ ΛΕΜΟΝΙΑ ΜΕΤΑΛΛΙΔΗΣ ΣΥΜΕΩΝ ΚΑΘΗΓΗΤΗΣ ΟΜΟΤΙΜΗ ΚΑΘΗΓΗΤΡΙΑ ΚΑΘΗΓΗΤΗΣ ΚΑΘΗΓΗΤΗΣ ΚΑΘΗΓΗΤΡΙΑ ΕΠΙΚΟΥΡΟΣ ΚΑΘΗΓΗΤΡΙΑ ΛΕΚΤΟΡΑΣ «Η έγκριση της Διδακτορικής Διατριβής υπό της Ιατρικής Σχολής του Αριστοτελείου Πανεπιστημίου Θεσσαλονίκς, δεν υποδηλοί αποδοχή των γνωμών του συγγραφέως» (Νόμος 5343/32, άρθρο 202, παρ. 2 και νόμος 1268/82, άρθρο 50, παρ. 8)

4

5 ΑΡΙΣΤΟΤΕΛΕΙΟ ΠΑΝΕΠΙΣΤΗΜΙΟ ΘΕΣΣΑΛΟΝΙΚΗΣ ΙΑΤΡΙΚΗ ΣΧΟΛΗ ΠΡΟΕΔΡΟΣ ΤΗΣ ΣΧΟΛΗΣ ΓΑΡΥΦΑΛΟΣ ΑΛΕΞΑΝΔΡΟΣ-ΑΝΑΣΤΑΣΙΟΣ

6

7 Στον αδελφό μου Φώτη Αντωνιάδη ( ). Στους γονείς μου και στον αδελφό μου Αλέξανδρο, που είναι πάντα δίπλα μου σε κάθε μου προσπάθεια.

8

9 ΠΕΡΙΕΧΟΜΕΝΑ ΠΕΡΙΕΧΟΜΕΝΑ... 9 ΕΙΣΑΓΩΓΗ ΚΕΦΑΛΑΙΟ 1ο ΓΕΝΙΚΟ ΜΕΡΟΣ Ο ΙΟΣ ΤΗΣ ΑΝΘΡΩΠΙΝΗΣ ΑΝΟΣΟΑΝΕΠΑΡΚΕΙΑΣ (HIV) ΤΑΞΙΝΟΜΗΣΗ, ΔΟΜΗ, ΑΝΑΠΑΡΑΓΩΓΗ, ΤΡΟΠΙΣΜΟΣ, ΑΝΟΣΟΛΟΓΙΚΗ ΑΝΤΑΠΟΚΡΙΣΗ Ταξινόμηση του HIV Δομή του σωματιδίου του HIV Το γονιδίωμα του HIV Αναπαραγωγή του HIV Tροπισμός του HIV Ανοσολογική ανταπόκριση στην HIV/AIDS λοίμωξη Χυμική Ανοσία Κυτταρική ανοσία ΚΕΦΑΛΑΙΟ 2ο ΓΕΝΕΤΙΚΗ ΠΟΙΚΙΛΟΜΟΡΦΙΑ ΤΟΥ HIV-1. ΟΜΑΔΕΣ ΚΑΙ ΥΠΟΤΥΠΟΙ ΤΟΥ HIV-1, ΓΕΩΓΡΑΦΙΚΗ ΚΑΤΑΝΟΜΗ ΥΠΟΤΥΠΩΝ, ΣΥΧΕΤΙΣΜΟΣ ΥΠΟΤΥΠΩΝ ΚΑΙ ΠΑΘΟΓΕΝΕΙΑΣ Ομάδες και υπότυποι του HIV Γεωγραφική κατανομή των υποτύπων της ομάδας Μ του HIV Συσχετισμός HIV-1 υποτύπων και παθογένειας ΚΕΦΑΛΑΙΟ 3ο ΕΠΙΔΗΜΙΟΛΟΓΙΑ ΤΗΣ HIV-1 ΛΟΙΜΩΞΗΣ, ΠΑΝΔΗΜΙΑ ΤΟΥ ΗΙV-1, ΗΙV-1 ΛΟΙΜΩΞΗ ΣΤΗΝ ΕΛΛΑΔΑ Πανδημία του ΗΙV HIV-1 λοίμωξη στην Ελλάδα

10 ΖΩΗ-ΑΝΝΑ ΑΝΤΩΝΙΑΔΟΥ ΔΙΔΑΚΤΟΡΙΚΗ ΔΙΑΤΡΙΒΗ ΚΕΦΑΛΑΙΟ 4ο ΚΛΙΝΙΚΟ ΣΥΝΔΡΟΜΟ (AIDS), ΑΝΤΡΕΤΡΟΪΚΗ ΘΕΡΑΠΕΙΑ, ΔΙΑΓΝΩΣΗ, ΠΡΟΛΗΨΗ Σύνδρομο Επίκτητης Ανοσολογικής Ανεπάρκειας (AIDS) Αντιρετροϊκή θεραπεία Αντοχή του HIV-1 στα αντιρετροϊκά φάρμακα Μεταλλάξεις αντοχής του γονιδίου της ανάστροφης μεταγραφάσης.. 64 Μεταλλάξεις αντοχής του γονιδίου της πρωτεάσης Μεταλλάξεις αντοχής του γονιδίου της ιντεγκράσης Αντοχές που οφείλονται σε αναστολείς σύντηξης Αντοχές που οφείλονται σε ανταγωνιστές CCR Μεταδιδόμενη αντοχή φαρμάκων(transmitted Drug Resistance-TDR) από τα στελέχη του HIV Εργαστηριακή διάγνωση της HIV-1 λοίμωξης Πρόληψη της HIV-1 λοίμωξης Εμβόλια έναντι της HIV-1 λοίμωξης ΕΙΔΙΚΟ ΜΕΡΟΣ ΣΚΟΠΟΣ ΤΗΣ ΠΑΡΟΥΣΑΣ ΜΕΛΕΤΗΣ ΥΛΙΚΟ ΚΑΙ ΜΕΘΟΔΟΙ HIV-1 ΟΡΟΘΕΤΙΚΑ ΑΤΟΜΑ, ΕΡΩΤΗΜΑΤΟΛΟΓΙΟ, ΣΥΛΛΟΓΗ ΔΕΙΓΜΑΤΩΝ ΑΙΜΑΤΟΣ HIV-1 οροθετικά άτομα Ερωτηματολόγιο Συλλογή δειγμάτων αίματος Α. ΔΙΑΧΩΡΙΣΜΟΣ ΤΩΝ ΠΕΡΙΦΕΡΙΚΩΝ ΜΟΝΟΠΥΡΗΝΩΝ ΚΥΤΤΑΡΩΝ ΚΑΙ ΤΟΥ ΠΛΑΣΜΑΤΟΣ, ΓΕΝΟΤΥΠΙΚΗ ΑΝΑΛΥΣΗ ΤΗΣ ΑΝΑΣΤΡΟΦΗΣ ΜΕΤΑΓΡΑΦΑΣΗΣ ΚΑΙ ΤΗΣ ΠΡΩΤΕΑΣΗΣ ΤΟΥ ΓΟΝΙΔΙΟΥ Pol ΤΟΥ HIV Διαχωρισμός των Περιφερικών Μονοπύρηνων Κυττάρων (PBMs) και του πλάσματος του αίματος Γενοτυπική ανάλυση περιοχών της Ανάστροφης Μεταγραφάσης (RT) και της Πρωτεάσης (PR) του γονιδίου Pol Εκχύλιση RNA από το πλάσμα αίματος Ενίσχυσις περιοχών της ανάστροφης μεταγραφάσης (RT) και της πρωτεάσης (PR) του γονιδίου Pol

11 ΠΕΡΙΕΧΟΜΕΝΑ Προσδιορισμός των αλληλουχιών του RNA Επεξεργασία των αλληλουχιών του HIV-1 της περιοχής pol (RT-PR) Φυλογενετική ανάλυση της περιοχής pol (RT-PR) B. ΓΕΝΟΤΥΠΙΚΗ ΑΝΑΛΥΣΗ ΤΟΥ ΓΟΝΙΔΙΟΥ Env ΤΟΥ HIV-1. ΣΥΓΚΡΙΣΗ ΤΟΥ ΚΥΤΤΑΡΙΚΟΥ ΙΪΚΟΥ ΦΟΡΤΙΟΥ ΜΕ ΤΟ ΙΪΚΟ ΦΟΡΤΙΟ ΤΟΥ ΠΛΑΣΜΑΤΟΣ, ΤΗ ΜΕΤΑΔΙΔΟΜΕΝΗ ΑΝΤΟΧΗ ΚΑΙ ΤΟΝ ΑΡΙΘΜΟ ΤΩΝ CD 4 T ΛΕΜΦΟΚΥΤΤΑΡΩΝ, ΠΡΟΣΔΙΟΡΙΣΜΟΣ ΤΩΝ ΣΥΝΥΠΟΔΟΧΕΩΝ ΤΟΥ HIV Γενοτυπική ανάλυση του γονιδίου env του hiv Εκχύλιση του γενωμικού DNA από τα μονοπύρηνα κύτταρα του περιφερικού αίματος (PBMCs) Ενίσχυση της περιοχής του V3-βρόγχου της γλυκοπρωτείνης gp120 του γονιδίου Env Πρώτη Nested- PCR ενίσχυσης της περιοχής C2-C5 του γονιδίου env.. 89 Δεύτερη Nested- PCR ενίσχυσης των προϊόντων της πρώτης Nested- PCR Ελεγχος της περιοχής Env (C2-C5) των προϊόντων της δεύτερης Nested- PCR Καθαρισμός προϊόντων της δεύτερης Νested PCR Κυκλική αλληλούχιση ενίσχυσης της περιοχής Env (C2-C5) του HIV ΣΥΣΧΕΤΙΣΗ ΤΟΥ ΚΥΤΤΑΡΙΚΟΥ ΙΪΚΟΥ ΦΟΡΤΙΟΥ ΜΕ ΤΟ ΙΪΚΟ ΦΟΡΤΙΟ ΤΟΥ ΠΛΑΣΜΑΤΟΣ, ΤΗ ΜΕΤΑΔΙΔΟΜΕΝΗ ΑΝΤΟΧΗ ΚΑΙ ΤΟΝ ΑΡΙΘΜΟ ΤΩΝ CD 4 T ΛΕΜΦΟΚΥΤΤΑΡΩΝ Συσχέτιση του κυτταρικού ιϊκού φορτίου και της μεταδιδόμενης αντοχής φαρμάκων Προσδιορισμός του κυτταρικού ιικού φορτίου ΠΡΟΣΔΙΟΡΙΣΜΟΣ ΤΩΝ ΣΥΝΥΠΟΔΟΧΕΩΝ ΤΟΥ HIV Ποσοτικοποίηση του HIV-1 STS DNA (Ακραίων Ορίων των DNΑ στην αλληλουχία Sequence Tagged Sites) και των CCR5 Αλληλίων Σύγκριση των επίπεδων του κυτταρικού DNA του HIV-1 με τη μεταδιδόμενη αντοχή στα αντιρετροικά φάρμακα Προσδιορισμός επίπεδων κυτταρικού ιικού φορτίου των υποτύπων του HIV Σχέση ιικού φορτίου του πλάσματος και του κυτταρικού ιικου φορτίου Κατασκευή του φυλογενετικού δέντρου γειτονικών ενώσεων

12 ΖΩΗ-ΑΝΝΑ ΑΝΤΩΝΙΑΔΟΥ ΔΙΔΑΚΤΟΡΙΚΗ ΔΙΑΤΡΙΒΗ ΑΠΟΤΕΛΕΣΜΑΤΑ Στατιστική ανάλυση ερωτηματολογίου Φυλογενετική ανάλυση αλληλουχιών του γονιδίου Pol Σύγκριση κυτταρικού DNA με το RNA του πλάσματος και των CD4 Τ λεμφοκυττάρων ΣΥΖΗΤΗΣΗ ΣΥΜΠΕΡΑΣΜΑΤΑ ΠΕΡΙΛΗΨΗ SUMMARY ΒΙΒΛΙΟΓΡΑΦΙΑ

13 ΕΙΣΑΓΩΓΗ Το σύνδρομο της επίκτητης ανοσολογικής ανεπάρκειας (AIDS) αναφέρθηκε για πρώτη φορά το Οι πρώτες αναφορές το περιέγραψαν σαν μία ασυνήθιστη αύξηση των περιστατικών σαρκώματος Kaposi και πνευμονίας από Pneumocystis Carinii Pneumonia (PCP) κυρίως σε ομοφυλόφιλους άνδρες που συνοδεύονταν από ασυνήθη συνύπαρξη έντονης ανοσολογικής ανεπάρκειας. Το 1983 ο ιός της ανθρώπινης ανοσοανεπάρκειας (HIV), αναγνωρίστηκε για πρώτη φορά ως το αίτιο του AIDS. O HIV προκαλεί κατάπτωση του ανοσολογικού συστήματος των ασθενών, με αποτέλεσμα την πληθώρα λοιμώξεων από διάφορους παθογόνους μικροοργανισμούς και την εμφάνιση νεοπλασιών που τελικά οδηγούν στο θάνατο. Ο ιός μεταδίδεται κυρίως από την επαφή με σωματικά βιολογικά υγρά όπως αίμα, σπέρμα, κολπικά υγρά και μητρικό γάλα. Οι πιο συχνοί τρόποι μετάδοσης είναι η ανασφαλής σεξουαλική επαφή, η χρήση μη αποστειρωμένων βελόνων,οι μεταγγίσεις μη ελεγμένου αίματος και η μετάδοση από οροθετική μητέρα στο βρέφος κατά τον τοκετό ή θηλασμό. Το πρώτο αντιρετροϊκό φάρμακο, το AZT (zidovudine,retrovir ), κυκλοφόρησε το 1987 και παρόλο που σαν μονοθεραπεία δεν επαρκούσε για την καταστολή του ιού για μεγάλα διαστήματα, σίγουρα όμως προκαλούσε επιμήκυνση της καλής ποιότητας ζωής των προσβεβλημένων από τον ιό ατόμων. Με την εισαγωγή όμως της Υψηλής Δραστικότητας Αντιρετροϊκής Αγωγής (HAART) το 1996, μειώθηκε δραματικά η επίδραση του ιού στο ανοσοποιητικό σύστημα. Η HAART θεραπεία αφορά στο συνδυασμό της δράσης διαφόρων αντιρετροϊκών φαρμάκων. Παράλληλα με τη βελτίωση της ποιότητας της ζωής των ασθενών αυτών παρατηρήθηκε και σημαντική μείωση της θνητότητας από AIDS έως και 80%, αυξάνοντας το προσδόκιμο της ζωής των ατόμων αυτών κατά χρόνια, γεγονός που προσδίδει πλέον στον HIV το χαρακτήρα της χρόνιας νόσου. 13

14 ΖΩΗ-ΑΝΝΑ ΑΝΤΩΝΙΑΔΟΥ ΔΙΔΑΚΤΟΡΙΚΗ ΔΙΑΤΡΙΒΗ Παρόλα ταύτα, μέχρι σήμερα, αποτελεσματικούς έλεγχος της πανδημίας του AIDS δεν έχει επιτευχθεί. Το γεγονός αυτό οφείλεται κυρίως στην μοριακή παθογένεια του HIV-1, ο οποίος χρησιμοποιεί διάφορους μηχανισμούς, με αποτέλεσμα να διαφεύγει τον έλεγχο του ανοσολογικού συστήματος λόγω του μεγάλου βαθμού γλυκοζυλίωσης της εξωτερικής γλυκοπρωτεϊνης, η οποία προστατεύει τους εξωτερικούς επίτοπους του ιού, της άμεσης στοχοποίηση από τον ιό των CD4 T λεμφοκυττάρων, η οποία είναι βασική για την ενεργοποίηση των Τ λεμφοκυττάρων στην ανοσολογική α- νταπόκριση, της ενσωμάτωσης του DNA του ιού στο γένωμα του ξενιστή με αποτέλεσμα τα κύτταρα τα οποία δεν φονεύονται με την αντιρετρoϊκή θεραπεία να φέρουν μόνιμα τον ιό και τέλος η ιδιότητα των συχνών μεταλλάξεων του ιού λόγω του γρήγορου κύκλου αναπαραγωγής και της α- ντιρετροϊκής θεραπείας, οδηγεί στην διαφυγή της ανοσολογικής ανταπόκρισης του ξενιστή (μεταλλαξιακή διαφυγή) και στην εμφάνιση μεγάλης γενετικής ποικιλομορφίας. Ως εκ τούτου, ο προσδιορισμός της γενετικής ποικιλομορφίας του HIV- 1 και των μεταλλάξεων αντοχής στα αντιρετροϊκά φάρμακα σε μία γεωγραφική περιοχή, σε τακτά χρονικά διαστήματα, συμβάλλει στην πορεία εξέλιξης της νόσου, στην ανταπόκριση της αντιρετροϊκής θεραπείας και στην ανάπτυξη παρασκευής εμβολίων ενώ ο προσδιορισμός του κυτταρικού DNA του HIV-1 στα νεοδιαγνωσθέντα άτομα και στα άτομα με αντρετροϊκή θεραπεία είναι βασικός για την πρόληψη της μετάδοσης του ιού. Η παρούσα μελέτη, πραγματοποιήθηκε για να προσδιορίσει την γενετική ποικιλομορφία του HIV-1 και άλλους επιδημιολογικούς δείκτες στην περιοχή της Β. Ελλάδας κατά το χρονικό διάστημα Τα αποτελέσματα αυτής της μελέτης συγκρίθηκαν με προηγούμενα αποτελέσματα που αφορούσαν την ίδια περιοχή ούτως ώστε να βρεθεί η ύπαρξη νέων δεδομένων, τα οποία θα συμβάλλουν στην αντιμετώπιση της HIV-1/AIDS λοίμωξης. Το πειραματικό μέρος πραγματοποιήθηκε κατά κύριο λόγo στο Τμήμα Μοριακής Βιολογίας του Πανεπιστημίου της Κύπρου και εν μέρει στο Εθνικό Κέντρο Αναφοράς AIDS Β. Ελλάδας (Α Εργαστήριο Μικροβιολογίας Ιατρική Σχολή, Αριστοτέλειο Πανεπιστήμιο Θεσσαλονίκης). 14

15 ΕΙΣΑΓΩΓΗ Από τη θέση αυτή θα ήθελα να ευχαριστήσω θερμά τον επιβλέποντα καθηγητή μου, Καθηγητή Μικροβιολογίας, κ. Νικόλαο Μαλισιόβα για την ανάθεση της διδακτορικής διατριβής μου,για την πολύτιμη καθοδήγηση και συνεχή στήριξη και συμπαράσταση σε όλη την πορεία της διατριβής. Ευχαριστώ θερμά την Ομ. Καθηγήτρια Μικροβιολογίας κα Φιλάνθη Φραντζίδου και τον Ομ. Καθηγητή Παθολογίας κ. Παύλο Νικολαίδη,μέλη της τριμελούς επιτροπής για την πολύτιμη συμβολή τους κατά εκπόνηση της διδακτορικής διατριβής. Θα ήθελα να ευχαριστήσω τα υπόλοιπα μέλη της εξεταστικής επιτροπής μου, τον Καθηγητή Βιοπαθολογίας/Εργαστηριακής Ανοσολογίας κ. Γεώργιο Κυριαζή, την Καθηγήτρια Μικροβιολογίας κα Ευδοξία Δίζα- Ματαυτσή, την Επίκουρη Καθηγήτρια Μικροβιολογίας κα Λεμονιά Σκούρα και τέλος τον Λέκτορα Παθολογίας κ. Συμεών Μεταλλίδη για την τιμή που μου έκαναν να συμμετέχουν στην κρίση της διδακτορικής μου διατριβής. Θα ήθελα να ευχαριστήσω ιδιαίτερα θερμά τον Καθηγητή Μοριακής Βιολογίας του Πανεπιστημίου Κύπρου κ. Λεόντιο Κωστρίκη για την ανεκτίμητη βοήθεια και συμπαράσταση που μου έδωσε καθόλη την διενέργεια των πειραματικών ερευνών οι οποίες πραγματοποιήθηκαν στο Πανεπιστήμιο της Κύπρου και για τις συμβουλές και γνώσεις που μου μετέφερε στην πορεία της διδακτορικής μου διατριβής. Πιστεύω ότι η καθοδήγηση του σε πρακτικό και θεωρητικό επίπεδο ήταν πραγματικά πολύτιμη. Πολλές ευχαριστίες οφείλω στις Ιωάννα Κιουσιάππα και Johanka Hezka από το τμήμα Μοριακής Βιολογίας του Πανεπιστημίου Κύπρου για την πολύτιμη βοήθεια, συμπαράσταση και φιλία που απλόχερα μου έδωσαν κατά την πορεία της διενέργειας των πειραματικών ερευνών καθώς και στον Ιωάννη Μάμαη για την στατιστική επεξεργασία των αποτελεσμάτων. Επίσης, θα ήθελα να ευχαριστήσω από το Κέντρο Αναφοράς AIDS Βορείου Ελλάδας τους Ευαγγελία Παπαδημητρίου, Αποστολία Μαργαρίτη,Ρούλα Στουραίτη και Ανδρέα Κουρελή για την πολύτιμη συμπαράσταση τους κατά την πορεία της συλλογής και επεξεργασίας των δειγμάτων μου. Πολλές ευχαριστίες οφείλω και στους γιατρούς της Μονάδας Ειδικών Λοιμώξεων του Γ.Π.Ν.Θ. ΑΧΕΠΑ, κ. Παναγιώτη Κολλάρα, κ. Συμεών Μεταλλίδη, κ. Θεόφιλο Χρυσανθίδη, κα Δέσποινα Βαλαγκούτη και τους κα Ισιδώ- 15

16 ΖΩΗ-ΑΝΝΑ ΑΝΤΩΝΙΑΔΟΥ ΔΙΔΑΚΤΟΡΙΚΗ ΔΙΑΤΡΙΒΗ ρα Μπακαίμη κ.καραπιπέρη Δημήτρη καθώς επίσης και τον κ. Πιλάλα Δημήτρη για την πολύτιμη στήριξη και υπομονή που μου έδειξαν κατά τη διάρκεια της συλλογής των δειγμάτων αίματος και των επιδημιολογικών στοιχείων του ερωτηματολογίου. Επίσης, ευχαριστώ θερμά όλα τα οροθετικά άτομα που δέχτηκαν να συμμετέχουν στη μελέτη αυτή. Τέλος θα ήθελα να ευχαριστήσω την οικογένεια μου και τους φίλους μου που ήταν στο πλάι μου σε όλη την διάρκεια του φιλόδοξου και δύσκολου αυτού ταξιδιού μου και ιδιαίτερα τον πατέρα μου Αντώνη Αντωνιάδη για την πολύτιμη συμπαράσταση, υπομονή και ακούραστη βοήθεια που μου προσέφερε σε όλη τη διάρκεια της εκπόνησης της διδακτορικής μου διατριβής. 16

17 ΓΕΝΙΚΟ ΜΕΡΟΣ

18

19 ΚΕΦΑΛΑΙΟ 1ο Ο ΙΟΣ ΤΗΣ ΑΝΘΡΩΠΙΝΗΣ ΑΝΟΣΟΑΝΕΠΑΡΚΕΙΑΣ (HIV) ΤΑΞΙΝΟΜΗΣΗ, ΔΟΜΗ, ΑΝΑΠΑΡΑΓΩΓΗ, ΤΡΟΠΙΣΜΟΣ, ΑΝΟΣΟΛΟΓΙΚΗ ΑΝΤΑΠΟΚΡΙΣΗ Ταξινόμηση του HIV-1 Ο ιός της Ανθρώπινης Ανοσοανεπάρκειας (Human Immunodeficiency Virus-HIV) είναι RNA ιός, ο οποίος ανήκει στο γένος Lentivirus της οικογένειας Retroviridae. Η οικογένεια Retroviridae ταξινομείται στην τάξη VI, στην κατά David Baltimore ταξινόμηση των ιών (Εικόνα 1) και περιλαμβάνει δύο υποοικογένειες, επτά γένη και πενήντα δύο είδη. Οι HIV1 και 2 α- νήκουν στην υποοικογένεια Orthoretrovirinae του γένους Lentivirus στο οποίο περιλαμβάνονται τα είδη: Visna/maedi virus, Simian immunodeficiency virus, Puma lent virus, Human immunodeficiency virus 2, Human immunodeficiency virus 1, Feline immunodeficiency virus, Equine infectious anaemia virus, Caprine arthritis encephalitis virus, Bovine immunodeficiency virus. (Seventh Report of the International Committee on Taxonomy of Viruses, 2002) (http://www.ncbi.nlm.nih.gov/ictv). Περαιτέρω οι HIV-1 και HIV- 2. απαρτίζονται από τρείς ομάδες και επτά υπότυπους αντίστοιχα (King et al., 2012, Aguchi et al., 2000). O HIV-1 είναι ο συχνότερος και μεγαλύτερος αιτιολογικός παράγων του AIDS παγκοσμίως, με 33 εκατ. άτομα να έχουν μολυνθεί από αυτόν κυρίως στις αναπτυσσόμενες χώρες της Υποσαχάριας Αφρικής, Ασίας και Νότιας Αμερικής. 19

20 ΖΩΗ-ΑΝΝΑ ΑΝΤΩΝΙΑΔΟΥ ΔΙΔΑΚΤΟΡΙΚΗ ΔΙΑΤΡΙΒΗ ΕΙΚΟΝΑ 1: Ταξινόμηση ιών κατά τον David Baltimore. Όλα τα μέλη της ομάδας VI (Group VI) χρησιμοποιούν το ένζυμο ανάστροφη μεταγραφάση το οποίο κωδικοποιείται από τον ιό. Η ανάστροφη μεταγραφάση είναι μία RNAεξαρτώμενη DNA πολυμεράση για την παραγωγή DNA από το RNA του ιού. Αυτό το DNA ενσωματώνεται συχνά στο γένωμα του ξενιστήκυττάρου όπως συμβαίνει στην περίπτωση των Retro-ιών και των Pseudoιών όπου αναπαράγεται και μεταγράφεται από τον ξενιστή. Δομή του σωματιδίου του HIV-1 Το σωματίδιο του HIV-1 (εικόνα 2) έχει δομή εικοσάεδρου με διάμετρο 100 nm. Περιέχει δύο αντίγραφα μονόκλωνου θετικής πολικότητας RNA 9,8 κιλοβάσεων (kb). τα οποία περιβάλλονται από ένα κωνικό καψίδιο που αποτελείται από 2000 αντίγραφα της ιϊκής πρωτεΐνης p24. Το μονόκλωνο RNA είναι στενά συνδεδεμένο με την πρωτεΐνη P7 και με τα ένζυμα ανάστροφη μεταγραφάση, ιντεγκράση και πρωτεάση, τα οποία είναι απαραίτητα για την αναπαραγωγή του ώριμου σωματιδίου του ιού (virion). Το νουκλεοκαψίδιο του ιού περιβάλλεται από την ιϊκή πρωτεΐνη p17 (matrix), η οποία εξασφαλίζει την αρτιότητα του ώριμου σωματιδίου του ιού. Η πρωτεΐνη p17 περιβάλλεται από διπλή φωσφολιπιδική στοιβάδα (φάκελος) την οποία προσλαμβάνει ο ιός στο στάδιο της απελευθέρω- 20

21 ΚΕΦΑΛΑΙΟ 1 ο Ο ΙΟΣ ΤΗΣ ΑΝΘΡΩΠΙΝΗΣ ΑΝΟΣΟΑΝΕΠΑΡΚΕΙΑΣ (HIV) σης του κατά την διάρκεια της σύντηξης με την κυτταρική μεμβράνη του κύτταρου ξενιστή (Wyatt R et al., 1998). ΕΙΚΟΝΑ 2: Σχεδιάγραμμα του σωματιδίου του HIV-1 Η διπλή φωσφολιπιδική στοιβάδα είναι διάστικτη από πρωτεΐνες του κυττάρου ξενιστή και στην επιφάνεια της προβάλλουν 72 εξωτερικές ά- κανθες ιϊκής γλυκοπρωτεϊνης οι οποίες σχηματίζονται από δύο κύριες γλυκοπρωτεϊνες του φακέλου, την διαμεμβρανιακώς εκτεινόμενη gp41 και την εξωμεμβρανιακή gp120 (Zanelki et al., 2006). Οι δεσμοί μεταξύ των γλυκοπρωτεϊνών gp120 και gp41 είναι χαλαροί και μπορεί να διασπασθούν με αποτέλεσμα, η gp120 να βρεθεί ελεύθερη στο τοπικό περιβάλλον, στο πλάσμα και στους λεμφικούς ιστούς του μολυσμένου ατόμου. Οι γλυκοπρωτεϊνες αυτές είναι απαραίτητες για την προσκόλληση του HIV-1 στους υποδοχείς του κυττάρου ξενιστή (Chan DC et al, 1997). Κατά τη διάρκεια της εκβλάστησης, ο ιός μπορεί να ενσωματώσει διάφορες πρωτείνες από την επιφάνεια του κυττάρου ξενιστή όπως τα αντιγόνα HLA τάξης Ι και ΙΙ και πρωτεΐνες συγκολλήσεως ICAM-1, οι οποίες δύνανται να διευκολύνουν την προσκόλληση σε άλλα κύτταρα-στόχους. Η ρ17 πρωτεΐνη αγκυρώνεται 21

22 ΖΩΗ-ΑΝΝΑ ΑΝΤΩΝΙΑΔΟΥ ΔΙΔΑΚΤΟΡΙΚΗ ΔΙΑΤΡΙΒΗ στο εσωτερικό της λιποπρωτεινικής ιικής μεμβράνης. Το ρ24 αντιγόνο του πυρήνα περικλείει δύο αντίγραφα του HIV-1 RNA. που αποτελούν τμήμα ενός σύμπλοκο πρωτεΐνης-νουκλεϊκού οξέος, το οποίο αποτελείται εκτός των δύο αντιγράφων RNA, από την νουκλεοπρωτεΐνη p7 και την ανάστροφη μεταγραφάση ρ66 (RT). Το ιικό σωματίδιο περιέχει όλα τα ένζυμα που είναι απαραίτητα για την αντιγραφή του, δηλαδή μια ανάστροφη μεταγραφάση (RT), μία ιντεγκράση την Ρ32 και μία πρωτεάση την Ρ11 (Gelderblom et al., 1993) Το γονιδίωμα του HIV-1 ΕΙΚΟΝΑ 3: Γονιδίωμα του HIV με τα γονίδια του. (HIV BOOK ) Όπως αναφέρθηκε παραπάνω, το γονιδίωμα του HIV-1, αποτελείται από δύο όμοια μονόκλωνα μόρια RNΑ θετικής πολικότητας κάθε ένα από τα οποία έχει μήκος 9,8 κιλοβάσεων. Το γονιδίωμα του HIV-1 αποτελείται από εννέα ανοιχτά πλαίσια ανάγνωσης και από το 5 άκρο (5 LTR) μέχρι και το 3 άκρο (3 LTR) περιέχει το γονίδιο gag (group antigen) για την παραγωγή εσωτερικών δομικών πρωτεϊνών, το γονίδιο pol (polymerase) για την σύνθεση των ενζύμων, το γονίδιο env (envelope) για την παραγωγή των 22

23 ΚΕΦΑΛΑΙΟ 1 ο Ο ΙΟΣ ΤΗΣ ΑΝΘΡΩΠΙΝΗΣ ΑΝΟΣΟΑΝΕΠΑΡΚΕΙΑΣ (HIV) πρωτεϊνών του φακέλου και τα γονίδια Tat, Rev, Vpu, Vif, Vpr και Nef για την παραγωγή ρυθμιστικών και βοηθητικών πρωτεϊνών (Εικόνα 3). Οι Μακρές Ακραίες Επαναλήψεις (ΜΑΕ) είναι διακριτές περιοχές του γονιδιώματος, από τις οποίες αρχίζει η διαδικασία της μεταγραφής για την σύνθεση του RNA (Freed EO και Marrin MA 2001). Οι ΜΑΕ, περιέχουν ι- σχυρούς μεταγραφικούς υποκινητές και απαρτίζονται από τις περιοχές U3, R και U5. Η περιοχή U3 είναι μόνο για το άκρο 3, η R για τις επαναλήψεις και η U5 μόνο για το άκρο 5. Η μεταγραφή για τη σύνθεση του RNA αρχίζει με την ένωση της περιοχής U3 με τη περιοχή R. Το γονίδιο gag κωδικοποιεί μία πρόδρομη πολυπρωτεΐνη, την πολυπρωτεϊνη Pr55Gag, η οποία διασπάται από την ιϊκή πρωτεάση (PR) σε ώριμες gag πρωτεΐνες οι οποίες είναι: η πρωτεΐνη ΜΑ ή p17 (matrix protein) που περιβάλει το νουκλεοκάψίδιο, η πρωτεΐνη CA ή p24 (core antigen) του καψιδίου, η πρωτεΐνη NS ή p7 του νουκλεοκαψιδίου και η πρωτεΐνη p6 (Freed 2001). Η πρωτεΐνη p17 είναι μία δομική πρωτεΐνη, η οποία εμπλέκεται στα περισσότερα στάδια του κύκλου αναπαραγωγής του ιού. Αποτελεί το Ν- τελικό άκρο της Pr55 Gag πολυπρωτεΐνης και μετά τη μετάφραση της σύνθεσης της Pr55 Gag τροποποιείται από το μυριστικό οξύ (Bukrinskaya 2007). Στο ώριμο σωματίδιο του ιού, η πρωτεΐνη ρ17 μετατρέπεται σε πολυπεπτίδιο 132 αμινοξέων, το οποίο σχηματίζει ένα προστατευτικό κάλυμμα (matrix) στην εσωτερική επιφάνεια του ιού γύρω από το νουκλεοκαψίδιο. Η πρωτεΐνη p17 αποτελείται από πέντε μεγάλες α-έλικες οι οποίες φαίνεται να ενώνουν τις δομές των πρωτεϊνών p17 και p24 της πολυπρωτεϊνης Pr55 Gag (Massiah 1994). Εκτός των παραπάνω, η πρωτεΐνη p17 δρώντας ως κυτοκίνη του ιού, ενώνεται με τον υποδοχέα p17r των Τ λεμφοκυττάρων αυξάνοντας την απελευθέρωση κυτοκινών πριν τη φλεγμονή, με αποτέλεσμα τη συντόμευση του κύκλου αναπαραγωγής του ιού (Fiorentini et al., 2006). Η πρωτεΐνη p24 όπως και η πρωτεΐνη p17 προέρχεται από την διάσπαση της πρόδρομης πολυπρωτεΐνης Pr55 Gag. Η πρωτεΐνη p24 είναι εσωτερική δομική πρωτεΐνη, η οποία περιβάλει το δίκλωνο RNA και τα ένζυμα του ιού. Η δομή του πυρήνα από σφαιρική σε κωνοειδή επιτυγχάνεται με την συμβολή της πρωτεΐνης p24. Η κωνική δομή του πυρήνα του σωματι- 23

24 ΖΩΗ-ΑΝΝΑ ΑΝΤΩΝΙΑΔΟΥ ΔΙΔΑΚΤΟΡΙΚΗ ΔΙΑΤΡΙΒΗ δίου του ιού περιέχει περίπου 2000 μόρια της πρωτείνης p24 και αποτελείται από δύο ανεξάρτητες στοιβάδες με N και C τελικές περιοχές (NTD, CTD). Η C τελική περιοχή λαμβάνει μέρος στο στάδιο της συναρμολόγησης του ιού προκαλώντας διμερισμό της πρωτεΐνης p24 και η τελική Ν περιοχή στο στάδιο της απέκδυσης μετά από σύνδεση με την κυκλοφιλίνη A(CypA) (Gamble et al., 1997, Luban 1996, Swanstrom and Willis 1997). Οι Ν-τελικές περιοχές της πρωτεΐνης p24 σχηματίζουν εξαμερείς δακτυλίους, ο καθένας εκ των οποίων συνδέεται με το δακτύλιο από τις γειτονικές CTD περιοχές της p24 με αποτέλεσμα να δημιουργείται ένα συμμετρικό πλέγμα. Στην Ν- τελική περιοχή της πρωτεΐνης p24 υπάρχει ένας βρόγχος πλούσιος σε προλίνη, ο οποίος περιέχει το πεπτίδιο Gly89-Pro90, το οποίο δεσμεύει την ειδική κυτταρική κυκλοφιλίνη Α(CypA) και συνδέεται άμεσα με την υψηλή μολυσματικότητα του HIV-1 (Gamble et al., 1996, Franke et al., 1994, Thali et al., 1994). Η πρωτεΐνη p7 είναι μία μικρού μεγέθους πρωτεΐνη προσκολλημένη στο RNA του ιού. Υπάρχουν περίπου 2000 αντίγραφα της πρωτεΐνης p7 μέσα στο καψίδιο του ιού, τα οποία επιδρούν στο RNA για το σχηματισμό των πρωτεϊνών του νουκλεοκαψιδίου και των πρωτεϊνών της ανάστροφης μεταγραφάσης και της ιντεγκράσης. Η πρωτεϊνη p7 είναι υπεύθυνη για την ενσωμάτωση του RNA γονιδιώματος μέσα στο καψίδιο και απαραίτητη για την σωστή συναρμολόγηση και την ωρίμανση του σωματιδίου του ιού (Berthoux 1997 και Didierlaurent 2011). Η πρωτεϊνη p6 είναι μία μικρού μεγέθους πρωτεΐνη (55 έως 74 αμινοξέα) και βρίσκεται στην πρόδρομη πολυπρωτεΐνη Gag-Pol σε περιοχές μεταξύ νουκλεοκαψιδίου και πρωτεάσης (Almog et al., 1996). Η πρωτεΐνη p6 συμβάλει κυρίως στην ρύθμιση της ενεργοποίησης της πρωτεάσης επηρεάζοντας παράλληλα και την ταχύτητα ωρίμανσης της (Chatterjee 2005). Επίσης, αν και δεν βρέθηκε μέχρι σήμερα αλληλοεπίδρασης μεταξύ των πρωτεϊνών p6 και Nef, είναι πιθανόν η πρωτεΐνη p6 να είναι ένας πρόσθετος παράγοντας εκτός της πρωτεΐνης Nef, ο οποίος συμβάλει στην παθογόνο δράση του HIV-1(Costa 2004). Το γονίδιο Pol κωδικοποιεί τα ένζυμα του HIV-1, τα οποία παράγονται από την πρόδρομη πολυπρωτεΐνη Pr160GagPol που δημιουργείται κατά την διάρκεια της μετάφρασης της πρωτεΐνης Pr55Gag. Τα εξειδικευμένα 24

25 ΚΕΦΑΛΑΙΟ 1 ο Ο ΙΟΣ ΤΗΣ ΑΝΘΡΩΠΙΝΗΣ ΑΝΟΣΟΑΝΕΠΑΡΚΕΙΑΣ (HIV) ένζυμα που κωδικοποιούνται από το γονίδιο pol, είναι η πρωτεάση (PR), η ανάστροφη μεταγραφάση (RT) και η ιντεγκράση (IN)(Katz και Skalka 1994). Η πρωτεάση του HIV-1 είναι μία ασπαρτιλική πρωτεάση (Retropepsin), η οποία διασπά διάφορες πολυπρωτεΐνες σε κατάλληλες περιοχές για το σχηματισμό ειδικών πρωτεϊνών που λαμβάνουν μέρος στον κύκλο αναπαραγωγής του ιού. Το μόριο της πρωτεάσης αποτελείται από δύο ό- μοιες πρωτεΐνες (υποομάδες) με 99 αμινοξέα η κάθε μία. Η ενεργός περιοχή του ενζύμου, Asp25, Thr26 και Gly27, βρίσκεται μεταξύ των δύο όμοιων υποομάδων (Davis 1990, Jakolski et al., 1991). Σε περιπτώσεις μη αποτελεσματικής δράσης της πρωτεάσης, τα ώριμα σωματίδια του ιού δεν αναπαράγονται, χάνουν την λοιμογόνο δύναμη και δεν προσβάλλουν άλλα κύτταρα (Kohl et al., 1988). Η ανάστροφη μεταγραφάση είναι μία ετεροδιμερής πρωτεΐνη (p66/p51) με περιοχές που χαρακτηρίζονται και στις δύο υποομάδες ως «δάχτυλα», «αντίχειρας», «παλάμη» και «σύνδεση» και μία περιοχή η ο- ποία χαρακτηρίζεται ως ριβονουκλεάση H, η οποία βρίσκεται μόνο στη μεγάλη υποομάδα (p66) (Rodgers et al., 1995). H ανάστροφη μεταγραφάση είναι μία DNA πολυμεράση με τρείς ενζυμικές δράσεις οι οποίες αφορούν τη σύνθεση του DNA με τη χρησιμοποίηση RNA ως εκμαγείου (ανάστροφη μεταγραφή), τη σύνθεση DNA με τη χρησιμοποίηση DNA ως εκμαγείου και την αποικοδόμηση του κλώνου του RNA σε υβρίδιο RNA: DNA με την επίδραση της ριβονουκλεάσης Η. Για την έναρξη της σύνθεσης του DNA, η ανάστροφη μεταγραφάση χρειάζεται έναν εκκινητή ο οποίος είναι ένα ειδικό μεταφορικό RNA (trna) που μεταφέρεται στο σωματίδιο του ιού από το προηγούμενο κύτταρο-ξενιστή (Goff 1990). Η ιντεγκράση είναι το βασικότερο στοιχείο για τις διαδικασίες που λαμβάνουν μέρος πριν την ενσωμάτωση και την ενσωμάτωση του DNA (προϊού) στο χρωμόσωμα του κυττάρου-ξενιστή. Η ινεγκράση είναι μία πρωτεΐνη που αποτελείται από 288 αμινοξέα και περιλαμβάνει τρείς ανεξάρτητες περιοχές (N-τελική, Κεντρική ή καταλυτική και C-τελική). Η N- τελική περιοχή περιέχει ένα HHCC ανάλογο το οποίο δεσμεύει Z 2+ και πιθανώς ευνοεί τον πολυμερισμό πρωτεϊνών που είναι απαραίτητες στη διαδικασία ενσωμάτωσης του προϊού στο χρωμόσωμα του κυττάρου (Zheng et al., 1995, Lee et al., 1997). Η Κεντρική ή καταλυτική περιοχή (R. Nase H πτυχή) είναι απαραίτητη για την καταλυτική δράση του ενζύμου καθώς ε- 25

26 ΖΩΗ-ΑΝΝΑ ΑΝΤΩΝΙΑΔΟΥ ΔΙΔΑΚΤΟΡΙΚΗ ΔΙΑΤΡΙΒΗ πίσης και στην ένωση των άκρων του DNA (Esposito και Craigie 1998). Η C- τελική περιοχή ενώνεται μη ειδικά με το DNA (SH3 πτυχή) και συμμετέχει κυρίως στην σταθερότητα του DNA. Για να ενεργοποιηθεί η ιντεγκράση είναι απαραίτητη η παρουσία ενός μεταλλικού κατιοντικού παράγοντα, ο οποίος συντονίζεται από δύο υπολείμματα του καταλυτικού τρίπτυχου της ιντεγκράσης (Goldgur et al., 1998, Maignan et al., 1998)). Το γονίδιο Env (Envelope) κωδικοποιεί την πρόδρομο γλυκοπρωτεΐνη gp160, η οποία κατά την διάρκεια της μεταφοράς του ιού στην επιφάνεια του κυττάρου διασπάται από μία κυτταρική πρωτεάση σε δύο γλυκοπρωτεΐνες, την gp120 και την gp41 (Checkley et al., 2011). Η γλυκοπρωτεΐνη gp120 περιέχει προσδιορισμένες περιοχές οι οποίες αλληλεπιδρούν με τους υποδοχείς των CD4 Τ λεμφοκυττάρων και τους συνυποδοχείς CCR5 και CXCR4. Η γλυκοπρωτεΐνη gp41 περιέχει επικρατούσες περιοχές οι ο- ποίες είναι βασικές κατά τη διάρκεια της αναπαραγωγής στο στάδιο της εισόδου του ιού στο κύτταρο (Pancera et al., 2010). Συγκρίνοντας αλληλουχίες των πρωτεϊνών env από απομονωθέντες ιούς HIV-1, βρέθηκε ότι η γλυκοπρωτεΐνη gp120 περιέχει πέντε σταθερές περιοχές (C1-C5) και πέντε περιοχές υψηλής μεταβλητότητας (V1-V5). Οι μεταβλητές περιοχές V1-V5 έχουν σχήμα βρόγχου, συνδέονται μεταξύ τους με δισουλφιδικούς δεσμούς και αυξάνουν τις περιοχές της γλυκόλυσης κατά τη διάρκεια της μόλυνσης του κυττάρου από τον ιό (Azimi et al., 2010, Frost et al., 2005). Η γλυκοπρωτεϊνη gp41 περιέχει τρείς μείζονες περιοχές, οι οποίες είναι βασικές για τη σύντηξη της κυτταρικής μεμβράνης του κυττάρουξενιστή(blacklow et al., 1995). Κατά τη διάρκεια της αλληλοεπίδρασης της γλυκοπρωτεΐνης gp120 με τους υποδοχείς του κυττάρου ξενιστή διαμορφώνονται ορισμένες αλλαγές στις γλυκοπρωτεΐνες gp120 και gp41 με αποτέλεσμα η κεντρική περιοχή της γλυκοπρωτεΐνης gp41 να μετατρέπεται σε μία εξαμερή ελικοειδή δέσμη η οποία καταλήγει να βρίσκεται ταυτόχρονα στη ιίκή και κυτταρική μεμβράνη (Gallo 2003, Chan et al., 1997). Το γονίδιο Rev (Regulator of Virion Protein) κωδικοποιεί την ρυθμιστική πρωτεΐνη Rev (18KD), η οποία είναι απαραίτητη στην διαδικασία α- ναπαραγωγής του ιού HIV-1 (Feinberg et al., 1986). Η πρωτεΐνη Rev βρίσκεται στον πυρήνα του κυττάρου και η βασική της δράση είναι η μεσολάβηση για την έξοδο από τον πυρήνα των αντιγράφων του ιού (Cullen et al., 1988). Επίσης έχει αποδειχθεί ότι η πρωτεΐνη Rev ρυθμίζει την ένωση και 26

27 ΚΕΦΑΛΑΙΟ 1 ο Ο ΙΟΣ ΤΗΣ ΑΝΘΡΩΠΙΝΗΣ ΑΝΟΣΟΑΝΕΠΑΡΚΕΙΑΣ (HIV) τη μετάφραση των αντιγράφων του ιού καθώς επίσης και τη μετέπειτα συσκευασία τους (Bolinger C. και Boris-Lawrie K. 2009). Η έξοδος των αντιγράφων από τον πυρήνα στο κυτταρόπλασμα επιτυγχάνεται μέσω των πόρων της πυρηνικής μεμβράνης, η οποία ρυθμίζεται από δύο μείζονες λειτουργικές περιοχές NLS και NES (Hope 1999). Η δράση της Rev πρωτεΐνης αναστέλλεται από τον παράγοντα 90 (NF 90) του κυτταρικού πυρήνα (Urcuqui-Inchima 2006). Το γονίδιο Vpu (Viral Protein U) κωδικοποιεί μία μικρού μεγέθους πρωτεΐνη, η οποία ταυτόχρονα με τη μετάφραση της εισέρχεται στη μεμβράνη του μολυσμένου κυττάρου (Strebel et al., 1989). Η πρωτεΐνη Vpu συμβάλει στην αύξηση της απελευθέρωσης των ώριμων σωματιδίων του ιού (virions) από τα μολυσμένα κύτταρα και προκαλεί την αποδόμηση του μορίου του υποδοχέα CD4 του HIV-1 (Hsu 2004 και Latres et al., 1999). Για την απελευθέρωση των ώριμων σωματιδίων του ιού, η πρωτεΐνη Vpu ε- ξουδετερώνει έναν κυτταρικό παράγοντα, τον παράγοντα TASK-1, ο οποίος όταν εκφράζεται απουσία της πρωτεΐνης Vpu αναστέλλει την απελευθέρωση του ιού (Varthakavi et al., 2003, Hsu et al., 2004). Το γονίδιο Vif (Virion Infectivity Factor) κωδικοποιεί μία βοηθητική πρωτεΐνη 23KDa, η οποία κατά το στάδιο της αναπαραγωγής του HIV-1 έ- χει τη δυνατότητα να περιορίζει την αντιϊκή ανταπόκριση του ξενιστή (Malim MH et al., 2008). Ο παράγων Vif αδρανοποιεί τη δράση των APOBEC3 πρωτεϊνών A3G και A3F του ξενιστή και σε έλλειψη του παράγοντα Vif οι APOBEC3 πρωτεΐνες είναι εν δυνάμει αναστολείς του HIV-1 (Chiu et al., 2008, Niewiadomska και Yu 2009). Επίσης οι APOBEC3 πρωτεΐνες που έχουν ήδη συσκευαστεί στο ώριμο σωματίδιο του ιού, δύνανται να ελαττώσουν την συσσώρευση του ιϊκού DNA και τον σχηματισμό του προιϊκού DNA (Burnett και Spearman 2007). Το γονίδιο Nef (Negative Regulator Factor) κωδικοποιεί μία πρωτεΐνη 25 έως 34 KDa, της οποίας η δράση είναι πολλαπλή και θεωρείται ως βασικός παράγοντας της λοιμογόνου δύναμης του HIV-1 (Arold et al., 2001, Geyer et al., 2002). Η πρωτεΐνη Nef αποδιοργανώνει τις πρωτεΐνες του κυττάρου-ξενιστή, οι οποίες λαμβάνουν μέρος στην αντιμετώπιση αποφυγής της μόλυνσης, με αποτέλεσμα την κατάρρευση της ανοσολογικής α- νταπόκρισης. Λόγω της ανοσολογικής κατάρρευσης, η μετάδοση του ιού σε άλλα κύτταρα είναι αυξημένη, γεγονός που οδηγεί στην προοδευτική 27

28 ΖΩΗ-ΑΝΝΑ ΑΝΤΩΝΙΑΔΟΥ ΔΙΔΑΚΤΟΡΙΚΗ ΔΙΑΤΡΙΒΗ εξέλιξη της νόσου (Kestler et al., 1991, Birch M et al., 2001). Για την κατάρρευση της ανοσολογικής ανταπόκρισης, η πρωτεΐνη Vef συμβάλλει στην καταστροφή των κυτταροτοξικών Τ λεμφοκυττάρων (Collins K et al., 1998), στην ελάττωση του αριθμού των CD4 Τ λεμφοκυττάρων (Carcia et al., 1991) και στην ελάττωση των CD8, CD28, CD80, CD86 και CD1d Τ λεμφοκυττάρων (Chaudhry et al., 2005, Chen et al., 2006). Εκτός των παραπάνω, η πρωτεΐνη Nef απορυθμίζει το Μείζον Σύμπλεγμα Ιστοσυμβατότητας 1 (MHC-1), δρώντας μετά την ένωση της με τις πρωτεΐνες PACS-1 και PACS-2 ανασταλτικά στη μεταφορά του MHC-1 στην επιφάνεια των μονοπύρηνων κυττάρων του αίματος (Dikeakoa et all 2012). Το γονίδιο Vpr (Viral Protein R) κωδικοποιεί την ιϊκή πρωτεΐνη R, η οποία είναι μία μικρού μεγέθους πρωτεΐνη, περίπου 14 KDa, αποτελούμενη από 96 αμινοξέα (Morellet et al., 2003). Το γονίδιο Vpr βρίσκεται στον πυρήνα του κυττάρου και εκφράζεται στα τελικά στάδια της αναπαραγωγής του ιού ενώ παράλληλα υπάρχει στα αρχικά στάδια της μόλυνσης του κυττάρου-στόχου από τον ιό. Η ενσωμάτωση του Vpr στο ιϊκό σωματίδιο προυποθέτει την παρουσία ενός καθοριστικού παράγοντα μέσα στην επικρατούσα περιοχή P6 της προδρόμου πολυπρωτεινης Pr55gag του ιού (Bachand et al., 1999). Η πρωτεΐνη Vpr συμμετέχει στην διαδικασία της αναστροφης μεταγραφής, στην εισαγωγή του DNA του ιού (ως σύμπλεγμα πριν την ενσωμάτωση του) στον πυρήνα του κυττάρου, στην ενεργοποίηση των ΜΑΕ (LTR), σε διάφορες λειτουργίες του κυτταρικού κύκλου και στην ρύθμιση της απόπτωσης (Manhalingam et al., 1997, Sherman et al., 2002, Zhang et al., 1998). Το γονίδιο tat (Τrans-Activator of Transcription), κωδικοποιεί την πρωτεΐνη Tat, η οποία είναι μία βασική πρωτεΐνη για την αναπαραγωγή του HIV-1. Η πρωτεΐνη Tat αλληλοεπιδρά με τις TAR (transactivator response element) και U3 περιοχές που βρίσκονται στο 5 άκρο των Μακρών Ακραίων Επαναλήψεων όλων των mrna του HIV-1, προκαλώντας την μεταγραφή σε πολλά στάδια της αναπαραγωγής του ιού, με αποτέλεσμα να αποτελεί ένα βασικό ρυθμιστή της σύνθεσης των πρωτεϊνών (Bannwarth και Gatignol 2005). Για να αρχίσει η μεταγραφή του RNA, η πρωτεϊνη Tat ενώνεται με την περιοχή TAR διεγείροντας τον υποκινητή των Μακρών Ακραίων Επαναλήψεων (LTR) (Atze et al., 2011). 28

ΜΕΛΕΤΗ ΓΕΝΕΤΙΚΩΝ ΠΟΛΥΜΟΡΦΙΣΜΩΝ ΚΑΙ ΤΡΟΠΙΣΜΟΥ HIV-1 ΣΤΕΛΕΧΩΝ ΟΡΟΘΕΤΙΚΩΝ

ΜΕΛΕΤΗ ΓΕΝΕΤΙΚΩΝ ΠΟΛΥΜΟΡΦΙΣΜΩΝ ΚΑΙ ΤΡΟΠΙΣΜΟΥ HIV-1 ΣΤΕΛΕΧΩΝ ΟΡΟΘΕΤΙΚΩΝ ΑΡΙΣΤΟΤΕΛΕΙΟ ΠΑΝΕΠΙΣΤΗΜΙΟ ΘΕΣΣΑΛΟΝΙΚΗΣ ΣΧΟΛΗ ΕΠΙΣΤΗΜΩΝ ΥΓΕΙΑΣ ΤΜΗΜΑ ΙΑΤΡΙΚΗΣ ΤΟΜΕΑΣ ΒΙΟΛΟΓΙΚΩΝ ΕΠΙΣΤΗΜΩΝ ΚΑΙ ΠΡΟΛΗΠΤΙΚΗΣ ΙΑΤΡΙΚΗΣ Α ΕΡΓΑΣΤΗΡΙΟ ΜΙΚΡΟΒΙΟΛΟΓΙΑΣ Διευθυντής: Καθηγητής Νικόλαος Μαλισιόβας Πανεπ.

Διαβάστε περισσότερα

ΒΙΟΛΟΓΙΑ ΓΕΝΙΚΗΣ ΠΑΙΔΕΙΑΣ ΚΕΦΑΛΑΙΟ 1(ΥΓΕΙΑ-ΑΝΘΡΩΠΟΣ)

ΒΙΟΛΟΓΙΑ ΓΕΝΙΚΗΣ ΠΑΙΔΕΙΑΣ ΚΕΦΑΛΑΙΟ 1(ΥΓΕΙΑ-ΑΝΘΡΩΠΟΣ) ΟΝΟΜΑΤΕΠΩΝΥΜΟ: ΤΜΗΜΑ: ΒΙΟΛΟΓΙΑ ΓΕΝΙΚΗΣ ΠΑΙΔΕΙΑΣ ΚΕΦΑΛΑΙΟ 1(ΥΓΕΙΑ-ΑΝΘΡΩΠΟΣ) Να βάλετε σε κύκλο το γράμμα που αντιστοιχεί στη σωστή απάντηση ή στη φράση που συμπληρώνει σωστά την πρόταση: 1. Οι ιοί αποτελούνται

Διαβάστε περισσότερα

Γενική Μικροβιολογία. Ενότητα 12 η ΕΙΣΑΓΩΓΗ ΣΤΗΝ ΙΟΛΟΓΙΑ

Γενική Μικροβιολογία. Ενότητα 12 η ΕΙΣΑΓΩΓΗ ΣΤΗΝ ΙΟΛΟΓΙΑ Γενική Μικροβιολογία Ενότητα 12 η ΕΙΣΑΓΩΓΗ ΣΤΗΝ ΙΟΛΟΓΙΑ Όνομα καθηγητή: Δ. ΓΕΩΡΓΑΚΟΠΟΥΛΟΣ Όνομα καθηγητή: Γ. ΖΕΡΒΑΚΗΣ Όνομα καθηγητή: ΑΝ. ΤΑΜΠΑΚΑΚΗ Τμήμα: ΕΠΙΣΤΗΜΗΣ ΦΥΤΙΚΗΣ ΠΑΡΑΓΩΓΗΣ ΣΤΟΧΟΙ ΤΟΥ ΜΑΘΗΜΑΤΟΣ

Διαβάστε περισσότερα

Νικόλαος Σιαφάκας Λέκτορας Διαγνωστικής Ιολογίας Εργαστήριο Κλινικής Μικροβιολογίας ΠΓΝ «ΑΤΤΙΚΟΝ»

Νικόλαος Σιαφάκας Λέκτορας Διαγνωστικής Ιολογίας Εργαστήριο Κλινικής Μικροβιολογίας ΠΓΝ «ΑΤΤΙΚΟΝ» Νικόλαος Σιαφάκας Λέκτορας Διαγνωστικής Ιολογίας Εργαστήριο Κλινικής Μικροβιολογίας ΠΓΝ «ΑΤΤΙΚΟΝ» DNA RNA: ΑΝΤΙΓΡΑΦΗ, ΜΕΤΑΓΡΑΦΗ, ΜΕΤΑΦΡΑΣΗ DNA RNA: Βασικά Χαρακτηριστικά Ρόλος Κεντικό Δόγμα της Βιολογίας:

Διαβάστε περισσότερα

ΑΝΟΣΟΠΟΙΗΤΙΚΟ ΣΥΣΤΗΜΑ ΜΟΝΟΚΛΩΝΙΚΑ ΑΝΤΙΣΩΜΑΤΑ ΕΜΒΟΛΙΑ. Εργαστήριο Γενετικής, ΓΠΑ

ΑΝΟΣΟΠΟΙΗΤΙΚΟ ΣΥΣΤΗΜΑ ΜΟΝΟΚΛΩΝΙΚΑ ΑΝΤΙΣΩΜΑΤΑ ΕΜΒΟΛΙΑ. Εργαστήριο Γενετικής, ΓΠΑ ΑΝΟΣΟΠΟΙΗΤΙΚΟ ΣΥΣΤΗΜΑ ΜΟΝΟΚΛΩΝΙΚΑ ΑΝΤΙΣΩΜΑΤΑ ΕΜΒΟΛΙΑ Στάδια μικροβιακής λοίμωξης δημιουργία αποικίας σε εξωτερική επιφάνεια διείσδυση στον οργανισμό τοπική μόλυνση συστηματική (γενικευμένη) μόλυνση H σημασία

Διαβάστε περισσότερα

ΘΕΜΑ Α Α1. γ Α2. γ Α3. α Α4. β Α5. β ΘΕΜΑ B B1. B2.

ΘΕΜΑ Α Α1. γ Α2. γ Α3. α Α4. β Α5. β ΘΕΜΑ B B1. B2. ΘΕΜΑ Α Α1. γ (το πριμόσωμα) Α2. γ (οι υποκινητές και οι μεταγραφικοί παράγοντες κάθε γονιδίου) Α3. α (μεταφέρει ένα συγκεκριμένο αμινοξύ στο ριβόσωμα) Α4. β (αποδιάταξη των δύο συμπληρωματικών αλυσίδων)

Διαβάστε περισσότερα

ΑΠΑΝΤΗΣΕΙΣ ΣΤΟ 1 ο ΔΙΑΓΩΝΙΣΜΑ ΒΙΟΛΟΓΙΑΣ ΓΕΝΙΚΗΣ ΠΑΙΔΕΙΑΣ

ΑΠΑΝΤΗΣΕΙΣ ΣΤΟ 1 ο ΔΙΑΓΩΝΙΣΜΑ ΒΙΟΛΟΓΙΑΣ ΓΕΝΙΚΗΣ ΠΑΙΔΕΙΑΣ ΑΠΑΝΤΗΣΕΙΣ ΣΤΟ 1 ο ΔΙΑΓΩΝΙΣΜΑ ΒΙΟΛΟΓΙΑΣ ΓΕΝΙΚΗΣ ΠΑΙΔΕΙΑΣ ΘΕΜΑ 1 ο Α. Ερωτήσεις πολλαπλής επιλογής 1. γ 2. α 3. β 4. δ 5. δ Β. Ερωτήσεις σωστού - λάθους 1. Σωστό 2. Λάθος 3. Λάθος 4. Λάθος 5. Σωστό ΘΕΜΑ

Διαβάστε περισσότερα

Εργαστηριακή Διάγνωση της HIV λοίμωξης. Δρ. Μαρία Κοτσιανοπούλου Βιολόγος Υπεύθυνη Εργαστηριού Κέντρου Αναφοράς AIDS, ΕΣΔΥ

Εργαστηριακή Διάγνωση της HIV λοίμωξης. Δρ. Μαρία Κοτσιανοπούλου Βιολόγος Υπεύθυνη Εργαστηριού Κέντρου Αναφοράς AIDS, ΕΣΔΥ Εργαστηριακή Διάγνωση της HIV λοίμωξης Δρ. Μαρία Κοτσιανοπούλου Βιολόγος Υπεύθυνη Εργαστηριού Κέντρου Αναφοράς AIDS, ΕΣΔΥ Διάγνωση της HIV λοίμωξης Από το 1985 και μέχρι σήμερα η διαγνωστική διαδικασία

Διαβάστε περισσότερα

HIV λοίμωξη στα παιδιά: από τη θεραπεία... στην πρόληψη. Βάνα Παπαευαγγέλου ΑΤΤΙΚΟΝ 30/09/2014

HIV λοίμωξη στα παιδιά: από τη θεραπεία... στην πρόληψη. Βάνα Παπαευαγγέλου ΑΤΤΙΚΟΝ 30/09/2014 HIV λοίμωξη στα παιδιά: από τη θεραπεία... στην πρόληψη Βάνα Παπαευαγγέλου ΑΤΤΙΚΟΝ 30/09/2014 Περιεχόµενα Επιδηµιολογία HIV λοίµωξης (2014) ΟιόςHIV ιάγνωση κλινική εικόνα Θεραπεία Κάθετη µετάδοση: απο

Διαβάστε περισσότερα

ΝΟΣΗΛΕΙΑ ΑΣΘΕΝΟΥΣ ΜΕ HIV ΛΟΙΜΩΞΗ: ΓΝΩΣΗ, ΠΡΟΣΤΑΣΙΑ ΚΑΙ ΕΝΗΜΕΡΩΣΗ ΕΝΑΝΤΙΑ ΣΤΟΝ ΤΡΟΜΟ ΚΑΙ ΤΟΝ ΚΟΙΝΩΝΙΚΟ ΑΠΟΚΛΕΙΣΜΟ

ΝΟΣΗΛΕΙΑ ΑΣΘΕΝΟΥΣ ΜΕ HIV ΛΟΙΜΩΞΗ: ΓΝΩΣΗ, ΠΡΟΣΤΑΣΙΑ ΚΑΙ ΕΝΗΜΕΡΩΣΗ ΕΝΑΝΤΙΑ ΣΤΟΝ ΤΡΟΜΟ ΚΑΙ ΤΟΝ ΚΟΙΝΩΝΙΚΟ ΑΠΟΚΛΕΙΣΜΟ ΝΟΣΗΛΕΙΑ ΑΣΘΕΝΟΥΣ ΜΕ HIV ΛΟΙΜΩΞΗ: ΓΝΩΣΗ, ΠΡΟΣΤΑΣΙΑ ΚΑΙ ΕΝΗΜΕΡΩΣΗ ΕΝΑΝΤΙΑ ΣΤΟΝ ΤΡΟΜΟ ΚΑΙ ΤΟΝ ΚΟΙΝΩΝΙΚΟ ΑΠΟΚΛΕΙΣΜΟ ΤΥΜΠΑ ΕΥΔΟΚΙΑ ΜΑΝΔΕΛΗ ΕΛΕΝΗ ΕΙΣΗΓΗΤΡΙΑ: Α. ΠΑΠΟΥΤΣΗ ΟΡΙΣΜΟΙ Ορισμός AIDS: Acquired Immune

Διαβάστε περισσότερα

Ανοσιακή απάντηση (immune response)

Ανοσιακή απάντηση (immune response) Ανοσιακή απάντηση (immune response) Το σύνολο των μηχανισμών που καθιστούν τον οργανισμό ικανό να αναγνωρίζει,να εξουδετερώνει και να απομακρύνει κάθε ξένη ουσία προς αυτόν χαρακτηρίζεται ως ανοσία. Αποτέλεσμα

Διαβάστε περισσότερα

ΠΑΝΕΛΛΑΔΙΚΕΣ ΕΞΕΤΑΣΕΙΣ Γ ΤΑΞΗΣ ΗΜΕΡΗΣΙΟΥ ΓΕΝΙΚΟΥ ΛΥΚΕΙΟΥ ΚΑΙ ΕΠΑΛ (ΟΜΑΔΑ Β) ΤΕΤΑΡΤΗ 4 ΙΟΥΝΙΟΥ 2014 ΕΞΕΤΑΖΟΜΕΝΟ ΜΑΘΗΜΑ: ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ

ΠΑΝΕΛΛΑΔΙΚΕΣ ΕΞΕΤΑΣΕΙΣ Γ ΤΑΞΗΣ ΗΜΕΡΗΣΙΟΥ ΓΕΝΙΚΟΥ ΛΥΚΕΙΟΥ ΚΑΙ ΕΠΑΛ (ΟΜΑΔΑ Β) ΤΕΤΑΡΤΗ 4 ΙΟΥΝΙΟΥ 2014 ΕΞΕΤΑΖΟΜΕΝΟ ΜΑΘΗΜΑ: ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ 1 ΠΑΝΕΛΛΑΔΙΚΕΣ ΕΞΕΤΑΣΕΙΣ Γ ΤΑΞΗΣ ΗΜΕΡΗΣΙΟΥ ΓΕΝΙΚΟΥ ΛΥΚΕΙΟΥ ΚΑΙ ΕΠΑΛ (ΟΜΑΔΑ Β) ΤΕΤΑΡΤΗ 4 ΙΟΥΝΙΟΥ 2014 ΕΞΕΤΑΖΟΜΕΝΟ ΜΑΘΗΜΑ: ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ ΑΠΑΝΤΗΣΕΙΣ ΘΕΜΑ Α Α1. δ Α2. γ Α3. β Α4. γ Α5. β ΘΕΜΑ

Διαβάστε περισσότερα

Αφιερωμένο σ όλους τους μαθητές της Γ! Λυκείου! 11/4/2009 2

Αφιερωμένο σ όλους τους μαθητές της Γ! Λυκείου! 11/4/2009 2 11/4/2009 1 Αφιερωμένο σ όλους τους μαθητές της Γ! Λυκείου! 11/4/2009 2 ΑΝΘΡΩΠΟΣ & ΥΓΕΙΑ 11/4/2009 3 ΙΣΟΡΡΟΠΙΑ 11/4/2009 4 Η ικανότητα του οργανισμού να διατηρεί σταθερές τις συνθήκες του εσωτερικού του

Διαβάστε περισσότερα

Ποιες είναι οι ομοιότητες και οι διαφορές μεταξύ της αντιγραφής και της

Ποιες είναι οι ομοιότητες και οι διαφορές μεταξύ της αντιγραφής και της ΚΕΦ. 2 ο ΕΡΩΤΗΣΕΙΣ ΚΡΙΣΕΩΣ Ποιες είναι οι ομοιότητες και οι διαφορές μεταξύ της αντιγραφής και της μεταγραφής; Διαφορές Αντιγραφή Μεταγραφή 1. Διατηρείται και μεταβιβάζεται η 1. Μεταβιβάζεται η γενετική

Διαβάστε περισσότερα

ΒΙΟΛΟΓΙΑ ΓΕΝΙΚΗΣ ΠΑΙΔΕΙΑΣ Γ ΛΥΚΕΙΟΥ

ΒΙΟΛΟΓΙΑ ΓΕΝΙΚΗΣ ΠΑΙΔΕΙΑΣ Γ ΛΥΚΕΙΟΥ ΒΙΟΛΟΓΙΑ ΓΕΝΙΚΗΣ ΠΑΙΔΕΙΑΣ Γ ΛΥΚΕΙΟΥ ΘΕΜΑ 1ο Να γράψετε στο τετράδιό σας τον αριθμό καθεμιάς από τις παρακάτω ημιτελείς προτάσεις 1 έως 5 και δίπλα το γράμμα που αντιστοιχεί στη λέξη ή στη φράση, η οποία

Διαβάστε περισσότερα

Μικροοργανισμοί. Οι μικροοργανισμοί διακρίνονται σε: Μύκητες Πρωτόζωα Βακτήρια Ιούς

Μικροοργανισμοί. Οι μικροοργανισμοί διακρίνονται σε: Μύκητες Πρωτόζωα Βακτήρια Ιούς Μικροοργανισμοί Οι μικροοργανισμοί διακρίνονται σε: Μύκητες Πρωτόζωα Βακτήρια Ιούς Παθογόνοι μικροοργανισμοί Παθογόνοι μικροοργανισμοί ονομάζονται οι μικροοργανισμοί που χρησιμοποιούν τον άνθρωπο ως ξενιστή

Διαβάστε περισσότερα

ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ

ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ 8 Ο ΚΕΦΑΛΑΙΟ ΕΦΑΡΜΟΓΕΣ ΤΗΣ ΒΙΟΤΕΧΝΟΛΟΓΙΑΣ ΣΤΗΝ ΙΑΤΡΙΚΗ 5ο ΓΕΝΙΚΟ ΛΥΚΕΙΟ ΙΛΙΟΥ 1 8. Εφαρμογές της Βιοτεχνολογίας στην Ιατρική Φαρμακευτικές πρωτεΐνες Τι είναι οι φαρμακευτικές

Διαβάστε περισσότερα

Β. ΚΑΜΙΝΕΛΛΗΣ ΒΙΟΛΟΓΙΑ. Είναι η επιστήμη που μελετά τους ζωντανούς οργανισμούς. (Αποτελούνται από ένα ή περισσότερα κύτταρα).

Β. ΚΑΜΙΝΕΛΛΗΣ ΒΙΟΛΟΓΙΑ. Είναι η επιστήμη που μελετά τους ζωντανούς οργανισμούς. (Αποτελούνται από ένα ή περισσότερα κύτταρα). ΒΙΟΛΟΓΙΑ Είναι η επιστήμη που μελετά τους ζωντανούς οργανισμούς. (Αποτελούνται από ένα ή περισσότερα κύτταρα). Είδη οργανισμών Υπάρχουν δύο είδη οργανισμών: 1. Οι μονοκύτταροι, που ονομάζονται μικροοργανισμοί

Διαβάστε περισσότερα

Β. Ζουμηουρλής,' Χ. Τσατσάνης'

Β. Ζουμηουρλής,' Χ. Τσατσάνης' ΤΙ ΝΕΩΤΕΡΟ ΣΤΟ AIDS 89 ΙΟΛΟΓΙΑ ΝΕΕΣ ΕΞΕΛΙΞΕΙΣ ΣΤΗΝ ΕΡΕΥΝΑ ΓΙΑ TO AIDS Δ.Α. Στταντίδος,' 1 Β. Ζουμηουρλής,' Χ. Τσατσάνης' Μέχρι πρόσφατα, η απλότητα και η μορφολογική σταθερότητα φαινόταν να είναι ένα από

Διαβάστε περισσότερα

ΕΡΩΤΗΣΕΙΣ ΣΩΣΤΟΥ - ΛΑΘΟΥΣ. ΠΟΛΛΑΠΛΗΣ ΕΠΙΛΟΓΗΣ

ΕΡΩΤΗΣΕΙΣ ΣΩΣΤΟΥ - ΛΑΘΟΥΣ. ΠΟΛΛΑΠΛΗΣ ΕΠΙΛΟΓΗΣ ΕΡΩΤΗΣΕΙΣ ΣΩΣΤΟΥ - ΛΑΘΟΥΣ. ΠΟΛΛΑΠΛΗΣ ΕΠΙΛΟΓΗΣ 1. Η πήξη του αίματος συμβάλλει στην άμυνα του οργανισμού 2. Η φαγοκυττάρωση είναι αποτελεσματική μόνο έναντι των βακτηρίων 3. Οι ιντερφερόνες δρουν άμεσα

Διαβάστε περισσότερα

ΑΡΧΕΣ ΑΝΟΣΟΛΟΓΙΑΣ ΕΙΣΑΓΩΓΗ ΣΤΟ ΑΝΟΣΟΠΟΙΗΤΙΚΟ ΣΥΣΤΗΜΑ

ΑΡΧΕΣ ΑΝΟΣΟΛΟΓΙΑΣ ΕΙΣΑΓΩΓΗ ΣΤΟ ΑΝΟΣΟΠΟΙΗΤΙΚΟ ΣΥΣΤΗΜΑ ΑΡΧΕΣ ΑΝΟΣΟΛΟΓΙΑΣ ΕΙΣΑΓΩΓΗ ΣΤΟ ΑΝΟΣΟΠΟΙΗΤΙΚΟ ΣΥΣΤΗΜΑ Χρειάζεται η µελέτη της ανοσολογία; Εµβόλια Άµυνα κατά µικροοργανισµών Ανοσολογικές ασθένειες Αλλεργίες - υπερευαισθησίες, αυτοανοσίες, ανοσοανεπάρκειες,

Διαβάστε περισσότερα

Μεταβολικές ανάγκες ανοσοκυττάρων

Μεταβολικές ανάγκες ανοσοκυττάρων Μεταβολικές ανάγκες ανοσοκυττάρων Στέργιος Κατσιουγιάννης PhD Μεταδιδακτορικός συνεργάτης Χαροκόπειο Πανεπιστήµιο Τµήµα Επιστήµης ιαιτολογίας και ιατροφής Μεταβολισµός και Ανοσολογία Ιστορικά το καλύτερο

Διαβάστε περισσότερα

ΕΠΑΝΑΛΗΠΤΙΚΕΣ ΑΠΟΛΥΤΗΡΙΕΣ ΕΞΕΤΑΣΕΙΣ Γ ΤΑΞΗΣ ΗΜΕΡΗΣΙΟΥ ΕΝΙΑΙΟΥ ΛΥΚΕΙΟΥ ΠΕΜΠΤΗ 1 ΙΟΥΛΙΟΥ 2004 ΕΞΕΤΑΖΟΜΕΝΟ ΜΑΘΗΜΑ: ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ

ΕΠΑΝΑΛΗΠΤΙΚΕΣ ΑΠΟΛΥΤΗΡΙΕΣ ΕΞΕΤΑΣΕΙΣ Γ ΤΑΞΗΣ ΗΜΕΡΗΣΙΟΥ ΕΝΙΑΙΟΥ ΛΥΚΕΙΟΥ ΠΕΜΠΤΗ 1 ΙΟΥΛΙΟΥ 2004 ΕΞΕΤΑΖΟΜΕΝΟ ΜΑΘΗΜΑ: ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ 1 ΕΠΑΝΑΛΗΠΤΙΚΕΣ ΑΠΟΛΥΤΗΡΙΕΣ ΕΞΕΤΑΣΕΙΣ Γ ΤΑΞΗΣ ΗΜΕΡΗΣΙΟΥ ΕΝΙΑΙΟΥ ΛΥΚΕΙΟΥ ΠΕΜΠΤΗ 1 ΙΟΥΛΙΟΥ 2004 ΕΞΕΤΑΖΟΜΕΝΟ ΜΑΘΗΜΑ: ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ ΑΠΑΝΤΗΣΕΙΣ ΘΕΜΑ 1ο 1. β 2. γ 3. α 4. γ 5. δ ΘΕΜΑ 2ο 1. Σχολικό

Διαβάστε περισσότερα

Σεξουαλικώς Μεταδιδόμενα Νοσήματα. Εργασία: Γιάννης Π.

Σεξουαλικώς Μεταδιδόμενα Νοσήματα. Εργασία: Γιάννης Π. Σεξουαλικώς Μεταδιδόμενα Νοσήματα Εργασία: Γιάννης Π. Εισαγωγή Σεξουαλικώς μεταδιδόμενα νοσήματα ή σεξουαλικώς μεταδιδόμενες ασθένειες ή αφροδίσια νοσήματα ονομάζονται ασθένειες ή μολύνσεις, οι οποίες

Διαβάστε περισσότερα

ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ

ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ ΘΕΜΑ 1ο Να γράψετε στο τετράδιό σας τον αριθμό καθεμιάς από τις παρακάτω ημιτελείς προτάσεις 1 έως 5 και δίπλα το γράμμα που αντιστοιχεί στη λέξη ή τη φράση, η οποία

Διαβάστε περισσότερα

ΕΞΕΛΙΞΗ ΣΕΙΡΑ ΜΕΤΑΒΟΛΩΝ ΠΡΟΣ ΟΛΕΣ ΤΙΣ ΣΥΝΙΣΤΩΣΕΣ ΠΟΥ ΠΑΙΡΝΟΥΝ ΜΕΡΟΣ ΣΕ ΕΝΑΝ ΠΛΗΘΥΣΜΟ ΜΕ ΤΗΝ ΠΑΡΟΔΟ ΤΟΥ ΧΡΟΝΟΥ

ΕΞΕΛΙΞΗ ΣΕΙΡΑ ΜΕΤΑΒΟΛΩΝ ΠΡΟΣ ΟΛΕΣ ΤΙΣ ΣΥΝΙΣΤΩΣΕΣ ΠΟΥ ΠΑΙΡΝΟΥΝ ΜΕΡΟΣ ΣΕ ΕΝΑΝ ΠΛΗΘΥΣΜΟ ΜΕ ΤΗΝ ΠΑΡΟΔΟ ΤΟΥ ΧΡΟΝΟΥ ΕΞΕΛΙΞΗ ΣΕΙΡΑ ΜΕΤΑΒΟΛΩΝ ΠΡΟΣ ΟΛΕΣ ΤΙΣ ΣΥΝΙΣΤΩΣΕΣ ΠΟΥ ΠΑΙΡΝΟΥΝ ΜΕΡΟΣ ΣΕ ΕΝΑΝ ΠΛΗΘΥΣΜΟ ΜΕ ΤΗΝ ΠΑΡΟΔΟ ΤΟΥ ΧΡΟΝΟΥ ΖΩΟΛΟΓΙΑ Δ. ΜΑΤΘΟΠΟΥΛΟΣ 1 ΠΑΡΑΓΟΝΤΕΣ ΠΟΥ ΕΠΗΡΕΑΖΟΥΝ ΤΗΝ ΕΞΕΛΙΞΗ ΚΛΗΡΟΝΟΜΙΚΟΤΗΤΑ ΔΙΑΔΙΚΑΣΙΑ

Διαβάστε περισσότερα

Πανελλήνιες Εξετάσεις Ημερήσιων Γενικών Λυκείων. Εξεταζόμενο Μάθημα: Βιολογία Θετικής Κατεύθυνσης, Ημ/νία: 04 Ιουνίου 2014. Απαντήσεις Θεμάτων

Πανελλήνιες Εξετάσεις Ημερήσιων Γενικών Λυκείων. Εξεταζόμενο Μάθημα: Βιολογία Θετικής Κατεύθυνσης, Ημ/νία: 04 Ιουνίου 2014. Απαντήσεις Θεμάτων Πανελλήνιες Εξετάσεις Ημερήσιων Γενικών Λυκείων Εξεταζόμενο Μάθημα: Βιολογία Θετικής Κατεύθυνσης, Ημ/νία: 04 Ιουνίου 2014 Απαντήσεις Θεμάτων ΘΕΜΑ Α A1. Τα πλασμίδια είναι: δ. κυκλικά δίκλωνα μόρια DNA

Διαβάστε περισσότερα

ΑΠΑΝΤΗΣΕΙΣ ΣΤΟ ΔΙΑΓΩΝΙΣΜΑ ΒΙΟΛΟΓΙΑΣ ΓΕΝΙΚΗΣ ΠΑΙΔΕΙΑΣ Γ ΛΥΚΕΙΟΥ

ΑΠΑΝΤΗΣΕΙΣ ΣΤΟ ΔΙΑΓΩΝΙΣΜΑ ΒΙΟΛΟΓΙΑΣ ΓΕΝΙΚΗΣ ΠΑΙΔΕΙΑΣ Γ ΛΥΚΕΙΟΥ 23 10 2011 ΘΕΡΙΝΑ ΑΠΑΝΤΗΣΕΙΣ ΣΤΟ ΔΙΑΓΩΝΙΣΜΑ ΒΙΟΛΟΓΙΑΣ ΓΕΝΙΚΗΣ ΠΑΙΔΕΙΑΣ Γ ΛΥΚΕΙΟΥ ΘΕΜΑ 1 Ο Α. Να επιλέξετε τη φράση που συμπληρώνει ορθά κάθε μία από τις ακόλουθες προτάσεις: 1. Όλα τα βακτήρια: Α. διαθέτουν

Διαβάστε περισσότερα

Επίκτητη Ανοσιακή Απάντηση (χυμικό σκέλος) Β λεμφοκύτταρα

Επίκτητη Ανοσιακή Απάντηση (χυμικό σκέλος) Β λεμφοκύτταρα Επίκτητη Ανοσιακή Απάντηση (χυμικό σκέλος) Β λεμφοκύτταρα φυσική ή μη ειδική ανοσία δεν απαιτεί προηγούμενη έκθεση στο παθογόνο και δεν διαθέτει μνήμη. σε επίκτητη ή ειδική ανοσία χυμική ανοσία με παραγωγή

Διαβάστε περισσότερα

ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ ΟΝΟΜΑΤΕΠΩΝΥΜΟ: ΤΜΗΜΑ: ΘΕΜΑ 1 Ο. 3. Το DNA των μιτοχονδρίων έχει μεγαλύτερο μήκος από αυτό των χλωροπλαστών.

ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ ΟΝΟΜΑΤΕΠΩΝΥΜΟ: ΤΜΗΜΑ: ΘΕΜΑ 1 Ο. 3. Το DNA των μιτοχονδρίων έχει μεγαλύτερο μήκος από αυτό των χλωροπλαστών. ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ ΟΝΟΜΑΤΕΠΩΝΥΜΟ: ΤΜΗΜΑ: ΘΕΜΑ 1 Ο Α. Να γράψετε τον αριθμό της καθεμιάς από τις παρακάτω προτάσεις 1-5 και δίπλα του τη λέξη Σωστό, αν η πρόταση είναι σωστή, ή Λάθος, αν η πρόταση

Διαβάστε περισσότερα

ΒΙΟΛΟΓΙΑ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ 16-2-2014 ΘΕΜΑ 1 ο Α. Να βάλετε σε κύκλο το γράμμα που αντιστοιχεί στη σωστή απάντηση. (Μονάδες 25)

ΒΙΟΛΟΓΙΑ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ 16-2-2014 ΘΕΜΑ 1 ο Α. Να βάλετε σε κύκλο το γράμμα που αντιστοιχεί στη σωστή απάντηση. (Μονάδες 25) ΤΣΙΜΙΣΚΗ &ΚΑΡΟΛΟΥ ΝΤΗΛ ΓΩΝΙΑ THΛ: 270727 222594 ΑΡΤΑΚΗΣ 12 - Κ. ΤΟΥΜΠΑ THΛ: 919113 949422 ΕΠΩΝΥΜΟ:... ΟΝΟΜΑ:... ΤΜΗΜΑ:... ΗΜΕΡΟΜΗΝΙΑ:... ΒΙΟΛΟΓΙΑ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ 16-2-2014 ΘΕΜΑ 1 ο Α. Να βάλετε σε

Διαβάστε περισσότερα

HIV & Ca τραχήλου μήτρας. Άτομα μολυσμένα με HIV έχουν αυξημένη ροπή για την ανάπτυξη καρκίνου.

HIV & Ca τραχήλου μήτρας. Άτομα μολυσμένα με HIV έχουν αυξημένη ροπή για την ανάπτυξη καρκίνου. HIV & Ca τραχήλου μήτρας Άτομα μολυσμένα με HIV έχουν αυξημένη ροπή για την ανάπτυξη καρκίνου. ΠΑΘΟΓΕΝΕΙΑ Πολλαπλοί παράγοντες μπορούν να συμβάλουν στην ανάπτυξη της κακοήθειας σε ασθενείς με AIDS. Οι

Διαβάστε περισσότερα

Γενική Μικροβιολογία. Ενότητα 11 η ΕΙΣΑΓΩΓΗ ΣΤΗΝ ΙΟΛΟΓΙΑ

Γενική Μικροβιολογία. Ενότητα 11 η ΕΙΣΑΓΩΓΗ ΣΤΗΝ ΙΟΛΟΓΙΑ Γενική Μικροβιολογία Ενότητα 11 η ΕΙΣΑΓΩΓΗ ΣΤΗΝ ΙΟΛΟΓΙΑ Όνομα καθηγητή: Δ. ΓΕΩΡΓΑΚΟΠΟΥΛΟΣ Όνομα καθηγητή: Γ. ΖΕΡΒΑΚΗΣ Όνομα καθηγητή: ΑΝ. ΤΑΜΠΑΚΑΚΗ Τμήμα: ΕΠΙΣΤΗΜΗΣ ΦΥΤΙΚΗΣ ΠΑΡΑΓΩΓΗΣ ΣΤΟΧΟΙ ΤΟΥ ΜΑΘΗΜΑΤΟΣ

Διαβάστε περισσότερα

ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ

ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ ΘΕΜΑ 1ο Να γράψετε στο τετράδιο σας τον αριθμό καθεμιάς από τις παρακάτω ημιτελείς προτάσεις 1 έως 5 και δίπλα το γράμμα που αντιστοιχεί στη φράση που συμπληρώνει

Διαβάστε περισσότερα

ΘΕΜΑ 1 Ο ΜΑΘΗΜΑ / ΤΑΞΗ : ΑΠΑΝΤΗΣΕΙΣ ΒΙΟΛΟΓΙΑΣ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ ΣΕΙΡΑ: ΘΕΡΙΝΑ ΗΜΕΡΟΜΗΝΙΑ: 01/12/2013

ΘΕΜΑ 1 Ο ΜΑΘΗΜΑ / ΤΑΞΗ : ΑΠΑΝΤΗΣΕΙΣ ΒΙΟΛΟΓΙΑΣ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ ΣΕΙΡΑ: ΘΕΡΙΝΑ ΗΜΕΡΟΜΗΝΙΑ: 01/12/2013 ΜΑΘΗΜΑ / ΤΑΞΗ : ΑΠΑΝΤΗΣΕΙΣ ΒΙΟΛΟΓΙΑΣ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ ΣΕΙΡΑ: ΘΕΡΙΝΑ ΗΜΕΡΟΜΗΝΙΑ: 01/12/2013 ΘΕΜΑ 1 Ο Να επιλέξετε την φράση που συμπληρώνει ορθά κάθε μία από τις ακόλουθες προτάσεις: 1. Τα

Διαβάστε περισσότερα

Τα ορμονικά μόρια και η διαχείριση τους μέσα στο φυτό

Τα ορμονικά μόρια και η διαχείριση τους μέσα στο φυτό Φυσιολογία Φυτών Διαχείριση ορμονικών μορίων Τα ορμονικά μόρια και η διαχείριση τους μέσα στο φυτό Φυσιολογία Φυτών 3 ου Εξαμήνου Δ. Μπουράνης, Σ. Χωριανοπούλου 1 Φυσιολογία Φυτών Διαχείριση ορμονικών

Διαβάστε περισσότερα

Εισαγωγή στην Ανοσολογία

Εισαγωγή στην Ανοσολογία Εισαγωγή στην Ανοσολογία ρ. Γιώργος Κρασιάς Ινστιτούτο Νευρολογίας και Γενετικής Κύπρου Τµήµα Μοριακής Ιολογίας Τι είναι το Ανοσοποιητικό Σύστηµα (ΑΣ)? Το ΑΣ (Immune System) είναι ένα σύστηµα άµυνας του

Διαβάστε περισσότερα

ΕΠΑΝΑΛΗΠΤΙΚΑ ΘΕΜΑΤΑ Ο.Ε.Φ.Ε. 2004 ΘΕΜΑΤΑ ΒΙΟΛΟΓΙΑΣ Γ ΛΥΚΕΙΟΥ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ

ΕΠΑΝΑΛΗΠΤΙΚΑ ΘΕΜΑΤΑ Ο.Ε.Φ.Ε. 2004 ΘΕΜΑΤΑ ΒΙΟΛΟΓΙΑΣ Γ ΛΥΚΕΙΟΥ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ ΕΠΑΝΑΛΗΠΤΙΚΑ ΘΕΜΑΤΑ Ο.Ε.Φ.Ε. 2004 ΘΕΜΑ 1 Ο Α. Να επιλέξετε την ορθή πρόταση: ΘΕΜΑΤΑ ΒΙΟΛΟΓΙΑΣ Γ ΛΥΚΕΙΟΥ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ 1. Το κωδικόνιο του mrna που κωδικοποιεί το αµινοξύ µεθειονίνη είναι α. 5 GUA

Διαβάστε περισσότερα

ΑΝΟΣΟΒΙΟΛΟΓΙΑ. Εξεταστική Ιανουαρίου 2010

ΑΝΟΣΟΒΙΟΛΟΓΙΑ. Εξεταστική Ιανουαρίου 2010 Εξεταστική Ιανουαρίου 2010 Ποιες είναι οι διαφορές μιας πρωτογενούς από μια δευτερογενή χυμική ανοσολογική απόκριση; Περιγράψετε τους μηχανισμούς ενεργοποίησης στις δυο περιπτώσεις. ΘΕΜΑ 2 (1 μονάδα) Περιγράψετε

Διαβάστε περισσότερα

Παραγωγή φαρμακευτικών πρωτεϊνών με βιοτεχνολογικές μεθόδους Μεταφορά γονιδίων σε ευκαρυωτικά κύτταρα (Γονιδιακή θεραπεία)

Παραγωγή φαρμακευτικών πρωτεϊνών με βιοτεχνολογικές μεθόδους Μεταφορά γονιδίων σε ευκαρυωτικά κύτταρα (Γονιδιακή θεραπεία) Παραγωγή φαρμακευτικών πρωτεϊνών με βιοτεχνολογικές μεθόδους Μεταφορά γονιδίων σε ευκαρυωτικά κύτταρα (Γονιδιακή θεραπεία) Παραγωγή ινσουλίνης από βακτήρια Παρελθόν: απομόνωση ινσουλίνης από πάνγκρεας

Διαβάστε περισσότερα

ΟΜΟΣΠΟΝ ΙΑ ΕΚΠΑΙ ΕΥΤΙΚΩΝ ΦΡΟΝΤΙΣΤΩΝ ΕΛΛΑ ΟΣ (Ο.Ε.Φ.Ε.) ΕΠΑΝΑΛΗΠΤΙΚΑ ΘΕΜΑΤΑ ΕΠΑΝΑΛΗΠΤΙΚΑ ΘΕΜΑΤΑ 2012 ÓÕÍÅÉÑÌÏÓ. Ηµεροµηνία: Κυριακή 1 Απριλίου 2012

ΟΜΟΣΠΟΝ ΙΑ ΕΚΠΑΙ ΕΥΤΙΚΩΝ ΦΡΟΝΤΙΣΤΩΝ ΕΛΛΑ ΟΣ (Ο.Ε.Φ.Ε.) ΕΠΑΝΑΛΗΠΤΙΚΑ ΘΕΜΑΤΑ ΕΠΑΝΑΛΗΠΤΙΚΑ ΘΕΜΑΤΑ 2012 ÓÕÍÅÉÑÌÏÓ. Ηµεροµηνία: Κυριακή 1 Απριλίου 2012 ΤΑΞΗ: ΜΑΘΗΜΑ: ΘΕΜΑ A Α1-δ, Α2-δ, Α3-γ, Α4-β, Α5-δ ΘΕΜΑ B Γ ΓΕΝΙΚΟΥ ΛΥΚΕΙΟΥ ΒΙΟΛΟΓΙΑ / ΓΕΝΙΚΗΣ ΠΑΙ ΕΙΑΣ Ηµεροµηνία: Κυριακή 1 Απριλίου 2012 ΑΠΑΝΤΗΣΕΙΣ Β1. Οι µεταβολές της θερµοκρασίας του εξωτερικού περιβάλλοντος

Διαβάστε περισσότερα

ΒΙΟΛΟΓΙΑ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ

ΒΙΟΛΟΓΙΑ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ ΒΙΟΛΟΓΙΑ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ ΙΑΓΩΝΙΣΜΑ Θέµα 1 ο 1. Τα άτοµα που είναι ετερόζυγα για τη β-θαλασσαιµία: α. Εµφανίζουν ήπια αναιµία β. Έχουν ευαισθησία στην ελονοσία γ. Συνθέτουν µεγάλη ποσότητα HbF δ.

Διαβάστε περισσότερα

ΑΠΑΝΤΗΣΕΙΣ. ΘΕΜΑ Α Α1. β Α2. γ Α3. δ Α4. γ Α5. β

ΑΠΑΝΤΗΣΕΙΣ. ΘΕΜΑ Α Α1. β Α2. γ Α3. δ Α4. γ Α5. β ΘΕΜΑ Α Α1. β Α2. γ Α3. δ Α4. γ Α5. β 1 ΕΙΣΑΓΩΓΙΚΕΣ ΕΞΕΤΑΣΕΙΣ ΤΕΚΝΩΝ ΕΛΛΗΝΩΝ ΤΟΥ ΕΞΩΤΕΡΙΚΟΥ ΚΑΙ ΤΕΚΝΩΝ ΕΛΛΗΝΩΝ ΥΠΑΛΛΗΛΩΝ ΣΤΟ ΕΞΩΤΕΡΙΚΟ ΤΕΤΑΡΤΗ 10 ΣΕΠΤΕΜΒΡΙΟΥ 2014 ΕΞΕΤΑΖΟΜΕΝΟ ΜΑΘΗΜΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ:

Διαβάστε περισσότερα

ΘΕΜΑΤΑ ΚΑΙ ΑΠΑΝΤΗΣΕΙΣ ΕΠΑΝΑΛΗΠΤΙΚΩΝ ΠΑΝΕΛΛΑΔΙΚΩΝ ΕΞΕΤΑΣΕΩΝ 2014 ΒΙΟΛΟΓΙΑ ΓΕΝΙΚΗΣ ΠΑΙΔΕΙΑΣ

ΘΕΜΑΤΑ ΚΑΙ ΑΠΑΝΤΗΣΕΙΣ ΕΠΑΝΑΛΗΠΤΙΚΩΝ ΠΑΝΕΛΛΑΔΙΚΩΝ ΕΞΕΤΑΣΕΩΝ 2014 ΒΙΟΛΟΓΙΑ ΓΕΝΙΚΗΣ ΠΑΙΔΕΙΑΣ ΒΙΟΛΟΓΙΑ ΓΕΝΙΚΗΣ ΠΑΙΔΕΙΑΣ ΘΕΜΑ Α Να γράψετε στο τετράδιό σας τον αριθμο καθεμιάς από τις παρακάτω ημιτελείς προτάσεις Α1 έως Α5 και, δίπλα, το γράμμα που αντιστοιχεί στη λέξη ή στη φράση, η οποία συμπληρώνει

Διαβάστε περισσότερα

Βιολογία γενικής παιδείας τάξη Γ

Βιολογία γενικής παιδείας τάξη Γ Βιολογία γενικής παιδείας τάξη Γ Παραδόσεις του μαθήματος Επιμέλεια: Γιάννης Αργύρης Βιολόγος M.Sc. Καθηγητής 3 ου Γεν. Λυκ. Ηλιούπολης Κεφάλαιο 1ο Άνθρωπος και υγεία 2. Μηχανισμοί Άμυνας του Ανθρώπινου

Διαβάστε περισσότερα

ΕΞΕΤΑΖΟΜΕΝΟ ΜΑΘΗΜΑ ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ

ΕΞΕΤΑΖΟΜΕΝΟ ΜΑΘΗΜΑ ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ ΕΞΕΤΑΖΟΜΕΝΟ ΜΑΘΗΜΑ ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ ΘΕΜΑ Α Να γράψετε στο τετράδιό σας τον αριθμό καθεμιάς από τις παρακάτω ημιτελείς προτάσεις Α1 έως Α5 και δίπλα το γράμμα που αντιστοιχεί στη λέξη

Διαβάστε περισσότερα

ΦΡΟΝΤΙΣΤΗΡΙΑ ΟΡΟΣΗΜΟ ΘΑΛΗΣ ΠΡΟΤΕΙΝΟΜΕΝΕΣ ΑΠΑΝΤΗΣΕΙΣ ΣΤΟ ΜΑΘΗΜΑ ΤΗΣ ΒΙΟΛΟΓΙΑΣ ΓΕΝΙΚΗΣ ΠΑΙΔΕΙΑΣ. Α1. γ Α2. α Α3. β Α4. β Α5. δ

ΦΡΟΝΤΙΣΤΗΡΙΑ ΟΡΟΣΗΜΟ ΘΑΛΗΣ ΠΡΟΤΕΙΝΟΜΕΝΕΣ ΑΠΑΝΤΗΣΕΙΣ ΣΤΟ ΜΑΘΗΜΑ ΤΗΣ ΒΙΟΛΟΓΙΑΣ ΓΕΝΙΚΗΣ ΠΑΙΔΕΙΑΣ. Α1. γ Α2. α Α3. β Α4. β Α5. δ ΦΡΟΝΤΙΣΤΗΡΙΑ ΠΡΟΤΕΙΝΟΜΕΝΕΣ ΑΠΑΝΤΗΣΕΙΣ ΣΤΟ ΜΑΘΗΜΑ ΤΗΣ ΒΙΟΛΟΓΙΑΣ ΓΕΝΙΚΗΣ ΠΑΙΔΕΙΑΣ ΘΕΜΑ Α Α1. γ Α2. α Α3. β Α4. β Α5. δ ΘΕΜΑ Β Β1. 1 Β 2 Α 3 Α 4 Β 5 Β 6 Α 7 Α 8 Β Β2. Σελ. 18 Σχολικού βιβλίου Το γενετικό

Διαβάστε περισσότερα

ΘΕΜΑ 1 ο Στις ερωτήσεις 1-5, να γράψετε στο τετράδιό σας τον αριθμό της ερώτησης και δίπλα του το γράμμα που αντιστοιχεί στη σωστή απάντηση.

ΘΕΜΑ 1 ο Στις ερωτήσεις 1-5, να γράψετε στο τετράδιό σας τον αριθμό της ερώτησης και δίπλα του το γράμμα που αντιστοιχεί στη σωστή απάντηση. ΒΙΟΛΟΓΙΑ ΓΕΝΙΚΗΣ ΠΑΙΔΕΙΑΣ Γ ΛΥΚΕΙΟΥ ΘΕΜΑ 1 ο Στις ερωτήσεις 1-5, να γράψετε στο τετράδιό σας τον αριθμό της ερώτησης και δίπλα του το γράμμα που αντιστοιχεί στη σωστή απάντηση. 1. Τα κύτταρα που παράγουν

Διαβάστε περισσότερα

Πανελλήνιες Εξετάσεις Ημερήσιων Γενικών Λυκείων. Εξεταζόμενο Μάθημα: Βιολογία Θετικής Κατεύθυνσης, Ημ/νία: 04 Ιουνίου 2014. Απαντήσεις Θεμάτων

Πανελλήνιες Εξετάσεις Ημερήσιων Γενικών Λυκείων. Εξεταζόμενο Μάθημα: Βιολογία Θετικής Κατεύθυνσης, Ημ/νία: 04 Ιουνίου 2014. Απαντήσεις Θεμάτων Πανελλήνιες Εξετάσεις Ημερήσιων Γενικών Λυκείων Εξεταζόμενο Μάθημα: Βιολογία Θετικής Κατεύθυνσης, Ημ/νία: 04 Ιουνίου 2014 Απαντήσεις Θεμάτων ΘΕΜΑ Α A1. Τα πλασμίδια είναι: δ. κυκλικά δίκλωνα μόρια DNA

Διαβάστε περισσότερα

HPV. Τι είναι τα κονδυλώματα?

HPV. Τι είναι τα κονδυλώματα? HPV O HPV (Human papilloma virus) ιός των ανθρώπινων θηλωμάτων είναι ιός που βασίζεται στο DNA και μολύνει το δέρμα και τις βλεννογόνες μεμβράνες ανθρώπων και ορισμένων ζώων. Μέχρι στιγμής έχουν αναγνωριστεί

Διαβάστε περισσότερα

γ ρ α π τ ή ε ξ έ τ α σ η σ τ ο μ ά θ η μ α ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ

γ ρ α π τ ή ε ξ έ τ α σ η σ τ ο μ ά θ η μ α ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ γ ρ α π τ ή ε ξ έ τ α σ η σ τ ο μ ά θ η μ α ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ Γ ' ΛΥΚΕΙΟΥ Τάξη: Γ Λυκείου Τμήμα: Βαθμός: Ονοματεπώνυμο: Καθηγητές: Θ Ε Μ Α A 1. Να επιλέξετε τη σωστή απάντηση: Α1. Το γονίδιο

Διαβάστε περισσότερα

Εργαλεία Μοριακής Γενετικής

Εργαλεία Μοριακής Γενετικής Εργαλεία Μοριακής Γενετικής Αρχές Μοριακής κλωνοποίησης Τα περιοριστικά ένζυμα: αναγνωρίζουν αλληλουχίες (θέσεις περιορισμού). 2 τύποι ενζύμων: -Τύπος I = Κόβουν κοντά στη θέση περιορισμού -σπάνια χρησιμοποιούνται.

Διαβάστε περισσότερα

1 ο ΔΙΑΓΩΝΙΣΜΑ ΒΙΟΛΟΓΙΑΣ ΓΕΝΙΚΗΣ ΠΑΙΔΕΙΑΣ

1 ο ΔΙΑΓΩΝΙΣΜΑ ΒΙΟΛΟΓΙΑΣ ΓΕΝΙΚΗΣ ΠΑΙΔΕΙΑΣ 1 ο ΔΙΑΓΩΝΙΣΜΑ ΒΙΟΛΟΓΙΑΣ ΓΕΝΙΚΗΣ ΠΑΙΔΕΙΑΣ ΘΕΜΑ 1 ο Α. Στις ερωτήσεις 1-5 να γράψετε στο τετράδιό σας τον αριθμό της ερώτησης και δίπλα του το γράμμα που αντιστοιχεί στη σωστή απάντηση. 1. Οι ομοιοστατικοί

Διαβάστε περισσότερα

Η κυτταρική µετατόπιση των πρωτεϊνών

Η κυτταρική µετατόπιση των πρωτεϊνών 9-1 Κεφάλαιο 9 Η κυτταρική µετατόπιση των πρωτεϊνών Εισαγωγή Στο κύτταρο η έκφραση των πρωτεϊνών γίνεται από µόνο ένα τύπο ριβοσώµατος (εκτός των µιτοχονδριακών και των χλωροπλαστικών που µοιάζουν µε αυτά

Διαβάστε περισσότερα

γραπτή εξέταση στo μάθημα ΒΙΟΛΟΓΙΑ ΓΕΝΙΚΗΣ ΠΑΙΔΕΙΑΣ Γ ' ΛΥΚΕΙΟΥ

γραπτή εξέταση στo μάθημα ΒΙΟΛΟΓΙΑ ΓΕΝΙΚΗΣ ΠΑΙΔΕΙΑΣ Γ ' ΛΥΚΕΙΟΥ γραπτή εξέταση στo μάθημα ΒΙΟΛΟΓΙΑ ΓΕΝΙΚΗΣ ΠΑΙΔΕΙΑΣ Γ ' ΛΥΚΕΙΟΥ Τάξη: Γ Λυκείου Τμήμα: Βαθμός: Ονοματεπώνυμο: Καθηγητής: Θ Ε Μ Α A 1. Να επιλέξετε τη σωστή απάντηση: Α1. Η ρύθμιση της θερμοκρασίας του

Διαβάστε περισσότερα

ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ 22 ΜΑΪΟΥ 2015 ΑΠΑΝΤΗΣΕΙΣ

ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ 22 ΜΑΪΟΥ 2015 ΑΠΑΝΤΗΣΕΙΣ ΘΕΜΑ Α Α1. Β Α2. Γ Α3. Α Α4. Α5. Γ ΘΕΜΑ Β ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ 22 ΜΑΪΟΥ 2015 ΑΠΑΝΤΗΣΕΙΣ B1. Α (Σωµατικά κύτταρα στην αρχή της µεσόφασης): 1, 4, 5, 6 Β (Γαµέτες): 2, 3, 7, 8 Β2. (Κάθε

Διαβάστε περισσότερα

www.epignosi.edu.gr ΘΕΜΑ Α

www.epignosi.edu.gr ΘΕΜΑ Α ΘΕΜΑ Α Να γράψετε στην κόλλα σας τον αριθμό καθεμιάς από τις παρακάτω ημιτελείς προτάσεις 1 έως 5 και δίπλα το γράμμα που αντιστοιχεί στη λέξη ή τη φράση, η οποία συμπληρώνει σωστά την ημιτελή πρόταση.

Διαβάστε περισσότερα

Γ1. Το γνώρισμα για το μέγεθος των φτερών ελέγχεται από αυτοσωμικό γονίδιο.

Γ1. Το γνώρισμα για το μέγεθος των φτερών ελέγχεται από αυτοσωμικό γονίδιο. ΠΑΝΕΛΛΗΝΙΕΣ ΒΙΟΛΟΓΙΑΣ ΚΑΤΕΥΘΥΝΣΗΣ 2013 AΠΑΝΤΗΣΕΙΣ ΘΕΜΑ Α Α1.γ Α2.β Α3.α Α4.δ Α5.α ΘΕΜΑ Β Β1. Η γονιδιακή θεραπεία εφαρμόστηκε για πρώτη φορά το 1990 σε ένα κορίτσι που έπασχε από έλλειψη της απαμινάσης

Διαβάστε περισσότερα

ΕΠΑΝΑΛΗΠΤΙΚΕΣ ΠΑΝΕΛΛΑΔΙΚΕΣ ΕΞΕΤΑΣΕΙΣ Δ ΤΑΞΗΣ ΕΣΠΕΡΙΝΟΥ ΓΕΝΙΚΟΥ ΛΥΚΕΙΟΥ ΔΕΥΤΕΡΑ 23 ΙΟΥΝΙΟΥ 2014 ΕΞΕΤΑΖΟΜΕΝΟ ΜΑΘΗΜΑ: ΒΙΟΛΟΓΙΑ ΚΑΤΕΥΘΥΝΣΗΣ ΑΠΑΝΤΗΣΕΙΣ

ΕΠΑΝΑΛΗΠΤΙΚΕΣ ΠΑΝΕΛΛΑΔΙΚΕΣ ΕΞΕΤΑΣΕΙΣ Δ ΤΑΞΗΣ ΕΣΠΕΡΙΝΟΥ ΓΕΝΙΚΟΥ ΛΥΚΕΙΟΥ ΔΕΥΤΕΡΑ 23 ΙΟΥΝΙΟΥ 2014 ΕΞΕΤΑΖΟΜΕΝΟ ΜΑΘΗΜΑ: ΒΙΟΛΟΓΙΑ ΚΑΤΕΥΘΥΝΣΗΣ ΑΠΑΝΤΗΣΕΙΣ 1 ΕΠΑΝΑΛΗΠΤΙΚΕΣ ΠΑΝΕΛΛΑΔΙΚΕΣ ΕΞΕΤΑΣΕΙΣ Δ ΤΑΞΗΣ ΕΣΠΕΡΙΝΟΥ ΓΕΝΙΚΟΥ ΛΥΚΕΙΟΥ ΔΕΥΤΕΡΑ 23 ΙΟΥΝΙΟΥ 2014 ΕΞΕΤΑΖΟΜΕΝΟ ΜΑΘΗΜΑ: ΒΙΟΛΟΓΙΑ ΚΑΤΕΥΘΥΝΣΗΣ ΘΕΜΑ Α Α1. γ Α2. β Α3. γ Α4. δ Α5. α ΑΠΑΝΤΗΣΕΙΣ ΘΕΜΑ Β Β1. Σχολικό

Διαβάστε περισσότερα

ΠΡΟΤΕΙΝΟΜΕΝΕΣ ΛΥΣΕΙΣ ΔΙΑΓΩΝΙΣΜΑΤΟΣ ΒΙΟΛΟΓΙΑΣ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ

ΠΡΟΤΕΙΝΟΜΕΝΕΣ ΛΥΣΕΙΣ ΔΙΑΓΩΝΙΣΜΑΤΟΣ ΒΙΟΛΟΓΙΑΣ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ ΠΡΟΤΕΙΝΟΜΕΝΕΣ ΛΥΣΕΙΣ ΔΙΑΓΩΝΙΣΜΑΤΟΣ ΒΙΟΛΟΓΙΑΣ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ ΘΕΜΑ Α Α. 1. β 2. β 3. γ 4. β Β. Ζύμωση: Διαδικασία ανάπτυξης μικροοργανισμών σε υγρό θρεπτικό υλικό κάτω από οποιεσδήποτε συνθήκες Υβριδοποίηση:

Διαβάστε περισσότερα

ΠΡΟΤΕΙΝΟΜΕΝΕΣ ΑΠΑΝΤΗΣΕΙΣ ΒΙΟΛΟΓΙΑ ΚΑΤΕΥΘΥΝΣΗΣ 2014

ΠΡΟΤΕΙΝΟΜΕΝΕΣ ΑΠΑΝΤΗΣΕΙΣ ΒΙΟΛΟΓΙΑ ΚΑΤΕΥΘΥΝΣΗΣ 2014 ΦΡΟΝΤΙΣΤΗΡΙΑ ΜΕΣΗΣ ΕΚΠΑΙΔΕΥΣΗΣ : - ΠΡΟΤΕΙΝΟΜΕΝΕΣ ΑΠΑΝΤΗΣΕΙΣ ΒΙΟΛΟΓΙΑ ΚΑΤΕΥΘΥΝΣΗΣ 2014 ΘΕΜΑ A Α1. δ Α2. γ Α3. β Α4. γ Α5. β ΘΕΜΑ B Β1. 4 2 1 6 3 5 Β2. α. DNA πολυμεράση β. Πριμόσωμα γ. DNA δεσμάση δ. DNA

Διαβάστε περισσότερα

ΦΡΟΝΤΙΣΤΗΡΙΟ «ΕΝΑ» ΓΙΟΜΠΛΙΑΚΗΣ ΛΑΖΑΡΟΣ ΠΕΤΡΟΜΕΛΙΔΗΣ ΒΑΣΙΛΗΣ

ΦΡΟΝΤΙΣΤΗΡΙΟ «ΕΝΑ» ΓΙΟΜΠΛΙΑΚΗΣ ΛΑΖΑΡΟΣ ΠΕΤΡΟΜΕΛΙΔΗΣ ΒΑΣΙΛΗΣ ΦΡΟΝΤΙΣΤΗΡΙΟ «ΕΝΑ» ΓΙΟΜΠΛΙΑΚΗΣ ΛΑΖΑΡΟΣ ΠΕΤΡΟΜΕΛΙΔΗΣ ΒΑΣΙΛΗΣ ΒΙΟΛΟΓΙΑ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ ΘΕΜΑ 1 ο Α. Να βάλετε σε κύκλο το γράµµα που αντιστοιχεί στη σωστή απάντηση. 1. Ο µέγιστος αριθµός διαφορετικών

Διαβάστε περισσότερα

ΣΕΞΟΥΑΛΙΚΑ ΜΕΤΑΔΙΔΟΜΕΝΑ ΝΟΣΗΜΑΤΑ - ΧΛΑΜΥΔΙΑ - ΜΥΚΟΠΛΑΣΜΑ - ΕΡΠΗΣ - ΚΟΝΔΥΛΩΜΑΤΑ - ΣΥΦΙΛΗ - HIV - ΓΟΝΟΡΡΟΙΑ

ΣΕΞΟΥΑΛΙΚΑ ΜΕΤΑΔΙΔΟΜΕΝΑ ΝΟΣΗΜΑΤΑ - ΧΛΑΜΥΔΙΑ - ΜΥΚΟΠΛΑΣΜΑ - ΕΡΠΗΣ - ΚΟΝΔΥΛΩΜΑΤΑ - ΣΥΦΙΛΗ - HIV - ΓΟΝΟΡΡΟΙΑ ΣΕΞΟΥΑΛΙΚΑ ΜΕΤΑΔΙΔΟΜΕΝΑ ΝΟΣΗΜΑΤΑ - ΧΛΑΜΥΔΙΑ - ΜΥΚΟΠΛΑΣΜΑ - ΕΡΠΗΣ - ΚΟΝΔΥΛΩΜΑΤΑ - ΣΥΦΙΛΗ - HIV - ΓΟΝΟΡΡΟΙΑ Σεξουαλικώς μεταδιδόμενα νοσήματα ή σεξουαλικώς μεταδιδόμενες ασθένειες ή αφροδίσια νοσήματα ονομάζονται

Διαβάστε περισσότερα

ΔΕΙΚΤΕΣ ΦΛΕΓΜΟΝΗΣ ΣΕ ΑΣΘΕΝΕΙΣ ΜΕ ΜΗ ΑΛΛΕΡΓΙΚΟ ΣΟΒΑΡΟ ΒΡΟΓΧΙΚΟ ΑΣΘΜΑ

ΔΕΙΚΤΕΣ ΦΛΕΓΜΟΝΗΣ ΣΕ ΑΣΘΕΝΕΙΣ ΜΕ ΜΗ ΑΛΛΕΡΓΙΚΟ ΣΟΒΑΡΟ ΒΡΟΓΧΙΚΟ ΑΣΘΜΑ ΔΕΙΚΤΕΣ ΦΛΕΓΜΟΝΗΣ ΣΕ ΑΣΘΕΝΕΙΣ ΜΕ ΜΗ ΑΛΛΕΡΓΙΚΟ ΣΟΒΑΡΟ ΒΡΟΓΧΙΚΟ ΑΣΘΜΑ ΠΑΡΑΣΚΕΥΗ ΚΑΤΣΑΟΥΝΟΥ ΛΕΚΤΟΡΑΣ ΙΑΤΡΙΚΗΣ ΣΧΟΛΗΣ ΠΑΝΕΠΙΣΤΗΜΙΟΥ ΑΘΗΝΩΝ ΜΟΝΑΔΑ ΠΝΕΥΜΟΝΟΛΟΓΙΑΣ ΚΑΙ ΑΝΑΠΝΕΥΣΤΙΚΗΣ ΑΝΕΠΑΡΚΕΙΑΣ- Κ.Ε.Θ. ΝΟΣΟΚΟΜΕΙΟ

Διαβάστε περισσότερα

Συστήματα επικοινωνίας Ανθρωπίνου σώματος. ενδοκρινολογικό νευρικό σύστημα

Συστήματα επικοινωνίας Ανθρωπίνου σώματος. ενδοκρινολογικό νευρικό σύστημα Κύτταρο Το κύτταρο αποτελείται από μέρη τα οποία έχουν συγκεκριμένη δομή και επιτελούν μία συγκεκριμένη λειτουργία στην όλη οργάνωση του κυττάρου. Δομή κυτταροπλασματικής μεμβράνης Συστήματα επικοινωνίας

Διαβάστε περισσότερα

AIDS KAI ΥΓΕΙΑ ΠΕΡΙΕΧΟΜΕΝΑ

AIDS KAI ΥΓΕΙΑ ΠΕΡΙΕΧΟΜΕΝΑ AIDS KAI ΥΓΕΙΑ ΠΕΡΙΕΧΟΜΕΝΑ 1. AIDS 2. Φορείς 3. Περίοδος Επώασης 4. Ανοσολογική Ανεπάρκεια 5. HIV - είδη του ιού 6. Προέλευση ιού 7. Kλινική συμπτωματολογία 8. Προφύλαξη 9. Θεραπευτικά σχήματα 10. Στοματικό

Διαβάστε περισσότερα

γραπτή εξέταση στo μάθημα ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ

γραπτή εξέταση στo μάθημα ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ γραπτή εξέταση στo μάθημα ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ Γ ' ΛΥΚΕΙΟΥ Τάξη: Γ Λυκείου Τμήμα: Βαθμός: Ονοματεπώνυμο: Καθηγητές: ΠΑΣΣΙΑ Α. Θ Ε Μ Α A 1. Να επιλέξετε τη σωστή απάντηση: Α1. Κάθε μεταφορικό RNA

Διαβάστε περισσότερα

ΑΣΚΗΣΕΙΣ στο 2 ο κεφάλαιο

ΑΣΚΗΣΕΙΣ στο 2 ο κεφάλαιο ΑΣΚΗΣΕΙΣ στο 2 ο κεφάλαιο 1. Ένας κλώνος ενός γονιδίου προκαρυωτικού κυττάρου έχει την παρακάτω αλληλουχία βάσεων: AAAATGTATACGGGCGCTGATACGGCAAACCCACTCATGTAA Βρείτε: Α) την αλληλουχία των βάσεων του mrna

Διαβάστε περισσότερα

Θέματα Πανελλαδικών 2000-2013

Θέματα Πανελλαδικών 2000-2013 Θέματα Πανελλαδικών 2000-2013 ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΗΜΕΡΗΣΙΩΝ ΛΥΚΕΙΩΝ ΕΣΠΕΡΙΝΩΝ ΛΥΚΕΙΩΝ ΕΠΑΝΑΛΗΠΤΙΚΕΣ Κεφάλαιο 4 ΚΕΦΑΛΑΙΟ 4 ΘΕΜΑ 1 ο Γράψτε τον αριθμό καθεμιάς από τις παρακάτω προτάσεις και δίπλα το γράμμα

Διαβάστε περισσότερα

Γ' ΛΥΚΕΙΟΥ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ ΒΙΟΛΟΓΙΑ. Óõíåéñìüò ΕΚΦΩΝΗΣΕΙΣ. Να επιλέξετε τη φράση που συµπληρώνει ορθά κάθε µία από τις ακόλουθες προτάσεις:

Γ' ΛΥΚΕΙΟΥ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ ΒΙΟΛΟΓΙΑ. Óõíåéñìüò ΕΚΦΩΝΗΣΕΙΣ. Να επιλέξετε τη φράση που συµπληρώνει ορθά κάθε µία από τις ακόλουθες προτάσεις: 1 Γ' ΛΥΚΕΙΟΥ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ ΘΕΜΑ 1 o ΒΙΟΛΟΓΙΑ ΕΚΦΩΝΗΣΕΙΣ Να επιλέξετε τη φράση που συµπληρώνει ορθά κάθε µία από τις ακόλουθες προτάσεις: 1. Το DNA ενός ανθρώπινου κυττάρου αποτελείται από 6 10 9

Διαβάστε περισσότερα

- Θεωρία- Δρ. ΠέτρουΚαρκαλούσου

- Θεωρία- Δρ. ΠέτρουΚαρκαλούσου - Θεωρία- Έκδοση2008 Πρόλογος Αγαπητοίσπουδαστέςοισημειώσειςπουκρατάτεσταχέριασαςέχουνσκοπόνασας εισαγάγουνστιςβασικέςγνώσειςμιαςαπότιςσημαντικότερεςβιοιατρικέςεπιστήμες, της ανοσολογίας. Η ανοσολογίαείναιμιασχετικάνέαεπιστήμηηοποίαεμφανίστηκεστοτέλοςτου

Διαβάστε περισσότερα

ΘΕΜΑΤΑ ΚΑΙ ΑΠΑΝΤΗΣΕΙΣ ΠΑΝΕΛΛΑΔΙΚΩΝ ΕΞΕΤΑΣΕΩΝ 2013 ΒΙΟΛΟΓΙΑ ΚΑΤΕΥΘΥΝΣΗΣ

ΘΕΜΑΤΑ ΚΑΙ ΑΠΑΝΤΗΣΕΙΣ ΠΑΝΕΛΛΑΔΙΚΩΝ ΕΞΕΤΑΣΕΩΝ 2013 ΒΙΟΛΟΓΙΑ ΚΑΤΕΥΘΥΝΣΗΣ ΒΙΟΛΟΓΙΑ ΚΑΤΕΥΘΥΝΣΗΣ ΘΕΜΑ Α Να γράψετε στο τετράδιό σας τον αριθμό κάθε μίας από τις παρακάτω ημιτελείς προτάσεις Α1 έως Α5 και δίπλα το γράμμα, που αντιστοιχεί στη λέξη ή στη φράση, η οποία συμπληρώνει

Διαβάστε περισσότερα

Γ' ΛΥΚΕΙΟΥ ΘΕΤΙΚΗ ΚΑΤΕΥΘΥΝΣΗ ΒΙΟΛΟΓΙΑ ΑΠΑΝΤΗΣΕΙΣ ÏÅÖÅ

Γ' ΛΥΚΕΙΟΥ ΘΕΤΙΚΗ ΚΑΤΕΥΘΥΝΣΗ ΒΙΟΛΟΓΙΑ ΑΠΑΝΤΗΣΕΙΣ ÏÅÖÅ 1 Γ' ΛΥΚΕΙΟΥ ΘΕΤΙΚΗ ΚΑΤΕΥΘΥΝΣΗ ΒΙΟΛΟΓΙΑ ΘΕΜΑ 1 ο 1 γ 2 δ 3 β 4 α 5 γ ΘΕΜΑ 2 ο ΑΠΑΝΤΗΣΕΙΣ Μονάδες 25 (5Χ5) Α. ιαγονιδιακά ζώα ονοµάζονται εκείνα στα οποία το γενετικό τους υλικό έχει τροποποιηθεί µε την

Διαβάστε περισσότερα

Η βιολογία του ιού της γρίπης Γιατίγίνονταιπανδημίες;

Η βιολογία του ιού της γρίπης Γιατίγίνονταιπανδημίες; Η βιολογία του ιού της γρίπης Γιατίγίνονταιπανδημίες; Αλκιβιάδης Βατόπουλος Εργαστήριο Μικροβιολογίας Εθνική Σχολή Δημόσιας Υγείας & Κεντρικό Εργαστήριο Δημόσιας Υγείας ΚΕΕΛΟΝΟ 1. Δομή του Ιού Ιός Γρίπης

Διαβάστε περισσότερα

ΑΠΑΝΤΗΣΕΙΣ ΣΤΗ ΒΙΟΛΟΓΙΑ ΚΑΤΕΥΘΥΝΣΗΣ 24 ΜΑΪΟΥ 2013

ΑΠΑΝΤΗΣΕΙΣ ΣΤΗ ΒΙΟΛΟΓΙΑ ΚΑΤΕΥΘΥΝΣΗΣ 24 ΜΑΪΟΥ 2013 ΑΠΑΝΤΗΣΕΙΣ ΣΤΗ ΒΙΟΛΟΓΙΑ ΚΑΤΕΥΘΥΝΣΗΣ 24 ΜΑΪΟΥ 2013 ΘΕΜΑ Α Α1. γ Α2. β Α3. α Α4. δ Α5. α ΘΕΜΑ Β Β1. Σελ. 123 124 σχολ. βιβλίου: «Η διαδικασία που ακολουθείται παράγουν το ένζυμο ADA». Β2. Σελ. 133 σχολ.

Διαβάστε περισσότερα

8. Σε στέλεχος του βακτηρίου E.coli δε λειτουργεί το γονίδιο που παράγει τον καταστολέα του οπερόνιου της λακτόζης. Ποιο είναι το αποτέλεσμα σε σχέση

8. Σε στέλεχος του βακτηρίου E.coli δε λειτουργεί το γονίδιο που παράγει τον καταστολέα του οπερόνιου της λακτόζης. Ποιο είναι το αποτέλεσμα σε σχέση Γονιδιακή ρύθμιοη 1. Εντοπίστε δύο διαφορές στον έλεγχο της γονιδιακής έκφρασης ανάμεσα στους προκαρυωτικούς και στους ευκαρυωτικούς οργανισμούς. Α. Η ρύθμιση της γσνιδιακής έκφρασης στους προκαρυωτικούς

Διαβάστε περισσότερα

ΑΝΤΙΜΕΤΩΠΙΣΗ ΤΩΝ ΠΑΘΟΓΟΝΩΝ ΜΙΚΡΟΟΡΓΑΝΙΣΜΩΝ ΜΕ ΕΜΒΟΛΙΑ ΚΑΙ ΟΡΟΥΣ

ΑΝΤΙΜΕΤΩΠΙΣΗ ΤΩΝ ΠΑΘΟΓΟΝΩΝ ΜΙΚΡΟΟΡΓΑΝΙΣΜΩΝ ΜΕ ΕΜΒΟΛΙΑ ΚΑΙ ΟΡΟΥΣ ΑΝΤΙΜΕΤΩΠΙΣΗ ΤΩΝ ΠΑΘΟΓΟΝΩΝ ΜΙΚΡΟΟΡΓΑΝΙΣΜΩΝ ΜΕ ΕΜΒΟΛΙΑ ΚΑΙ ΟΡΟΥΣ ΟΝΟΜΑ:ΕΥΑΓΓΕΛΙΑ ΕΠΙΘΕΤΟ:ΠΡΙΦΤΗ ΤΑΞΗ:Γ ΓΥΜΝΑΣΙΟΥ ΤΜΗΜΑ: 4 ΗΜ/ΝΙΑ: 11/10/2013 ΛΙΓΑ ΛΟΓΙΑ ΓΙΑ ΤΟΥΣ ΠΑΘΟΓΟΝΟΥΣ ΜΙΚΡΟΟΡΓΑΝΙΣΜΟΥΣ Ένας μικροοργανισμός

Διαβάστε περισσότερα

ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ

ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ ΘΕΜΑ 1ο Να γράψετε στο τετράδιό σας τον αριθμό καθεμιάς από τις παρακάτω ημιτελείς προτάσεις 1 έως 5 και δίπλα το γράμμα που αντιστοιχεί στη λέξη ή τη φράση, η οποία

Διαβάστε περισσότερα

ΤΟ ΕΡΓΑΣΤΗΡΙΟ ΚΛΙΝΙΚΗΣ ΜΙΚΡΟΒΙΟΛΟΓΙΑΣ ΣΤΟΝ ΕΛΕΓΧΟ ΤΩΝ ΝΟΣΟΚΟΜΕΙΑΚΩΝ ΛΟΙΜΩΞΕΩΝ

ΤΟ ΕΡΓΑΣΤΗΡΙΟ ΚΛΙΝΙΚΗΣ ΜΙΚΡΟΒΙΟΛΟΓΙΑΣ ΣΤΟΝ ΕΛΕΓΧΟ ΤΩΝ ΝΟΣΟΚΟΜΕΙΑΚΩΝ ΛΟΙΜΩΞΕΩΝ 1η ΕΠΙΣΤΗΜΟΝΙΚΗ ΔΙΗΜΕΡΙΔΑ «ΕΛΕΓΧΟΣ ΤΩΝ ΝΟΣΟΚΟΜΕΙΑΚΩΝ ΛΟΙΜΩΞΕΩΝ ΕΦΑΡΜΟΓΕΣ ΣΤΗ ΚΑΘΗΜΕΡΙΝΗ ΠΡΑΞΗ ΔΥΝΑΤΟΤΗΤΕΣ ΠΡΟΟΠΤΙΚΕΣ» ΛΑΜΙΑ 21 22 22 ΟΚΤΩΒΡΙΟΥ 2005 ΤΟ ΕΡΓΑΣΤΗΡΙΟ ΚΛΙΝΙΚΗΣ ΜΙΚΡΟΒΙΟΛΟΓΙΑΣ ΣΤΟΝ ΕΛΕΓΧΟ ΤΩΝ

Διαβάστε περισσότερα

Σας αποστέλλουμε τις προτεινόμενες απαντήσεις που αφορούν τα θέματα της Βιολογίας Γενικής Παιδείας των Ημερησίων Γενικών Λυκείων και ΕΠΑΛ (Ομάδας Β ).

Σας αποστέλλουμε τις προτεινόμενες απαντήσεις που αφορούν τα θέματα της Βιολογίας Γενικής Παιδείας των Ημερησίων Γενικών Λυκείων και ΕΠΑΛ (Ομάδας Β ). Αθήνα, 30/5/2014 ΠΑΝΕΛΛΗΝΙΑ ΕΝΩΣΗ ΒΙΟΕΠΙΣΤΗΜΟΝΩΝ Σας αποστέλλουμε τις προτεινόμενες απαντήσεις που αφορούν τα θέματα της Βιολογίας Γενικής Παιδείας των Ημερησίων Γενικών Λυκείων και ΕΠΑΛ (Ομάδας Β ). Η

Διαβάστε περισσότερα

Παραγωγή, απομόνωση και καθαρισμός της φαρμακευτικής πρωτεΐνης.

Παραγωγή, απομόνωση και καθαρισμός της φαρμακευτικής πρωτεΐνης. ΑΠΟΛΥΤΗΡΙΕΣ ΕΞΕΤΑΣΕΙΣ Γ ΤΑΞΗΣ ΗΜΕΡΗΣΙΟΥ ΕΝΙΑΙΟΥ ΛΥΚΕΙΟΥ ΤΡΙΤΗ 1 ΙΟΥΝΙΟΥ 2004 ΕΞΕΤΑΖΟΜΕΝΟ ΜΑΘΗΜΑ: ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ 1 ΑΠΑΝΤΗΣΕΙΣ ΘΕΜΑ 1o 1. δ 2. β 3. β 4. γ 5. δ ΘΕΜΑ 2o 1. Σχολικό βιβλίο, σελ.

Διαβάστε περισσότερα

γραπτή εξέταση στo μάθημα ΒΙΟΛΟΓΙΑ ΓΕΝΙΚΗΣ ΠΑΙΔΕΙΑΣ Γ ' ΛΥΚΕΙΟΥ

γραπτή εξέταση στo μάθημα ΒΙΟΛΟΓΙΑ ΓΕΝΙΚΗΣ ΠΑΙΔΕΙΑΣ Γ ' ΛΥΚΕΙΟΥ γραπτή εξέταση στo μάθημα ΒΙΟΛΟΓΙΑ ΓΕΝΙΚΗΣ ΠΑΙΔΕΙΑΣ Γ ' ΛΥΚΕΙΟΥ Τάξη: Γ Λυκείου Τμήμα: Βαθμός: Ονοματεπώνυμο: Καθηγητής: Θ Ε Μ Α A 1. Να επιλέξετε τη σωστή απάντηση: Α1. Ευκαρυωτικοί μικροοργανισμοί; α.

Διαβάστε περισσότερα

ΒΙΟΛΟΓΙΑ ΓΕΝΙΚΗΣ ΠΑΙ ΕΙΑΣ

ΒΙΟΛΟΓΙΑ ΓΕΝΙΚΗΣ ΠΑΙ ΕΙΑΣ ΒΙΟΛΟΓΙΑ ΓΕΝΙΚΗΣ ΠΑΙ ΕΙΑΣ Συγκρίνατε την πρωτογενή µε τη δευτερογενή ανοσοβιολογική απόκριση και απεικονίστε αυτές στο ίδιο διάγραµµα αξόνων. Πρωτογενή ανοσοβιολογική απόκριση ονοµάζουµε την απόκριση του

Διαβάστε περισσότερα

ÍÅÏ ÄÕÍÁÌÉÊÏ ÓÔÁÕÑÏÕÐÏËÇ

ÍÅÏ ÄÕÍÁÌÉÊÏ ÓÔÁÕÑÏÕÐÏËÇ 1 ΘΕΜΑ 1 o Γ' ΛΥΚΕΙΟΥ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ ΕΚΦΩΝΗΣΕΙΣ ΒΙΟΛΟΓΙΑ Α. Για τις ερωτήσεις 1 5 να γράψετε στο τετράδιό σας τον αριθµό της ερώτησης και δίπλα του το γράµµα, που αντιστοιχεί στη σωστή απάντηση. 1.

Διαβάστε περισσότερα

Ο ρόλος και η σημασία των μοριακών τεχνικών στον έλεγχο των. μικροβιολογικών παραμέτρων σε περιβαλλοντικά δείγματα για την προστασία

Ο ρόλος και η σημασία των μοριακών τεχνικών στον έλεγχο των. μικροβιολογικών παραμέτρων σε περιβαλλοντικά δείγματα για την προστασία Ο ρόλος και η σημασία των μοριακών τεχνικών στον έλεγχο των μικροβιολογικών παραμέτρων σε περιβαλλοντικά δείγματα για την προστασία της Δημόσιας Υγείας Α. Βανταράκης Εργαστήριο Υγιεινής, Ιατρική Σχολή,

Διαβάστε περισσότερα

ΒΙΟΛΟΓΙΑ Γ ΛΥΚΕΙΟΥ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ 2004

ΒΙΟΛΟΓΙΑ Γ ΛΥΚΕΙΟΥ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ 2004 ΒΙΟΛΟΓΙΑ Γ ΛΥΚΕΙΟΥ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ 2004 ΕΚΦΩΝΗΣΕΙΣ ΘΕΜΑ 1ο Να γράψετε στο τετράδιό σας τον αριθµό καθεµιάς από τις παρακάτω ηµιτελείς προτάσεις 1 έως 5 και δίπλα το γράµµα που αντιστοιχεί στη φράση

Διαβάστε περισσότερα

Βιολογία Θετικής Κατεύθυνσης Γ' Λυκείου 2001

Βιολογία Θετικής Κατεύθυνσης Γ' Λυκείου 2001 Βιολογία Θετικής Κατεύθυνσης Γ' Λυκείου 2001 ΕΚΦΩΝΗΣΕΙΣ Ζήτηµα 1ο Α1. Από τη διασταύρωση ενός λευκού µ ένα µαύρο ποντικό όλοι οι απόγονοι είναι γκρίζοι. Τα γονίδια που καθορίζουν το χρώµα τους είναι: α.

Διαβάστε περισσότερα

ΟΜΟΣΠΟΝ ΙΑ ΕΚΠΑΙ ΕΥΤΙΚΩΝ ΦΡΟΝΤΙΣΤΩΝ ΕΛΛΑ ΟΣ (Ο.Ε.Φ.Ε.) ΕΠΑΝΑΛΗΠΤΙΚΑ ΘΕΜΑΤΑ ΕΠΑΝΑΛΗΠΤΙΚΑ ΘΕΜΑΤΑ 2013 ÁÍÅËÉÎÇ

ΟΜΟΣΠΟΝ ΙΑ ΕΚΠΑΙ ΕΥΤΙΚΩΝ ΦΡΟΝΤΙΣΤΩΝ ΕΛΛΑ ΟΣ (Ο.Ε.Φ.Ε.) ΕΠΑΝΑΛΗΠΤΙΚΑ ΘΕΜΑΤΑ ΕΠΑΝΑΛΗΠΤΙΚΑ ΘΕΜΑΤΑ 2013 ÁÍÅËÉÎÇ ΤΑΞΗ: ΚΑΤΕΥΘΥΝΣΗ: ΜΑΘΗΜΑ: Γ ΓΕΝΙΚΟΥ ΛΥΚΕΙΟΥ ΘΕΤΙΚΗ ΒΙΟΛΟΓΙΑ Ηµεροµηνία: Κυριακή 28 Απριλίου 2013 ιάρκεια Εξέτασης: 3 ώρες ΕΚΦΩΝΗΣΕΙΣ ΘΕΜΑ Α Να γράψετε στο τετράδιό σας τον αριθµό καθεµιάς από τις παρακάτω

Διαβάστε περισσότερα

ΒΙΟΛΟΓΙΑ. 1 ο ΔΙΑΓΩΝΙΣΜΑ ΑΠΑΝΤΗΣΕΙΣ. ΘΕΜΑ 1 o

ΒΙΟΛΟΓΙΑ. 1 ο ΔΙΑΓΩΝΙΣΜΑ ΑΠΑΝΤΗΣΕΙΣ. ΘΕΜΑ 1 o ΘΕΜΑ 1 o Γ ΛΥΚΕΙΟΥ-ΘΕΤΙΚΗ ΚΑΤΕΥΘΥΝΣΗ 1 ο ΔΙΑΓΩΝΙΣΜΑ Α. Γιατί τα βακτήρια μπορούν να χρησιμοποιηθούν σαν «εργοστάσια παραγωγής ανθρώπινων πρωτεϊνών»; Β. Σε ένα βακτήριο εισάγεται με τη μέθοδο του ανασυνδυασμένου

Διαβάστε περισσότερα

ΑΠΟΛΥΤΗΡΙΕΣ ΕΞΕΤΑΣΕΙΣ Γ ΤΑΞΗΣ ΗΜΕΡΗΣΙΟΥ ΓΕΝΙΚΟΥ ΛΥΚΕΙΟΥ ΕΥΤΕΡΑ 18 ΜΑΪΟΥ 2009 ΕΞΕΤΑΖΟΜΕΝΟ ΜΑΘΗΜΑ ΒΙΟΛΟΓΙΑ ΓΕΝΙΚΗΣ ΠΑΙ ΕΙΑΣ

ΑΠΟΛΥΤΗΡΙΕΣ ΕΞΕΤΑΣΕΙΣ Γ ΤΑΞΗΣ ΗΜΕΡΗΣΙΟΥ ΓΕΝΙΚΟΥ ΛΥΚΕΙΟΥ ΕΥΤΕΡΑ 18 ΜΑΪΟΥ 2009 ΕΞΕΤΑΖΟΜΕΝΟ ΜΑΘΗΜΑ ΒΙΟΛΟΓΙΑ ΓΕΝΙΚΗΣ ΠΑΙ ΕΙΑΣ 1 ΘΕΜΑ 1ο ΑΠΟΛΥΤΗΡΙΕΣ ΕΞΕΤΑΣΕΙΣ Γ ΤΑΞΗΣ ΗΜΕΡΗΣΙΟΥ ΓΕΝΙΚΟΥ ΛΥΚΕΙΟΥ ΕΥΤΕΡΑ 18 ΜΑΪΟΥ 2009 ΕΞΕΤΑΖΟΜΕΝΟ ΜΑΘΗΜΑ ΒΙΟΛΟΓΙΑ ΓΕΝΙΚΗΣ ΠΑΙ ΕΙΑΣ Να γράψετε στο τετράδιό σας τον αριθµό καθεµιάς από τις παρακάτω ηµιτελείς

Διαβάστε περισσότερα

ΒΙΟΛΟΓΙΑ Γ ΛΥΚΕΙΟΥ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ 2008

ΒΙΟΛΟΓΙΑ Γ ΛΥΚΕΙΟΥ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ 2008 ΒΙΟΛΟΓΙΑ Γ ΛΥΚΕΙΟΥ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ 2008 ΕΚΦΩΝΗΣΕΙΣ ΘΕΜΑ 1ο Να γράψετε στο τετράδιό σας τον αριθµό καθεµιάς από τις παρακάτω ηµιτελείς προτάσεις 1 έως 5 και δίπλα το γράµµα που αντιστοιχεί στη λέξη

Διαβάστε περισσότερα

1. σελ. 109 «Με τον όρο ζύμωση.. όπως πρωτεΐνες και αντιβιοτικά»

1. σελ. 109 «Με τον όρο ζύμωση.. όπως πρωτεΐνες και αντιβιοτικά» ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ ΑΠΑΝΤΗΣΕΙΣ ΘΕΜΑ 1ο 1. γ 2. γ 3. δ 4. α 5. β ΘΕΜΑ 2ο 1. σελ. 109 «Με τον όρο ζύμωση.. όπως πρωτεΐνες και αντιβιοτικά» 2. σελ. 119-120: «Θεραπευτικά. Τα αντισώματα μπορούν να

Διαβάστε περισσότερα

ΑΠΟΛΥΤΗΡΙΕΣ ΕΞΕΤΑΣΕΙΣ ΤΗΣ Γ' ΛΥΚΕΙΟΥ ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ. ΟΙ ΛΥΣΕΙΣ ΤΩΝ ΘΕΜΑΤΩΝ ΑΠΟ ΤΟΝ ΚΑΘΗΓΗΤΗ κύριο ΤΡΙΓΚΑ ΓΕΩΡΓΙΟ του ΦΡΟΝΤΙΣΤΗΡΙΟΥ

ΑΠΟΛΥΤΗΡΙΕΣ ΕΞΕΤΑΣΕΙΣ ΤΗΣ Γ' ΛΥΚΕΙΟΥ ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ. ΟΙ ΛΥΣΕΙΣ ΤΩΝ ΘΕΜΑΤΩΝ ΑΠΟ ΤΟΝ ΚΑΘΗΓΗΤΗ κύριο ΤΡΙΓΚΑ ΓΕΩΡΓΙΟ του ΦΡΟΝΤΙΣΤΗΡΙΟΥ ΑΠΟΛΥΤΗΡΙΕΣ ΕΞΕΤΑΣΕΙΣ ΤΗΣ Γ' ΛΥΚΕΙΟΥ ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ ΟΙ ΛΥΣΕΙΣ ΤΩΝ ΘΕΜΑΤΩΝ ΑΠΟ ΤΟΝ ΚΑΘΗΓΗΤΗ κύριο ΤΡΙΓΚΑ ΓΕΩΡΓΙΟ του ΦΡΟΝΤΙΣΤΗΡΙΟΥ www.orionidef.gr ΘΕΜΑ A Α1. α Α2. δ Α3. γ Α4. β Α5. β ΘΕΜΑ

Διαβάστε περισσότερα

The Cyprus Institute of. Neurology & Genetics. Influenza. Σταύρος Πασιαρδής. Τμήμα Μοριακής Ιολογίας Ινστιτούτο Νευρολογίας και Γενετικής Κύπρου

The Cyprus Institute of. Neurology & Genetics. Influenza. Σταύρος Πασιαρδής. Τμήμα Μοριακής Ιολογίας Ινστιτούτο Νευρολογίας και Γενετικής Κύπρου The Cyprus Institute of Neurology & Genetics Influenza Σταύρος Πασιαρδής Τμήμα Μοριακής Ιολογίας Ινστιτούτο Νευρολογίας και Γενετικής Κύπρου Ιοί της γρίπης-influenza -Οικογένεια Orthomyxoviridae - Προσβάλουν

Διαβάστε περισσότερα

είναι τα αυτοάνοσα νοσήματα

είναι τα αυτοάνοσα νοσήματα είναι τα αυτοάνοσα νοσήματα Χ.Μ. Μουτσόπουλος Καθηγητής Ιατρικής Σχολής Πανεπιστημίου Αθηνών ο ανοσολογικό (αμυντικό) σύστημα έχει σκοπό την προστασία του οργανισμού από ξένους εισβολείς, όπως είναι τα

Διαβάστε περισσότερα

Μικροοργανισμοί: είναι οι οργανισμοί ΜΙΚΡΟΟΡΓΑΝΙΣΜΟΙ που δεν μπορούμε να Η τους ΜΙΚΡΟΒΙΑ διακρίνουμε με γυμνό μάτι (μέγεθος < 0,1 mm)

Μικροοργανισμοί: είναι οι οργανισμοί ΜΙΚΡΟΟΡΓΑΝΙΣΜΟΙ που δεν μπορούμε να Η τους ΜΙΚΡΟΒΙΑ διακρίνουμε με γυμνό μάτι (μέγεθος < 0,1 mm) Μικροοργανισμοί: είναι οι οργανισμοί ΜΙΚΡΟΟΡΓΑΝΙΣΜΟΙ που δεν μπορούμε να Η τους ΜΙΚΡΟΒΙΑ διακρίνουμε με γυμνό μάτι (μέγεθος < 0,1 mm) Πού και πώς ζουν 1. στο φυσικό περιβάλλον (νιτροποιητικά βακτήρια)

Διαβάστε περισσότερα

ΒΙΟΛΟΓΙΑ Γ ΤΑΞΗΣ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ 2003

ΒΙΟΛΟΓΙΑ Γ ΤΑΞΗΣ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ 2003 ΒΙΟΛΟΓΙΑ Γ ΤΑΞΗΣ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ 2003 ΘΕΜΑ 1ο Α. Να γράψετε τον αριθµό της καθεµιάς από τις παρακάτω προτάσεις 1-5 και δίπλα του τη λέξη Σωστό, αν η πρόταση είναι σωστή, ή Λάθος, αν η πρόταση είναι

Διαβάστε περισσότερα

ΛΥΣΗ ΤΗΣ ΑΣΚΗΣΗΣ ΕΠΑΝΑΛΗΨΗΣ

ΛΥΣΗ ΤΗΣ ΑΣΚΗΣΗΣ ΕΠΑΝΑΛΗΨΗΣ ΛΥΣΗ ΤΗΣ ΑΣΚΗΣΗΣ ΕΠΑΝΑΛΗΨΗΣ 1. Ο γενετικός κώδικας είναι ένας κώδικας αντιστοίχισης των κωδικονίων του mrna με αμινοξέα στην πολυπεπτιδική αλυσίδα. Σύμφωνα με αυτόν η 3 μετάφραση όλων των mrna αρχίζει

Διαβάστε περισσότερα