θέσεις που κόβουν οι περιοριστικές ενδονουκλεάσες, στον αριθμό των πλασμιδίων που θα χρειαστούν κλπ

Μέγεθος: px
Εμφάνιση ξεκινά από τη σελίδα:

Download "θέσεις που κόβουν οι περιοριστικές ενδονουκλεάσες, στον αριθμό των πλασμιδίων που θα χρειαστούν κλπ"


1 ΜΕΘΟΔΟΛΟΓΙΑ ΑΣΚΗΣΕΩΝ ΣΤΟ 4 ο ΚΕΦΑΛΑΙΟ 1. Προβλήματα που αναφέρονται στα κομμάτια που θα κοπεί το DNA, στις θέσεις που κόβουν οι περιοριστικές ενδονουκλεάσες, στον αριθμό των πλασμιδίων που θα χρειαστούν κλπ α. Στο κυκλικό DNA αν υπάρχουν ν θέσεις αναγνώρισης από μια περιοριστική ενδονουκλεάση τότε: i. προκύπτουν ν κομμάτια και ii. χρησιμοποιούνται ν κομμάτια για ανασυνδυασμό και ν πλασμίδια τουλάχιστον. β. Στο γραμμικό DNA αν υπάρχουν ν θέσεις αναγνώρισης από την περιοριστική ενδονουκλεάση, τότε για κάθε μόριο : i. προκύπτουν ν+1 κομμάτια ii. χρησιμοποιούνται ν-1 κομμάτια για ανασυνδυασμό και ν-1 πλασμίδια τουλάχιστον γ. Οι περιοριστικές ενδονουκλεάσες αναγνωρίζουν και σπάνε τους 3 5 φωσφοδιεστερικούς δεσμούς που υπάρχουν μεταξύ των συγκεκριμένων νουκλεοτιδίων. 2. Προβλήματα που αναφέρονται στις αλυσίδες του DNA, συνδυασμός με το δεύτερο κεφάλαιο. 3. Προβλήματα όπως 12 σελ 65 βιβλίου (Διαχωρισμός μετασχηματισμένων από τα μη μετασχηματισμένα βακτήρια σε μια καλλιέργεια) Μεθοδολογία: Α. Καταγράφουμε τις ομάδες βακτηρίων που δημιουργήθηκαν Ομάδες βακτηρίων που δημιουργήθηκαν 1. Βακτήρια που μετασχηματίστηκαν από ανασυνδυασμένα βακτήρια 2. Βακτήρια που μετασχηματίστηκαν από μη ανασυνδυασμένα πλασμίδια 3. Βακτήρια που δεν μετασχηματίστηκαν Χρήση αντιβιοτικού Α Ζουν ή πεθαίνουν ανάλογα πεθαίνουν Χρήση αντιβιοτικού Β Ζουν ή πεθαίνουν ανάλογα πεθαίνουν Β. Αρχικά διαχωρίζουμε τα βακτήρια της 3ης ομάδας από αυτά των άλλων δύο, αφού δεν επιζούν σε περιβάλλον όπου υπάρχουν αντιβιοτικά Γ. Διαχωρίζουμε τα βακτήρια της 2ης ομάδας από αυτά της 1ης, αφού παρουσιάζουν διαφορετικά ανθεκτικότητα στα διάφορα αντιβιοτικά

2 4. Εύρεση του πλήθους των μορίων του DNA που παράγονται με τη μέθοδο PCR, χρόνου παραγωγής αντιγράφων κ.λ.π. Εάν εφαρμόσουμε την μέθοδο PCR ν φορές τότε τα μόρια DNA που παράγονται υπολογίζονται από την σχέση: Μόρια DNA= 2 ν ΑΣΚΗΣΕΙΣ 4 ου ΚΕΦΑΛΑΙΟΥ 1. Με τη δράση της EcoRΙ ένα τμήμα DNA από ευκαρυωτικό κύτταρο κόπηκε σε 5 κομμάτια : α. Σε πόσα σημεία κόπηκε το μόριο; β. Πόσων δεσμών τη διάσπαση προκάλεσε η EcoRi Έστω ότι ένα μιτοχονδριακό κομμάτι DNA κόβεται σε πέντε σημεία με την περιοριστική ενδονουκλεάση EcoRI. α. Σε πόσα κομμάτια κόπηκε το DNA αυτό; β. Πόσοι δεσμοί σπάσανε συνολικά στο δεδομένο μόριο DNA; γ. Αν θελήσουμε να ενσωματώσουμε τα κομμάτια του DNA που προέκυψαν μετά τη δράση της περιοριστικής ενδονουκλεάσης, πόσα πλασμίδια θα χρειαστούμε; 3. Η περιοριστική ενδονουκλεάση BamH1 έχει σαν θέση αναγνώρισης την αλληλουχία... G GATCC CCTAG G και κόβει ανάμεσα στις δύο γουανίνες. α. να βρείτε σε πόσες θέσεις θα κόψει η BamH1 την παρακάτω αλληλουχία: TTAGGATCCCAGTTAGAGTGGATCCAGTC AATCCTAGGGTCAATCTCACCTAGGTCAG και πόσα πλασμίδια θα χρειαστούν; β. Πόσοι φωσφοδιεστερικοί δεσμοί και πόσοι δεσμοί υδρογόνου διασπάστηκαν; Με τη βοήθεια του ενζύμου EcoRΙ κόβουμε ένα τμήμα δίκλωνου DNA σε δύο κομμάτια Α και Β. Το κομμάτι Α αποτελείται από 304 νουκλεοτίδια, από τα οποία τα 60 έχουν ως βάση τη θυμίνη. α. ποια είναι η αριθμητική σύσταση των υπόλοιπων βάσεων στο κομμάτι Α; β. Πόσοι φωσφοδιεστερικοί δεσμοί και πόσοι δεσμοί υδρογόνου υπάρχουν στο κομμάτι Α; γ. Αν το μήκος όλου του τμήματος DNA είναι 800 ζεύγη βάσεων και ο συνολικός αριθμός των θυμινών είναι 160, ποια είναι η αριθμητική σύσταση των βάσεων στο κομμάτι Β; Δίνεται το παρακάτω τμήμα μορίου DNA προκαρυωτικού κυττάρου 5 GAATTCTTAATGCAAGATCATAAAGAATTCTAG 3 3 CTTAAGAATTACGTTCTAGTATTTCTTAAGATC 5 Το παραπάνω τμήμα DNA κόβεται με EcoRI, προκειμένου να ενσωματωθεί σε κατάλληλο πλασμίδιο που έχει κοπεί με την ίδια περιοριστική ενδονουκλεάση, με τελικό σκοπό να εισαχθεί σε βακτήριο για την παραγωγή φαρμακευτικού πολυπεπτιδίου. Να βρείτε την αλληλουχία των αμινοξέων του πολυπεπτιδίου με χρήση του γενετικού κώδικα Π 6. Δίνεται το παρακάτω τμήμα βακτηριακού DNA:

3 3 AACTTAAGATGTTTGAAAAGTAATACTTAAGGC 5 5 TTGAATTCTACAAACTTTT C ATTATGAATTCCG 3 Το τμήμα αυτό του DNA κόβεται με την περιοριστική ενδονουκλεάση EcoRI, προκειμένου να ενσωματωθεί σε κατάλληλο πλασμίδιο που έχει κοπεί με την ίδια περιοριστική ενδονουκλεάση, με τελικό σκοπό να εισαχθεί σε βακτήριο για την παραγωγή ενός πεπτιδίου. Να βρείτε την αλληλουχία των αμινοξέων του πεπτιδίου με τη χρήση του γενετικού κώδικα Όταν σε ένα δίκλωνο DNA μήκους βάσεων επιδράσει το ένζυμο περιορισμού EcoRΙ προκύπτουν δύο κομμάτια μήκους 2000 και 8000 βάσεων. Αν σ αυτό το τμήμα επιδράσει η ενδονουκλεάση BamH1 προκύπτουν τρία κομμάτια, δύο με μεγέθη 3000 βάσεων και ένα με μέγεθος 4000 βάσεων. Όταν στο αρχικό κομμάτι επιδράσουν ταυτόχρονα και τα δύο ένζυμα, προκύπτουν δύο κομμάτια με μήκος 3000 βάσεων και δύο με μήκος 2000 βάσεων. Να δείξετε σε ποιες θέσεις κόβουν τα δύο ένζυμα το DNA. 8. Σε πείραμα γενετικής Μηχανικής χρησιμοποιείται πλασμίδιο το οποίο έχει δύο γονίδια ανθεκτικότητας σε αντίστοιχα αντιβιοτικά : το ένα γονίδιο δίνει ανθεκτικότητα στην αμπικιλίνη και το άλλο στρεπτομυκίνη. Στο πλασμίδιο αυτό εισάγεται τμήμα DNA μέσα στο γονίδιο ανθεκτικότητας της στρεπτομυκίνης. Στη συνέχεια με το ανασυνδυασμένο πλασμίδιο μετασχηματίζονται κύτταρα Escherichia coli που δεν είναι ανθεκτικά σε κανένα από τα δύο αντιβιοτικά. Αναλύστε τρόπο με τον οποίο μπορούν να επιλεγούν τα βακτήρια που περιέχουν το ανασυνδυασμένο πλασμίδιο. 9. Ένα πλασμίδιο που χρησιμοποιείται ως φορέας κλωνοποίησης για την κατασκευή μιας γονιδιωματικής βιβλιοθήκης διαθέτει τρία γονίδια ανθεκτικότητας σε αντιβιοτικό ( για στρεπτομυκίνη, αμπικιλίνη, πενικιλίνη). Η αλληλουχία βάσεων που αναγνωρίζει η περιοριστική ενδονουκλεάση βρίσκεται μέσα στο γονίδιο ανθεκτικότητας στην πενικιλίνη. Να εξηγήσετε με ποιο τρόπο θα επιλέξετε τα μετασχηματισμένα από τα μη μετασχηματισμένα βακτήρια, ώστε να προχωρήσετε στη φάση της κλωνοποίησης. Τα βακτήρια που χρησιμοποιούνται ως κύτταρα-ξενιστές φέρουν στο κύριο μόριο DNA ένα γονίδιο ανθεκτικότητας στην αμπικιλίνη Σε ένα πείραμα PCR επιχειρείται η κατασκευή τουλάχιστον 32 αντιγράφων ενός αρχικού κομματιού από DNA που αποτελείται από νουκλεοτίδια και η αντιγραφή του διαρκεί 2 ώρες. α. μετά από πόσο χρόνο θα έχουμε τον επιθυμητό αριθμό αντιγράφων; β. πόσα νουκλεοτίδια θα υπάρχουν τελικά στα αντίγραφα και πόσα χρειάστηκαν; γ. πόσοι κλώνοι συντέθηκαν; Δίνεται η παρακάτω αλληλουχία νουκλεοτιδίων ενός τμήματος δίκλωνου μορίου DNA που περιέχει ένα γονίδιο υπεύθυνο για τη σύνθεση ενός ολιγοπεπτιδίου 6 αμινοξέων: 5 TTTCTCGAGATGCCCTTACGCGAATTCCGCCAACATTGGGGAATTCCCCCTCGAGAAA 3 3 AAAGAGCTCTACGGGAATGCGCTTAAGGCGGTTGTAACCCCTTAAGGGGGAGCTCTT T 5

4 α. πόσα και ποια κομμάτια θα προκύψουν μετά τη δράση της EcoRI στο παραπάνω μόριο; β. αν χρησιμοποιήσουμε μαζί την και την περιοριστική ενδονουκλεάση Xhol που αναγνω-ρίζει την αλληλουχία νουκλεοτιδίων : 5 CTCGAG 3 3 GAGCTC 5 και την κόβει μεταξύ C και T, ποια κομμάτια θα προκύψουν από την δράση και των δύο περιοριστικών ενδονουκλεασών και ποια θα είναι η αλληλουχία τους; γ. αν θέλουμε να κλωνοποιήσουμε το τμήμα που μεταφράζεται στο ολιγοπεπτίδιο, ποια περιοριστική ενδονουκλεάση θα χρησιμοποιήσουμε; δ. από πόσα ( ή ποια) αμινοξέα αποτελείται το ολιγοπεπτίδιο; Το ένζυμο EcoRI κόβει μικρό γραμμικό δίκλωνο μόριο DNA σε δύο τμήματα, το Α και το Β. Το Α αποτελείται από 212 νουκλεοτίδια, 40 από τα οποία περιέχουν τη βάση αδενίνη. α. ποιος ο αριθμός των άλλων βάσεων του Α τμήματος; β. ποιος ο αριθμός των φωσφοδιεστερικών δεσμών, που υπάρχουν στο τμήμα Α; γ. πόσοι δεσμοί υδρογόνου συγκρατούν μεταξύ τους τις συμπληρωματικές αλυσίδες του Α; δ. ποιος είναι ο αριθμός κάθε είδους βάσεων του τμήματος Β, αν το αρχικό μόριο DNA περιέχει 400 φωσφοδιεστερικούς δεσμούς και 85 αδενίνες; Υπάρχει μια περιοχή του DNA που περιέχει ένα γονίδιο με την ακόλουθη αλληλουχία βάσεων AAAGAATTCATTGAAGCTTCAA 300 νουκλεοτίδια TTGAAGCTTTAAGAATTCACG TTTCTTAAGTAACTTCGAAGTT 300 νουκλεοτίδια AACTTCGAAATTCTTAAGTGC Η περιοχή αυτή περιέχει θέσεις αναγνώρισης από τις ακόλουθες ενδονουκλεάσες: EcoRI και HindIII A AGCTT TTCGA A Υπάρχει ένα φορέας κλωνοποίησης γενετικού υλικό που περιέχει από μια φορά τις θέσεις αυτές περιορισμού. α. που αρχίζει και που τελειώνει το γονίδιο αυτό που υπάρχει στη δοθείσα περιοχή του DNA; β. πόσα νουκλεοτίδια έχει το mrna που μεταγράφεται; γ. πόσα αμινοξέα έχει η πρωτεΐνη που κωδικοποιείται; δ. ποιο ένζυμο πρέπει να χρησιμοποιήσουμε για να ανασυνδυάσουμε ένα φορέα γενετικού υλικού ( που περιέχει κα τις δύο θέσεις από μία φορά), ώστε να περιέχεται όλο το γονίδιο; Σε ένα πείραμα PCR επιθυμούμε να κατασκευάσουμε τουλάχιστον 60 αντίγραφα ρνός τμήματος DNA. Το τμήμα αυτό έχει μήκος 200 ζεύγη βάσεων και κάθε αντιγραφή διαρκεί μία ώρα. α. σε πόσο χρόνο θα έχουμε τον αριθμό των αντιγράφων που επιθυμούμε; β. ποσοι κλώνοι συντέθηκαν και πόσα νουκλεοτίδια χρησιμοποιήθηκαν; γ. πόσα αντίγραφα DNA θα έχουμε μετά από 15 κύκλους αντιγραφής;

5 15. Με τη βοήθεια ενζύμου EcoRI κόβουμε ένα τμήμα δίκλωνου σε δύο κομμάτια Α και Β. Το κομμάτι Α αποτελείται από 304 νουκλεοτίδια, από τα οποία τα 60 έχουν ως βάση θυμίνη. α. ποια είναι η αριθμητική σύσταση των υπολοίπων βάσεων στο κομμάτι Α; β. πόσοι φωσφοδιεστερικοί δεσμοί και πόσοι δεσμοί υδρογόνου υπάρχουν στο κομμάτι Α; γ. αν το μήκος όλου του τμήματος DNA είναι 800 ζεύγη βάσεων και ο συνολικός αριθμός θυμινών είναι 160, ποια είναι η αριθμητική σύσταση των βάσεων στο κομμάτι Β; Σε μια μικρή πόλη έγινε ένα έγκλημα και η αστυνομία βρήκε κοντά στο θύμα μικρή κηλίδα αίματος η οποία δεν ανήκε σ αυτό. Ο γιατρός της πόλης διαθέτει δείγμα αίματος από όλους του κατοίκους της. Ποιες μεθόδους και τεχνικές θα ακολουθήσει για να εξακριβώσει αν η μικρή κηλίδα αίματος ανήκει σε κάποιον από τους κατοίκους της μικρής αυτής πόλης; Δύο άνθρωποι που υποψιάζονται ότι είναι αδέλφια σκοπεύουν να υποβληθούν σε εξέταση DNA για επιβεβαιώσουν ή όχι τις υποψίες τους. Να περιγράψετε τα βήματα που θα ακολουθήσουν για να γίνει η πιστοποίηση Τι θα χρειαστείτε για να αντιγράψετε μια ειδική αλληλουχία DNA πολλές φορές με τη μέθοδο της αλυσιδωτής αντίδρασης πολυμεράσης;



Διαβάστε περισσότερα


ΚΕΦ.4 ΤΕΧΝΟΛΟΓΙΑ ΑΝΑΣΥΝΔΥΑΣΜΕΝΟΥ DNA ΚΕΦ.4 ΤΕΧΝΟΛΟΓΙΑ ΑΝΑΣΥΝΔΥΑΣΜΕΝΟΥ DNA ΕΡΩΤΗΣΕΙΣ ΑΝΑΠΤΥΞΗΣ-ΕΜΒΑΘΥΝΣΗΣ ΘΕΩΡΙΑΣ 4.1. Τι ονομάζεται ανασυνδυασμένο DNA, που χρησιμοποιείται; 4.2. Τι είναι η γενετική μηχανική, ποιοι είναι οι στόχοι της και

Διαβάστε περισσότερα

ΓΕΝΕΤΙΚΗ ΜΗΧΑΝΙΚΗ. Η τεχνολογία του ανασυνδυασμένου DNA και οι εφαρμογές της...

ΓΕΝΕΤΙΚΗ ΜΗΧΑΝΙΚΗ. Η τεχνολογία του ανασυνδυασμένου DNA και οι εφαρμογές της... ΓΕΝΕΤΙΚΗ ΜΗΧΑΝΙΚΗ Η τεχνολογία του ανασυνδυασμένου DNA και οι εφαρμογές της... Γενετική Μηχανική o Περιλαμβάνει όλες τις τεχνικές με τις οποίες μπορούμε να επεμβαίνουμε στο γενετικό υλικό των οργανισμών.

Διαβάστε περισσότερα

Κεφάλαιο 4: Ανασυνδυασμένο DNA

Κεφάλαιο 4: Ανασυνδυασμένο DNA Κεφάλαιο 4: Ανασυνδυασμένο DNA 1. Η ανάπτυξη της γενετικής μηχανικής επέτρεψε: α. την κατανόηση των μηχανισμών αντιγραφής του γενετικού υλικού β. την απομόνωση των πλασμιδίων από τα βακτήρια γ. την πραγματοποίηση

Διαβάστε περισσότερα

Θέματα Πανελλαδικών 2000-2013

Θέματα Πανελλαδικών 2000-2013 Θέματα Πανελλαδικών 2000-2013 ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΗΜΕΡΗΣΙΩΝ ΛΥΚΕΙΩΝ ΕΣΠΕΡΙΝΩΝ ΛΥΚΕΙΩΝ ΕΠΑΝΑΛΗΠΤΙΚΕΣ Κεφάλαιο 4 ΚΕΦΑΛΑΙΟ 4 ΘΕΜΑ 1 ο Γράψτε τον αριθμό καθεμιάς από τις παρακάτω προτάσεις και δίπλα το γράμμα

Διαβάστε περισσότερα

ΚεφάΠαιο 4 ΤεχνοΠογία ίου ανασυνουασμένου DNA

ΚεφάΠαιο 4 ΤεχνοΠογία ίου ανασυνουασμένου DNA ΚεφάΠαιο 4 ΤεχνοΠογία ίου ανασυνουασμένου DNA 1. Γιατί οι περιοριστικές ενδονουκλεάσες και οι φορείς κλωνοποίησης είναι απαραίτητα εργαλεία για τη Γενετική Μηχανική; Οι περιοριστικές ενδονουκλεάσες είναι

Διαβάστε περισσότερα

ΚΕΦΑΛΑΙΟ 4 ο... 2 I. Τεχνολογία του ανασυνδυασµένου DNA... 2

ΚΕΦΑΛΑΙΟ 4 ο... 2 I. Τεχνολογία του ανασυνδυασµένου DNA... 2 ΚΕΦΑΛΑΙΟ 4 ο ΚΕΦΑΛΑΙΟ 4 ο... 2 I. Τεχνολογία του ανασυνδυασµένου DN... 2 ΚΕΦΑΛΑΙΟ 4 ο I. Τεχνολογία του ανασυνδυασµένου DN Εκπαιδευτικοί στόχοι: Μετά την ολοκλήρωση της µελέτης αυτού του κεφαλαίου ο µαθητής

Διαβάστε περισσότερα

Τεχνολογία του ανασυνδυασμένου DNA

Τεχνολογία του ανασυνδυασμένου DNA Τεχνολογία του ανασυνδυασμένου DNA Ε Ι Σ Α Γ Ω Γ Η Φώτης Καρβέλης Ιστορική αναδρομή Ανακάλυψη του DNA Μελέτη αντιγραφής Απομόνωση ενζύμων Μελέτη της δράσης τους Αποκάλυψη των περιοριστικών ενδονουκλεασών

Διαβάστε περισσότερα



Διαβάστε περισσότερα


ΜΑΘΗΜΑ / ΤΑΞΗ : ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΟΥ ΠΡΟΣΑΝΑΤΟΛΙΣΜΟΥ / Γ ΙΑΤΡ ΓΘΕΤ 2 ΗΜΕΡΟΜΗΝΙΑ: 20/03/2016 ΘΕΜΑ Α ΜΑΘΗΜΑ / ΤΑΞΗ : ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΟΥ ΠΡΟΣΑΝΑΤΟΛΙΣΜΟΥ / Γ ΙΑΤΡ ΓΘΕΤ 2 ΗΜΕΡΟΜΗΝΙΑ: 20/03/2016 ΘΕΜΑ Α 1. α 2. δ 3. γ 4. δ 5. γ. ΘΕΜΑ Β 1. Τα αντισώματα αποτελούν το πιο αποτελεσματικό φυσικό φάρμακο για την αντιμετώπιση

Διαβάστε περισσότερα

Βιολογία Θετικής Κατεύθυνσης. 4 ο Κεφάλαιο - Τεχνολογία του ανασυνδυασμένου DNA

Βιολογία Θετικής Κατεύθυνσης. 4 ο Κεφάλαιο - Τεχνολογία του ανασυνδυασμένου DNA Βιολογία Θετικής Κατεύθυνσης 4 ο Κεφάλαιο - Τεχνολογία του ανασυνδυασμένου DNA Τεχνολογία ανασυνδυασμένου DNA Αναπτύχθηκε λόγω της ανακάλυψης: i. Περιοριστικών ενδονουκλεασών ii. Ειδικών φορέων DNA Έδωσε

Διαβάστε περισσότερα

Θέματα Πανελλαδικών

Θέματα Πανελλαδικών Θέματα Πανελλαδικών 2000-2015 ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΗΜΕΡΗΣΙΩΝ ΛΥΚΕΙΩΝ ΕΣΠΕΡΙΝΩΝ ΛΥΚΕΙΩΝ ΕΠΑΝΑΛΗΠΤΙΚΕΣ ΟΜΟΓΕΝΩΝ Κεφάλαιο 4 Περιεχόμενα Περιεχόμενα 1 Κεφάλαιο 1 ο Το γενετικό υλικό Θέμα 1 ο 2 Θέμα 2 ο 8 Θέμα

Διαβάστε περισσότερα


ΒΙΟΛΟΓΙΑ Ο.Π. ΘΕΣΙΚΩΝ ΠΟΤΔΩΝ ΜΑΘΗΜΑ / ΣΑΞΗ : ΕΙΡΑ: ΗΜΕΡΟΜΗΝΙΑ: ΕΠΙΜΕΛΕΙΑ ΔΙΑΓΩΝΙΜΑΣΟ: ΒΙΟΛΟΓΙΑ Ο.Π. ΘΕΣΙΚΩΝ ΠΟΤΔΩΝ ΘΕΜΑ 1 Ο 1. Η γενετική πληροφορία μεταφέρεται στα ριβοσώματα με α. RNA β. DNA γ. πρωτεΐνες δ. λιπίδια 2. Κατά την σύνθεση

Διαβάστε περισσότερα

Βιολογία προσανατολισμού

Βιολογία προσανατολισμού Βιολογία προσανατολισμού ΘΕΜΑ Α Στις προτάσεις από Α1-Α5 να βρείτε την σωστή απάντηση. Α1. Ένας ερευνητής απομόνωσε ένα ασυνεχές γονίδιο από το γονιδίωμα ανθρώπινων κυττάρων. Το γονίδιο συνδέθηκε με βακτηριακό

Διαβάστε περισσότερα

B4-Ασκήσεις για το Κεφάλαιο 4: Η τεχνολογία του ανασυνδυασμένου DNA

B4-Ασκήσεις για το Κεφάλαιο 4: Η τεχνολογία του ανασυνδυασμένου DNA A) Ερωτήσεις με πολλές πιθανές απαντήσεις Να βάλετε σε κύκλο το γράμμα ή τα γράμματα που αντιστοιχούν στη σωστή φράση ή στη φράση που συμπληρώνει σωστά την πρόταση, αν υπάρχει. 1. Οι περιοριστικές ενδονουκλεάσες

Διαβάστε περισσότερα

Βιολογία. Θετικής Κατεύθυνσης

Βιολογία. Θετικής Κατεύθυνσης Βιολογία Θετικής Κατεύθυνσης Κεφάλαιο 4ο ΤΕΧΝΟΛΟΓΊΑ ΤΟΥ ΑΝΑΣΥΝΔΥΑΣΜΈΝΟΥ DNA Γενετική Μηχανική 3 Είναι ο κλάδος της Βιολογίας που περιλαμβάνει τις τεχνικές με τις οποίες ο άνθρωπος επεμβαίνει στο γενετικό

Διαβάστε περισσότερα

ΘΕΜΑ Α Να επιλέξετε τη φράση που συμπληρώνει ορθά κάθε μία από τις ακόλουθες προτάσεις:

ΘΕΜΑ Α Να επιλέξετε τη φράση που συμπληρώνει ορθά κάθε μία από τις ακόλουθες προτάσεις: ΜΑΘΗΜΑ / ΤΑΞΗ: ΒΙΟΛΟΓΙΑ ΟΠ Γ ΛΥΚΕΙΟΥ (ΘΕΡΙΝΑ) ΗΜΕΡΟΜΗΝΙΑ: 22/01/2017 ΕΠΙΜΕΛΕΙΑ ΔΙΑΓΩΝΙΣΜΑΤΟΣ: ΝΟΤΑ ΛΑΖΑΡΑΚΗ ΘΕΜΑ Α Να επιλέξετε τη φράση που συμπληρώνει ορθά κάθε μία από τις ακόλουθες προτάσεις: 1. Από

Διαβάστε περισσότερα

ΘΕΜΑ Α Α1. γ Α2. γ Α3. α Α4. β Α5. β ΘΕΜΑ B B1. B2.

ΘΕΜΑ Α Α1. γ Α2. γ Α3. α Α4. β Α5. β ΘΕΜΑ B B1. B2. ΘΕΜΑ Α Α1. γ (το πριμόσωμα) Α2. γ (οι υποκινητές και οι μεταγραφικοί παράγοντες κάθε γονιδίου) Α3. α (μεταφέρει ένα συγκεκριμένο αμινοξύ στο ριβόσωμα) Α4. β (αποδιάταξη των δύο συμπληρωματικών αλυσίδων)

Διαβάστε περισσότερα

Σημειώσεις Μοριακής Βιολογίας Βιολογία Γ Λυκείου Θετικής Κατεύθυνσης

Σημειώσεις Μοριακής Βιολογίας Βιολογία Γ Λυκείου Θετικής Κατεύθυνσης 1 Προαπαιτούμενες Γνώσεις για την κατανόηση της Κλωνοποίησης 1. Περιοριστικές ενδονουκλεάσες α. Είναι ένζυμα που σπάνε (υδρολύουν) 3-5 φωσφοδιεστερικούς δεσμούς ενδιάμεσα στο μόριο του DNA, και όχι στα

Διαβάστε περισσότερα

Με την ανάπτυξη αυτής της τεχνολογίας το DNA που ήταν τόσο δύσκολο να µελετηθεί έγινε «παιχνίδι» στα ανθρώπινα χέρια

Με την ανάπτυξη αυτής της τεχνολογίας το DNA που ήταν τόσο δύσκολο να µελετηθεί έγινε «παιχνίδι» στα ανθρώπινα χέρια ΚΕΦΑΛΑΙΟ 4ο: Η τεχνολογία του ανασυνδυασµένου DNA έδωσε στον άνθρωπο την ικανότητα όχι µόνο να ερευνά αλλά και να τροποποιεί το γενετικό υλικό των οργανισµών ΤΕΧΝΟΛΟΓΙΑ ΤΟΥ ΑΝΑΣΥΝ ΥΑΣΜΕΝΟΥ DNA Η τεχνολογία

Διαβάστε περισσότερα


ΒΙΟΛΟΓΙΑ ΟΜΑΔΑΣ ΠΡΟΣΑΝΑΤΟΛΙΣΜΟΥ ΘΕΤΙΚΩΝ ΣΠΟΥΔΩΝ 16 Ιουνίου 2017 ΒΙΟΛΟΓΙΑ ΟΜΑΔΑΣ ΠΡΟΣΑΝΑΤΟΛΙΣΜΟΥ ΘΕΤΙΚΩΝ ΣΠΟΥΔΩΝ Απαντήσεις Θεμάτων Πανελλαδικών Εξετάσεων Εσπερινών Λυκείων Γενικών ΘΕΜΑ Α Α.1 δ Α.2 δ Α.3 β Α.4 γ Α.5 α ΘΕΜΑ B B.1 I. A II. E III. ΣΤ IV.

Διαβάστε περισσότερα

ΘΕΜΑ Α Να επιλέξετε την φράση που συμπληρώνει ορθά κάθε μία από τις ακόλουθες προτάσεις:

ΘΕΜΑ Α Να επιλέξετε την φράση που συμπληρώνει ορθά κάθε μία από τις ακόλουθες προτάσεις: ΜΑΘΗΜΑ / ΤΑΞΗ : ΒΙΟΛΟΓΙΑ ΟΠ ΘΕΤΙΚΩΝ ΣΠΟΥΔΩΝ Γ ΛΥΚΕΙΟΥ ΣΕΙΡΑ: ΘΕΡΙΝΑ ΗΜΕΡΟΜΗΝΙΑ: 15/11/2015 ΘΕΜΑ Α Να επιλέξετε την φράση που συμπληρώνει ορθά κάθε μία από τις ακόλουθες προτάσεις: 1. Δεοξυριβονουκλεοτίδια

Διαβάστε περισσότερα

σύγχρονο προπαρασκευή για Α.Ε.Ι. & Τ.Ε.Ι. & Group µαθητικό φροντιστήριο Γραβιάς 85 ΚΗΠΟΥΠΟΛΗ

σύγχρονο προπαρασκευή για Α.Ε.Ι. & Τ.Ε.Ι. & Group µαθητικό φροντιστήριο Γραβιάς 85 ΚΗΠΟΥΠΟΛΗ σύγχρονο Φάσµα & Group προπαρασκευή για Α.Ε.Ι. & Τ.Ε.Ι. µαθητικό φροντιστήριο Γραβιάς 85 ΚΗΠΟΥΠΟΛΗ 210 50 51 557 210 50 56 296 25ης Μαρτίου 111 ΠΕΤΡΟΥΠΟΛΗ 210 50 20 990 210 50 27 990 25ης Μαρτίου 74 ΠΕΤΡΟΥΠΟΛΗ

Διαβάστε περισσότερα



Διαβάστε περισσότερα



Διαβάστε περισσότερα


ΑΣΚΗΣΕΙΣ ΠΡΟΣ ΛΥΣΗ ΚΕΦ. 4ο ΑΣΚΗΣΕΙΣ ΠΡΟΣ ΛΥΣΗ ΚΕΦ. 4ο ΟΜΑΔΑ Α 1. Τμήμα DΝΑ που έχει κοπεί στα άκρα του με την περιοριστική ενδονουκλεάση ΕcoRΙ περιέχει 316 νουκλεοτίδια με αζωτούχο βάση την Τ και 1614 δεσμούς υδρογόνου. Να υπολογίσετε

Διαβάστε περισσότερα



Διαβάστε περισσότερα

B.3 Σχολικό βιβλίο, σελίδες : «Θεραπευτικά. χημειοθεραπείας.»

B.3 Σχολικό βιβλίο, σελίδες : «Θεραπευτικά. χημειοθεραπείας.» 23 Ιουνίου 2014 ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ Απαντήσεις Θεμάτων Πανελληνίων Εξετάσεων Ημερησίων Γενικών Λυκείων ΘΕΜΑ Α Α.1 γ Α.2 β Α.3 β Α.4 δ Α.5 α ΘΕΜΑ Β B.1 Σχολικό βιβλίο, σελίδα 34: «Η αλληλουχία

Διαβάστε περισσότερα

Ημερομηνία: Πέμπτη 5 Ιανουαρίου 2016 Διάρκεια Εξέτασης: 3 ώρες ΕΚΦΩΝΗΣΕΙΣ

Ημερομηνία: Πέμπτη 5 Ιανουαρίου 2016 Διάρκεια Εξέτασης: 3 ώρες ΕΚΦΩΝΗΣΕΙΣ ΑΠΟ 18/12/2016 ΕΩΣ 05/01/2017 2η ΕΞΕΤΑΣΤΙΚΗ ΠΕΡΙΟΔΟΣ ΤΑΞΗ: ΜΑΘΗΜΑ: Γ ΓΕΝΙΚΟΥ ΛΥΚΕΙΟΥ ΒΙΟΛΟΓΙΑ ΠΡΟΣΑΝΑΤΟΛΙΣΜΟΥ Ημερομηνία: Πέμπτη 5 Ιανουαρίου 2016 Διάρκεια Εξέτασης: 3 ώρες ΕΚΦΩΝΗΣΕΙΣ Στις ημιτελείς προτάσεις

Διαβάστε περισσότερα



Διαβάστε περισσότερα



Διαβάστε περισσότερα

ΚΟΡΥΦΑΙΟ ΦΡΟΝΤΙΣΤΗΡΙΟ korifeo.gr. Μάθημα: Βιολογία Προσανατολισμού Εξεταζόμενη ύλη: 1o,2o κεφάλαιο ΘΕΜΑ 1 Ο

ΚΟΡΥΦΑΙΟ ΦΡΟΝΤΙΣΤΗΡΙΟ korifeo.gr. Μάθημα: Βιολογία Προσανατολισμού Εξεταζόμενη ύλη: 1o,2o κεφάλαιο ΘΕΜΑ 1 Ο Μάθημα: Βιολογία Προσανατολισμού Εξεταζόμενη ύλη: 1o,2o κεφάλαιο ΚΟΡΥΦΑΙΟ ΦΡΟΝΤΙΣΤΗΡΙΟ korifeo.gr ΘΕΜΑ 1 Ο Να βάλετε σε κύκλο τον αριθμό που αντιστοιχεί στη σωστή απάντηση ή συμπληρώνει σωστά την πρόταση

Διαβάστε περισσότερα


ΕΞΕΤΑΖΟΜΕΝΟ ΜΑΘΗΜΑ ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ ΕΞΕΤΑΖΟΜΕΝΟ ΜΑΘΗΜΑ ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ ΘΕΜΑ Α Να γράψετε στο τετράδιό σας τον αριθμό καθεμιάς από τις παρακάτω ημιτελείς προτάσεις Α1 έως Α5 και δίπλα το γράμμα που αντιστοιχεί στη λέξη

Διαβάστε περισσότερα

Θεωρία (4 Ο Κεφάλαιο) επιμέλεια: Μιχάλης Χαλικιόπουλος καθηγητής Βιολογίας

Θεωρία (4 Ο Κεφάλαιο) επιμέλεια: Μιχάλης Χαλικιόπουλος καθηγητής Βιολογίας Θεωρία (4 Ο Κεφάλαιο) επιμέλεια: Μιχάλης Χαλικιόπουλος καθηγητής Βιολογίας 1 ΤΕΧΝΟΛΟΓΙΑ ΤΟΥ ΑΝΑΣΥΝΔΥΑΣΜΕΝΟΥ DNA 2 Θεωρία (4 Ο Κεφάλαιο) 3 ΤΕΧΝΟΛΟΓΙΑ ΤΟΥ ΑΝΑΣΥΝΔΥΑΣΜΕΝΟΥ DNA 1 2 3 ΚΛΩΝΟΠΟΙΗΣΗ 4 5 6 ορισμός:

Διαβάστε περισσότερα



Διαβάστε περισσότερα

ΘΕΜΑ Α Να επιλέξετε την φράση που συμπληρώνει ορθά κάθε μία από τις ακόλουθες προτάσεις:

ΘΕΜΑ Α Να επιλέξετε την φράση που συμπληρώνει ορθά κάθε μία από τις ακόλουθες προτάσεις: ΜΑΘΗΜΑ / ΤΑΞΗ : ΒΙΟΛΟΓΙΑ ΟΠ ΘΕΤΙΚΩΝ ΣΠΟΥΔΩΝ / Γ ΛΥΚΕΙΟΥ (ΘΕΡΙΝΑ) ΣΕΙΡΑ: ΗΜΕΡΟΜΗΝΙΑ: 15/11/2015 ΘΕΜΑ Α Να επιλέξετε την φράση που συμπληρώνει ορθά κάθε μία από τις ακόλουθες προτάσεις: 1. Δεοξυριβονουκλεοτίδια

Διαβάστε περισσότερα


ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ ΑΠΑΝΤΗΣΕΙΣ ΣΤΑ ΘΕΜΑΤΑ ΕΞΕΤΑΣΕΩΝ 2011 ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ ΑΠΑΝΤΗΣΕΙΣ ΣΤΑ ΘΕΜΑΤΑ ΕΞΕΤΑΣΕΩΝ 2011 ΘΕΜΑ Α Α1. α Α2. δ Α3. γ Α4. β Α5. β ΘΕΜΑ Β Β1. Σελ. 13: Το 1928 ο Griffith χρησιμοποίησε δύο στελέχη του βακτηρίου πνευμονιόκοκκος δεν

Διαβάστε περισσότερα



Διαβάστε περισσότερα


ΒΙΟΛΟΓΙΑ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ Βιολογία Θετικής Κατεύθυνσης ΒΙΟΛΟΓΙΑ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ ΙΑΓΩΝΙΣΜΑ Β κ Θέµα 1 ο Από τις παρακάτω πολλαπλές απαντήσεις να επιλέξετε τη σωστή. 1. Ο γενετικός κώδικας είναι µη επικαλυπτόµενος, δηλαδή:

Διαβάστε περισσότερα



Διαβάστε περισσότερα



Διαβάστε περισσότερα

γ ρ α π τ ή ε ξ έ τ α σ η σ τ ο μ ά θ η μ α

γ ρ α π τ ή ε ξ έ τ α σ η σ τ ο μ ά θ η μ α γ ρ α π τ ή ε ξ έ τ α σ η σ τ ο μ ά θ η μ α ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ Γ ' ΛΥΚΕΙΟΥ Τάξη: Γ Λυκείου Τμήμα: Βαθμός: Ονοματεπώνυμο: Καθηγητές: Θ Ε Μ Α Να επιλέξετε τη σωστή απάντηση: Α1. Στην τεχνολογία

Διαβάστε περισσότερα

Bιολογία προσανατολισμού

Bιολογία προσανατολισμού Bιολογία προσανατολισμού Α. 1. γ 2. β 3. γ 4. γ 5. β ΘΕΜΑ Α ΘΕΜΑ B B1. Περιγραφή του πολυσώματος όπως αυτό περιγράφεται στις σελίδες 41-42. B2. Σελίδες 37-38 Στους προκαρυωτικούς οργανισμούς... σχηματίζεται

Διαβάστε περισσότερα

ΘΕΜΑ Α Να επιλέξετε τη φράση που συμπληρώνει ορθά κάθε μία από τις ακόλουθες προτάσεις:

ΘΕΜΑ Α Να επιλέξετε τη φράση που συμπληρώνει ορθά κάθε μία από τις ακόλουθες προτάσεις: ΜΘΗΜ / ΤΞΗ: ΙΟΛΟΓΙ ΟΠ Γ ΛΥΚΕΙΟΥ (ΘΕΡΙΝ) ΗΜΕΡΟΜΗΝΙ: 22/01/2017 ΕΠΙΜΕΛΕΙ ΔΙΓΩΝΙΣΜΤΟΣ: ΝΟΤ ΛΖΡΚΗ ΘΕΜ Να επιλέξετε τη φράση που συμπληρώνει ορθά κάθε μία από τις ακόλουθες προτάσεις: 1. πό τη διασταύρωση ελέγχου

Διαβάστε περισσότερα



Διαβάστε περισσότερα



Διαβάστε περισσότερα

3. Σε ένα σωματικό κύτταρο ανθρώπου που βρίσκεται στη μεσόφαση πριν την αντιγραφή υπάρχουν:

3. Σε ένα σωματικό κύτταρο ανθρώπου που βρίσκεται στη μεσόφαση πριν την αντιγραφή υπάρχουν: ΜΑΘΗΜΑ / ΤΑΞΗ : ΒΙΟΛΟΓΙΑ ΚΑΤΕΥΘΥΝΣΗΣ ΣΕΙΡΑ: ΗΜΕΡΟΜΗΝΙΑ: ΘΕΜΑ 1 Ο Α. Να επιλέξετε τη φράση που συμπληρώνει ορθά κάθε μία από τις ακόλουθες προτάσεις: 1. Στο οπερόνιο της λακτόζης: Α. Η πρωτεΐνη καταστολέας

Διαβάστε περισσότερα



Διαβάστε περισσότερα

1. Ο Griffith στα πειράματά του χρησιμοποίησε:

1. Ο Griffith στα πειράματά του χρησιμοποίησε: ΜΑΘΗΜΑ / ΤΑΞΗ : ΒΙΟΛΟΓΙΑ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ ΣΕΙΡΑ: ΧΕΙΜΕΡΙΝΑ ΗΜΕΡΟΜΗΝΙΑ: 27/11/11 ΘΕΜΑ 1 Ο Α. Να επιλέξετε τη φράση που συμπληρώνει ορθά κάθε μία από τις ακόλουθες προτάσεις: 1. Ο Griffith στα πειράματά

Διαβάστε περισσότερα



Διαβάστε περισσότερα

Βιολογία. Γ ΚΥΚΛΟΣ ΠΡΟΣΟΜΟΙΩΤΙΚΩΝ ΔΙΑΓΩΝΙΣΜΑΤΩΝ ΣΥΓΧΡΟΝΟ Προτεινόμενα Θέματα Γ ΓΕΛ. Ιανουάριος προσανατολισμού ΘΕΜΑ Α

Βιολογία. Γ ΚΥΚΛΟΣ ΠΡΟΣΟΜΟΙΩΤΙΚΩΝ ΔΙΑΓΩΝΙΣΜΑΤΩΝ ΣΥΓΧΡΟΝΟ Προτεινόμενα Θέματα Γ ΓΕΛ. Ιανουάριος προσανατολισμού ΘΕΜΑ Α Βιολογία προσανατολισμού ΘΕΜΑ Α Να επιλέξετε τη σωστή απάντηση. Α1. Αν μια ασθένεια καθορίζεται από επικρατές φυλοσύνδετο γονίδιο θα εμφανίζεται: α. Σε όλους τους απογόνους εφόσον ο ένας γονέας έχει την

Διαβάστε περισσότερα

EΠΑΝΑΛΗΠΤΙΚΟ ΔΙΑΓΩΝΙΣΜΑ ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ 1,2,4,9 ΚΕΦΑΛΑΙΑ. Εξεταζόμενο μάθημα. Συκούδη Κωνσταντίνα. Διδάσκων/επιβλέπων καθηγήτρια

EΠΑΝΑΛΗΠΤΙΚΟ ΔΙΑΓΩΝΙΣΜΑ ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ 1,2,4,9 ΚΕΦΑΛΑΙΑ. Εξεταζόμενο μάθημα. Συκούδη Κωνσταντίνα. Διδάσκων/επιβλέπων καθηγήτρια EΠΑΝΑΛΗΠΤΙΚΟ ΔΙΑΓΩΝΙΣΜΑ ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ 1,2,4,9 ΚΕΦΑΛΑΙΑ Εξεταζόμενο μάθημα Συκούδη Κωνσταντίνα Διδάσκων/επιβλέπων καθηγήτρια 3:00 ώρες Διάρκεια εξέτασης Ονοματεπώνυμο εξεταζόμενου Όνομα:

Διαβάστε περισσότερα

Γ ΓΕΝΙΚΟΥ ΛΥΚΕΙΟΥ ΒΙΟΛΟΓΙΑ ΠΡΟΣΑΝΑΤΟΛΙΣΜΟΥ ΘΕΤΙΚΩΝ ΣΠΟΥΔΩΝ. Ημερομηνία: Κυριακή 23 Οκτωβρίου 2016 Διάρκεια Εξέτασης: 3 ώρες ΕΚΦΩΝΗΣΕΙΣ

Γ ΓΕΝΙΚΟΥ ΛΥΚΕΙΟΥ ΒΙΟΛΟΓΙΑ ΠΡΟΣΑΝΑΤΟΛΙΣΜΟΥ ΘΕΤΙΚΩΝ ΣΠΟΥΔΩΝ. Ημερομηνία: Κυριακή 23 Οκτωβρίου 2016 Διάρκεια Εξέτασης: 3 ώρες ΕΚΦΩΝΗΣΕΙΣ ΤΑΞΗ: ΜΑΘΗΜΑ: Γ ΓΕΝΙΚΟΥ ΛΥΚΕΙΟΥ ΒΙΟΛΟΓΙΑ ΠΡΟΣΑΝΑΤΟΛΙΣΜΟΥ ΘΕΤΙΚΩΝ ΣΠΟΥΔΩΝ Ημερομηνία: Κυριακή 23 Οκτωβρίου 2016 Διάρκεια Εξέτασης: 3 ώρες ΕΚΦΩΝΗΣΕΙΣ ΘΕΜΑ Α Στις ημιτελείς προτάσεις Α1 Α4 να γράψετε στο

Διαβάστε περισσότερα


ΕΡΩΤΗΣΕΙΣ 4 Ο, 7 Ο, 8 Ο, 9 Ο ΚΕΦΑΛΑΙΩΝ ΕΡΩΤΗΣΕΙΣ 4 Ο, 7 Ο, 8 Ο, 9 Ο ΚΕΦΑΛΑΙΩΝ 1. Η μεταφορά ανθρώπινου γονιδίου σε βακτήριο δίνει διαφορετικό προϊόν μεταγραφής και μετάφρασης, ενώ σε μύκητες μεταγράφεται κανονικά αλλά το προϊόν μετάφρασης εμφανίζει

Διαβάστε περισσότερα


ΑΠΑΝΤΗΣΕΙΣ ΘΕΜΑΤΩΝ ΒΙΟΛΟΓΙΑΣ ΚΑΤΕΥΘΥΝΣΗΣ ΖΗΤΗΜΑ 1 Ο 1. δ 2. δ 3. δ 4. β 5. δ ΑΠΑΝΤΗΣΕΙΣ ΘΕΜΑΤΩΝ ΒΙΟΛΟΓΙΑΣ ΚΑΤΕΥΘΥΝΣΗΣ 2008 ΖΗΤΗΜΑ 1 Ο 1. δ 2. δ 3. δ 4. β 5. δ ΖΗΤΗΜΑ 2 Ο 1. Σχολ. βιβλ. σελ. 41-42 : «Η ρύθµιση της έκφρασης των γονιδίων στα ευκαρυωτικά κύτταρα.µπορεί να υποστεί τροποποιήσεις

Διαβάστε περισσότερα



Διαβάστε περισσότερα

Βιολογία Προσανατολισμού Γ Λυκείου

Βιολογία Προσανατολισμού Γ Λυκείου Μάθημα/Τάξη: Κεφάλαιο: Βιολογία Προσανατολισμού Γ Λυκείου Το γενετικό υλικό (Κεφ.1), Αντιγραφή, έκφραση και ρύθμιση της γενετικής πληροφορίας (Κεφ.2), Τεχνολογία του Ανασυνδυασμένου DNA (Κεφ.4), Μενδελική

Διαβάστε περισσότερα



Διαβάστε περισσότερα

Τεχνολογία του ανασυνδυασμένου DNA

Τεχνολογία του ανασυνδυασμένου DNA Τεχνολογία του ανασυνδυασμένου DNA κεφάλαιο Κατασκευή ανασυνδυασμένου DNA 4. Τεχνολογία του ανασυνδυασμένου DΝΑ Από το 1953, που οι Watson και Crick πρότειναν το μοντέλο της τρισδιάστατης δομής του DNA,

Διαβάστε περισσότερα



Διαβάστε περισσότερα



Διαβάστε περισσότερα

Περικλέους Σταύρου 31 34100 Χαλκίδα Τ: 2221-300524 & 6937016375 F: 2221-300524 @: chalkida@diakrotima.gr W: www.diakrotima.gr

Περικλέους Σταύρου 31 34100 Χαλκίδα Τ: 2221-300524 & 6937016375 F: 2221-300524 @: chalkida@diakrotima.gr W: www.diakrotima.gr Τ: 2221-300524 & 6937016375 Προς: Μαθητές Α, Β & Γ Λυκείου / Κάθε ενδιαφερόμενο Αγαπητοί Φίλοι Όπως σίγουρα γνωρίζετε, από τον Ιούνιο του 2010 ένα νέο «ΔΙΑΚΡΟΤΗΜΑ» λειτουργεί και στη Χαλκίδα. Στο Φροντιστήριό

Διαβάστε περισσότερα

ΒΙΟΛΟΓΙΑ Ο.Π. ΘΕΤΙΚΩΝ ΣΠΟΥΔΩΝ. Να σημειώσετε το γράμμα που συμπληρώνει κατάλληλα τη φράση:

ΒΙΟΛΟΓΙΑ Ο.Π. ΘΕΤΙΚΩΝ ΣΠΟΥΔΩΝ. Να σημειώσετε το γράμμα που συμπληρώνει κατάλληλα τη φράση: Κανάρη 36, Δάφνη Τηλ. 210 9713934 & 210 9769376 ΔΙΑΓΩΝΙΣΜΑ ΠΡΟΣΟΜΟΙΩΣΗΣ ΒΙΟΛΟΓΙΑ Ο.Π. ΘΕΤΙΚΩΝ ΣΠΟΥΔΩΝ ΘΕΜΑ Α Να σημειώσετε το γράμμα που συμπληρώνει κατάλληλα τη φράση: Α1. Στη μεταγραφή δεν χρειάζονται:

Διαβάστε περισσότερα

Φάσμα. προπαρασκευή για Α.Ε.Ι. & Τ.Ε.Ι.

Φάσμα. προπαρασκευή για Α.Ε.Ι. & Τ.Ε.Ι. σύγχρονο Φάσμα προπαρασκευή για Α.Ε.Ι. & Τ.Ε.Ι. μαθητικό φροντιστήριο 25ης Μαρτίου 111 - ΠΕΤΡΟΥΠΟΛΗ - 210 50 20 990-210 50 27 990 25ης Μαρτίου 74 - ΠΕΤΡΟΥΠΟΛΗ - 210 50 50 658-210 50 60 845 Γραβιάς 85 -

Διαβάστε περισσότερα


ΕΠΑΝΑΛΗΠΤΙΚΑ ΘΕΜΑΤΑ Ο.Ε.Φ.Ε. 2004 ΘΕΜΑΤΑ ΒΙΟΛΟΓΙΑΣ Γ ΛΥΚΕΙΟΥ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ ΕΠΑΝΑΛΗΠΤΙΚΑ ΘΕΜΑΤΑ Ο.Ε.Φ.Ε. 2004 ΘΕΜΑ 1 Ο Α. Να επιλέξετε την ορθή πρόταση: ΘΕΜΑΤΑ ΒΙΟΛΟΓΙΑΣ Γ ΛΥΚΕΙΟΥ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ 1. Το κωδικόνιο του mrna που κωδικοποιεί το αµινοξύ µεθειονίνη είναι α. 5 GUA

Διαβάστε περισσότερα

ΕΚΦΩΝΗΣΕΙΣ. ΘΕΜΑ Α Να επιλέξετε τη φράση που συμπληρώνει ορθά κάθε μία από τις ακόλουθες προτάσεις:

ΕΚΦΩΝΗΣΕΙΣ. ΘΕΜΑ Α Να επιλέξετε τη φράση που συμπληρώνει ορθά κάθε μία από τις ακόλουθες προτάσεις: ΑΡΧΗ 1ΗΣ ΣΕΛΙΔΑΣ Γ ΤΑΞΗ ΓΕΝΙΚΟΥ ΛΥΚΕΙΟΥ ΚΑΙ ΕΠΑΛ (ΟΜΑΔΑ Β ) ΠΑΡΑΣΚΕΥΗ 25/04/2014 - ΕΞΕΤΑΖΟΜΕΝΟ ΜΑΘΗΜΑ: ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ ΣΥΝΟΛΟ ΣΕΛΙΔΩΝ: ΕΠΤΑ (7) ΕΚΦΩΝΗΣΕΙΣ ΘΕΜΑ Α Να επιλέξετε τη φράση που

Διαβάστε περισσότερα


ΑΠΑΝΤΗΣΕΙΣ ΣΤΗ ΒΙΟΛΟΓΙΑ ΚΑΤΕΥΘΥΝΣΗΣ 24 ΜΑΪΟΥ 2013 ΑΠΑΝΤΗΣΕΙΣ ΣΤΗ ΒΙΟΛΟΓΙΑ ΚΑΤΕΥΘΥΝΣΗΣ 24 ΜΑΪΟΥ 2013 ΘΕΜΑ Α Α1. γ Α2. β Α3. α Α4. δ Α5. α ΘΕΜΑ Β Β1. Σελ. 123 124 σχολ. βιβλίου: «Η διαδικασία που ακολουθείται παράγουν το ένζυμο ADA». Β2. Σελ. 133 σχολ.

Διαβάστε περισσότερα


ΑΠΑΝΤΗΣΕΙΣ ΣΤΟ 1 ο ΔΙΑΓΩΝΙΣΜΑ ΒΙΟΛΟΓΙΑΣ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ ΑΠΑΝΤΗΣΕΙΣ ΣΤΟ 1 ο ΔΙΑΓΩΝΙΣΜΑ ΒΙΟΛΟΓΙΑΣ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ ΘΕΜΑ 1 ο Α. Ερωτήσεις πολλαπλής επιλογής 1. δ 2. β 3. γ 4. γ 5. β Β. Ερωτήσεις σωστού λάθους 1. Λάθος 2. Σωστό 3. Λάθος 4. Λάθος 5. Σωστό ΘΕΜΑ

Διαβάστε περισσότερα


ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ ΓΕΝΙΚΟΥ ΛΥΚΕΙΟΥ ΚΑΙ ΕΠΑΛ (ΟΜΑ Α Β ) 2011 ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ ΓΕΝΙΚΟΥ ΛΥΚΕΙΟΥ ΚΑΙ ΕΠΑΛ (ΟΜΑ Α Β ) 2011 ΘΕΜΑ Α Να γράψετε στο τετράδιό σας τον αριθμό καθεμιάς από τις παρακάτω ημιτελείς προτάσεις Α1 έως Α5 και δίπλα το γράμμα που αντιστοιχεί

Διαβάστε περισσότερα


ΟΜΟΣΠΟΝ ΙΑ ΕΚΠΑΙ ΕΥΤΙΚΩΝ ΦΡΟΝΤΙΣΤΩΝ ΕΛΛΑ ΟΣ (Ο.Ε.Φ.Ε.) ΕΠΑΝΑΛΗΠΤΙΚΑ ΘΕΜΑΤΑ ΕΠΑΝΑΛΗΠΤΙΚΑ ΘΕΜΑΤΑ 2013 ÁÍÅËÉÎÇ ΤΑΞΗ: ΚΑΤΕΥΘΥΝΣΗ: ΜΑΘΗΜΑ: Γ ΓΕΝΙΚΟΥ ΛΥΚΕΙΟΥ ΘΕΤΙΚΗ ΒΙΟΛΟΓΙΑ Ηµεροµηνία: Κυριακή 28 Απριλίου 2013 ιάρκεια Εξέτασης: 3 ώρες ΕΚΦΩΝΗΣΕΙΣ ΘΕΜΑ Α Να γράψετε στο τετράδιό σας τον αριθµό καθεµιάς από τις παρακάτω

Διαβάστε περισσότερα



Διαβάστε περισσότερα



Διαβάστε περισσότερα


ΒΙΟΛΟΓΙΑ ΠΡΟΣΑΝΑΤΟΛΙΣΜΟΥ ΕΝΔΕΙΚΤΙΚΕΣ ΑΠΑΝΤΗΣΕΙΣ ΠΑΝΕΛΛΗΝΙΩΝ 2017 ΘΕΜΑ Α Α1. δ Α2. δ Α3. β Α4. γ Α5. α ΘΕΜΑ Β Β1. Ι Α, ΙΙ Ε, ΙΙΙ ΣΤ, ΙV Β, V Ζ, VII Γ, VII Δ Β2. Η εικόνα 1 αντιστοιχεί σε προκαρυωτικό κύτταρο. Στους προκαρυωτικούς

Διαβάστε περισσότερα


ΟΡΟΛΟΓΙΑ 1 ΟΥ ΚΕΦΑΛΑΙΟΥ ΟΡΟΛΟΓΙΑ 1 ΟΥ ΚΕΦΑΛΑΙΟΥ 1. In vitro 2. In vivo 3. Αναστολείς μίτωσης 4. Απλοειδές κύτταρο 5. Απλοειδής οργανισμός 6. Αριθμός ή αλληλουχία βάσεων 7. Αυτοσωμικά χρωμοσώματα 8. Βήμα έλικας 9. Γονιδίωμα κυττάρου

Διαβάστε περισσότερα


ΒΙΟΛΟΓΙΑ Ο.Π. ΘΕΤΙΚΩΝ ΣΠΟΥΔΩΝ Κανάρη 36, Δάφνη Τηλ. 210 9713934 & 210 9769376 ΔΙΑΓΩΝΙΣΜΑ ΠΡΟΣΟΜΟΙΩΣΗΣ ΒΙΟΛΟΓΙΑ Ο.Π. ΘΕΤΙΚΩΝ ΣΠΟΥΔΩΝ ΘΕΜΑ Α Α1. Γ. Α2. Β. Α3. Γ. Α4. Α. Α5. Β. ΘΕΜΑ Β 1. Οι σωστές απαντήσεις είναι: A. Βιβλίο σελ. 65

Διαβάστε περισσότερα

Για το χρώµα σπέρµατος επικρατής είναι η ιδιότητα κίτρινο και η υπολειπόµενη το πράσινο. Συµβολίζουµε: Κ:Κίτρινο κ: Πράσινο Κ>κ

Για το χρώµα σπέρµατος επικρατής είναι η ιδιότητα κίτρινο και η υπολειπόµενη το πράσινο. Συµβολίζουµε: Κ:Κίτρινο κ: Πράσινο Κ>κ Απαντήσεις Βιολογία Κατεύθυνσης 2011 ΘΕΜΑ Α Α1 α Α2 δ Α3 γ Α4 β Α5 β ΘΕΜΑ Β Β1 Σελ. 13 «Το 1928 γίνεται αυτό» Β2 Σελ 101 «βλάβες στους επιδιορθωτικά ένζυµα» (Χωρίς να απαιτείται θα θεωρηθεί σωστό να γίνει

Διαβάστε περισσότερα


ΑΣΚΗΣΕΙΣ 4 Ο, 7 Ο, 8 Ο, 9 Ο ΚΕΦΑΛΑΙΩΝ ΑΣΚΗΣΕΙΣ 4 Ο, 7 Ο, 8 Ο, 9 Ο ΚΕΦΑΛΑΙΩΝ 1. Από τα παρακάτω σχήματα: - Το (i) παριστάνει τμήμα DNA προκαρυωτικού κυττάρου, στο οποίο περιέχεται ένα γονίδιο και ο υποκινητής του (Υ) - Το (ii) παριστάνει το

Διαβάστε περισσότερα


ΒΙΟΛΟΓΙΑ - Γ Λ ΚΑΤΕΥΘΥΝΣΗ. ΑΣΚΗΣΕΙΣ ΒΙΟΛΟΓΙΑΣ - Γ Λ ΚΑΤΕΥΘΥΝΣΗ (ανάκληση γνώσεων από Β Λ) 1 ΒΙΟΛΟΓΙΑ - Γ Λ ΚΑΤΕΥΘΥΝΣΗ ΑΣΚΗΣΕΙΣ ΒΙΟΛΟΓΙΑΣ - Γ Λ ΚΑΤΕΥΘΥΝΣΗ (ανάκληση γνώσεων από Β Λ) 1. Κατά τον σχηματισμό ενός μορίου RNA αποβάλλονται 2008 μόρια νερού. Να βρεθεί το μήκος του. [2009b (βάσεις)]

Διαβάστε περισσότερα


ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ ΘΕΜΑΤΑ ΘΕΜΑ Α Να γράψετε στο τετράδιό σας τον αριθμό κάθε μίας από τις παρακάτω ημιτελείς προτάσεις Α1 έως Α5 και δίπλα το γράμμα, που αντιστοιχεί στη λέξη ή στη φράση, η οποία

Διαβάστε περισσότερα


ΔΙΑΦΟΡΕΣ ΑΣΚΗΣΕΙΣ ΣΤΟ 1 ΚΕΦΑΛΑΙΟ 1 ΔΙΑΦΟΡΕΣ ΑΣΚΗΣΕΙΣ ΣΤΟ 1 ΚΕΦΑΛΑΙΟ Το μόριο DNA μιας χρωματίδας μεταφασικού χωμοσώματος ενός φυσιολογικού ευκαρυωτικού κυττάρου περιέχει το 29% των νουκλεoτιδίων του με αζωτούχα βάση την T. a. Ποιο είναι

Διαβάστε περισσότερα


ΒΙΟΛΟΓΙΑ ΟΜΑΔΑΣ ΠΡΟΣΑΝΑΤΟΛΙΣΜΟΥ ΘΕΤΙΚΩΝ ΣΠΟΥΔΩΝ 8 Σεπτεμβρίου 2017 ΒΙΟΛΟΓΙΑ ΟΜΑΔΑΣ ΠΡΟΣΑΝΑΤΟΛΙΣΜΟΥ ΘΕΤΙΚΩΝ ΣΠΟΥΔΩΝ Απαντήσεις Θεμάτων Επαναληπτικών Πανελλαδικών Εξετάσεων Ημερησίων και Εσπερινών Γενικών Λυκείων ΘΕΜΑ Α Α1. γ Α2. γ Α3. δ Α4. β Α5. β ΘΕΜΑ

Διαβάστε περισσότερα

ΑΠΑΝΤΗΣΕΙΣ. Επιµέλεια: Οµάδα Βιολόγων της Ώθησης

ΑΠΑΝΤΗΣΕΙΣ. Επιµέλεια: Οµάδα Βιολόγων της Ώθησης ΑΠΑΝΤΗΣΕΙΣ Επιµέλεια: Οµάδα Βιολόγων της Ώθησης 1 Τετάρτη, 18 Μαΐου 2011 Γ ΛΥΚΕΙΟΥ ΚΑΤΕΥΘΥΝΣΗΣ ΒΙΟΛΟΓΙΑ ΘΕΜΑ Α Να γράψετε στο τετράδιό σας τον αριθμό καθεμιάς από τις παρακάτω ημιτελείς προτάσεις Α1 έως

Διαβάστε περισσότερα



Διαβάστε περισσότερα

Φάσμα group προπαρασκευή για Α.Ε.Ι. & Τ.Ε.Ι.

Φάσμα group προπαρασκευή για Α.Ε.Ι. & Τ.Ε.Ι. σύγχρονο Φάσμα group προπαρασκευή για Α.Ε.Ι. & Τ.Ε.Ι. µαθητικό φροντιστήριο Γραβιάς 85 ΚΗΠΟΥΠΟΛΗ 50.51.557 50.56.296 25ης Μαρτίου 74 ΠΛ.ΠΕΤΡΟΥΠΟΛΗΣ 50.50.658 50.60.845 25ης Μαρτίου 111 ΠΕΤΡΟΥΠΟΛΗ 50.27.990

Διαβάστε περισσότερα

γ ρ α π τ ή ε ξ έ τ α σ η σ τ ο μ ά θ η μ α ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ

γ ρ α π τ ή ε ξ έ τ α σ η σ τ ο μ ά θ η μ α ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ γ ρ α π τ ή ε ξ έ τ α σ η σ τ ο μ ά θ η μ α ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ Γ ' ΛΥΚΕΙΟΥ Τάξη: Γ Λυκείου Τμήμα: Βαθμός: Ονοματεπώνυμο: Καθηγητές: Θ Ε Μ Α A 1. Να επιλέξετε τη σωστή απάντηση: Α1. Το γονίδιο

Διαβάστε περισσότερα


Φ Ρ Ο Ν Τ Ι Σ Τ Η Ρ Ι Α ΘΕΩΡΗΤΙΚΗ ΘΕΤΙΚΗ ΤΕΧΝΟΛΟΓΙΚΗ ΚΑΤΕΥΘΥΝΣΗ ΕΠΑ.Λ Βιολογία ΘΕΜΑ Α κατεύθυνσης 1. δ 2. α 3. γ 4. δ 5. γ 6. α 7. δ 8. α 9. α 10. α ΘΕΜΑ Β Β1. Η ραδιενέργεια 32 Ρ θα βρίσκεται στο κλάσμα Β, δηλαδή στο κλάσμα εκείνο που περιλαμβάνει τα βακτήρια που έχουν

Διαβάστε περισσότερα

ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ ΟΝΟΜΑΤΕΠΩΝΥΜΟ: ΤΜΗΜΑ: ΘΕΜΑ 1 Ο. 3. Το DNA των μιτοχονδρίων έχει μεγαλύτερο μήκος από αυτό των χλωροπλαστών.

ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ ΟΝΟΜΑΤΕΠΩΝΥΜΟ: ΤΜΗΜΑ: ΘΕΜΑ 1 Ο. 3. Το DNA των μιτοχονδρίων έχει μεγαλύτερο μήκος από αυτό των χλωροπλαστών. ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ ΟΝΟΜΑΤΕΠΩΝΥΜΟ: ΤΜΗΜΑ: ΘΕΜΑ 1 Ο Α. Να γράψετε τον αριθμό της καθεμιάς από τις παρακάτω προτάσεις 1-5 και δίπλα του τη λέξη Σωστό, αν η πρόταση είναι σωστή, ή Λάθος, αν η πρόταση

Διαβάστε περισσότερα



Διαβάστε περισσότερα

ΑΠΑΝΤΗΣΕΙΣ. ΘΕΜΑ Α Α1. β Α2. γ Α3. γ Α4. α Α5. δ


Διαβάστε περισσότερα

ΕΠΑΝΑΛΗΠΤΙΚΑ ΘΕΜΑΤΑ 2016 B ΦΑΣΗ. ΒΙΟΛΟΓΙΑ Ηµεροµηνία: Τετάρτη 4 Μαΐου 2016 ιάρκεια Εξέτασης: 3 ώρες ΕΚΦΩΝΗΣΕΙΣ ÏÅÖÅ

ΕΠΑΝΑΛΗΠΤΙΚΑ ΘΕΜΑΤΑ 2016 B ΦΑΣΗ. ΒΙΟΛΟΓΙΑ Ηµεροµηνία: Τετάρτη 4 Μαΐου 2016 ιάρκεια Εξέτασης: 3 ώρες ΕΚΦΩΝΗΣΕΙΣ ÏÅÖÅ ΤΑΞΗ: Γ ΓΕΝΙΚΟΥ ΛΥΚΕΙΟΥ ΠΡΟΣΑΝΑΤΟΛΙΣΜΟΣ: ΘΕΤΙΚΩΝ ΣΠΟΥ ΩΝ ΜΑΘΗΜΑ: ΒΙΟΛΟΓΙΑ Ηµεροµηνία: Τετάρτη 4 Μαΐου 2016 ιάρκεια Εξέτασης: 3 ώρες ΘΕΜΑ Α ΕΚΦΩΝΗΣΕΙΣ Να γράψετε στο τετράδιό σας τον αριθµό καθεµιάς από

Διαβάστε περισσότερα


ΑΠΑΝΤΗΣΕΙΣ ΒΙΟΛΟΓΙΑΣ ΚΑΤΕΥΘΥΝΣΗΣ ΔΙΑΓΩΝΙΣΜΑ ΣΤΟ 1 ο ΚΕΦΑΛΑΙΟ 12-9-2015 ΑΠΑΝΤΗΣΕΙΣ ΒΙΟΛΟΓΙΑΣ ΚΑΤΕΥΘΥΝΣΗΣ ΔΙΑΓΩΝΙΣΜΑ ΣΤΟ 1 ο ΚΕΦΑΛΑΙΟ 12-9-2015 ΘΕΜΑ Α Α1. α. in vitro β. in vivo γ. in vitro δ. in vitro Α2. γ Μεταξύ των δύο δεοξυριβονουκλεοτιδίων έχουμε συμπληρωματικότητα (Α=Τ)

Διαβάστε περισσότερα

Να επιλέξετε την φράση που συμπληρώνει ορθά κάθε μία από τις ακόλουθες προτάσεις:

Να επιλέξετε την φράση που συμπληρώνει ορθά κάθε μία από τις ακόλουθες προτάσεις: ΜΑΘΗΜΑ / ΤΑΞΗ : ΒΙΟΛΟΓΙΑ / Β Λ ΠΡΟΕΤΟΙΜΑΣΙΑ Γ Λ ΗΜΕΡΟΜΗΝΙΑ: 28/02/2016 ΕΠΙΜΕΛΕΙΑ ΔΙΑΓΩΝΙΣΜΑΤΟΣ: ΝΟΤΑ ΛΑΖΑΡΑΚΗ ΘΕΜΑ 1 Ο Να επιλέξετε την φράση που συμπληρώνει ορθά κάθε μία από τις ακόλουθες προτάσεις:

Διαβάστε περισσότερα

ΑΠΑΝΤΗΣΕΙΣ. Να επιλέξετε την φράση που συμπληρώνει ορθά κάθε μία από τις ακόλουθες προτάσεις:

ΑΠΑΝΤΗΣΕΙΣ. Να επιλέξετε την φράση που συμπληρώνει ορθά κάθε μία από τις ακόλουθες προτάσεις: ΜΑΘΗΜΑ / ΤΑΞΗ : ΑΠΑΝΤΗΣΕΙΣ ΒΙΟΛΟΓΙΑΣ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ / Γ ΛΥΚΕΙΟΥ ΗΜΕΡΟΜΗΝΙΑ: 21/09/2015 ΕΠΙΜΕΛΕΙΑ: ΝΟΤΑ ΛΑΖΑΡΑΚΗ ΘΕΜΑ 1 Ο ΑΠΑΝΤΗΣΕΙΣ Να επιλέξετε την φράση που συμπληρώνει ορθά κάθε μία από τις ακόλουθες

Διαβάστε περισσότερα

ΠΑΝΕΠΙΣΤΗΜΙΟ ΙΩΑΝΝΙΝΩΝ ΑΝΟΙΚΤΑ ΑΚΑΔΗΜΑΪΚΑ ΜΑΘΗΜΑΤΑ. Βιοτεχνολογία. Τεχνολογία ανασυνδυασμένου DNA Διδάσκουσα: Αναπλ. Καθ. Άννα Ειρήνη Κούκκου

ΠΑΝΕΠΙΣΤΗΜΙΟ ΙΩΑΝΝΙΝΩΝ ΑΝΟΙΚΤΑ ΑΚΑΔΗΜΑΪΚΑ ΜΑΘΗΜΑΤΑ. Βιοτεχνολογία. Τεχνολογία ανασυνδυασμένου DNA Διδάσκουσα: Αναπλ. Καθ. Άννα Ειρήνη Κούκκου ΠΑΝΕΠΙΣΤΗΜΙΟ ΙΩΑΝΝΙΝΩΝ ΑΝΟΙΚΤΑ ΑΚΑΔΗΜΑΪΚΑ ΜΑΘΗΜΑΤΑ Βιοτεχνολογία Τεχνολογία ανασυνδυασμένου DNA Διδάσκουσα: Αναπλ. Καθ. Άννα Ειρήνη Κούκκου Άδειες Χρήσης Το παρόν εκπαιδευτικό υλικό υπόκειται σε άδειες

Διαβάστε περισσότερα

Ζεύγη βάσεων ΓΕΝΕΤΙΚΗ 11. ΜΟΡΙΑΚΗ ΓΕΝΕΤΙΚΗ. Φωσφοδιεστερικός δεσμός

Ζεύγη βάσεων ΓΕΝΕΤΙΚΗ 11. ΜΟΡΙΑΚΗ ΓΕΝΕΤΙΚΗ. Φωσφοδιεστερικός δεσμός Ζεύγη βάσεων Αδενίνη Θυμίνη Γουανίνη Κυτοσίνη ΓΕΝΕΤΙΚΗ Φωσφοδιεστερικός δεσμός 11. ΜΟΡΙΑΚΗ ΓΕΝΕΤΙΚΗ 1 ΜΟΡΙΑΚΗ ΓΕΝΕΤΙΚΗ άμεση πρόσβαση στο γενετικό υλικό εφαρμογές στην υγεία, βελτίωση φυτών και ζώων, προστασία

Διαβάστε περισσότερα

Φάσμα& Group προπαρασκευή για Α.Ε.Ι. & Τ.Ε.Ι.

Φάσμα& Group προπαρασκευή για Α.Ε.Ι. & Τ.Ε.Ι. σύγχρονο Φάσμα& Group προπαρασκευή για Α.Ε.Ι. & Τ.Ε.Ι. μαθητικό φροντιστήριο 1. 25ης Μαρτίου 111 ΠΕΤΡΟΥΠΟΛΗ 50.27.990 50.20.990 2. 25ης Μαρτίου 74 Π. ΠΕΤΡΟΥΠΟΛΗΣ 50.50.658 50.60.845 3. Γραβιάς 85 ΚΗΠΟΥΠΟΛΗ

Διαβάστε περισσότερα


ΒΙΟΛΟΓΙΑ Ο.Π. ΘΕΤΙΚΩΝ ΣΠΟΥΔΩΝ ΜΑΘΗΜΑ / ΤΑΞΗ : ΣΕΙΡΑ: ΗΜΕΡΟΜΗΝΙΑ: ΕΠΙΜΕΛΕΙΑ ΔΙΑΓΩΝΙΣΜΑΤΟΣ: ΒΙΟΛΟΓΙΑ Ο.Π. ΘΕΤΙΚΩΝ ΣΠΟΥΔΩΝ ΘΕΜΑ 1 Ο 1. Ένζυμο το οποίο δεν συμμετέχει στην κατασκευή cdna βιβλιοθήκης είναι η: α. DNA δεσμάση β. DNA ελικάση

Διαβάστε περισσότερα

ΘΕΜΑ 1 Ο Α. Να επιλέξετε τη φράση που συμπληρώνει ορθά κάθε μία από τις ακόλουθες προτάσεις: 1. Ως φορείς κλωνοποίησης χρησιμοποιούνται:

ΘΕΜΑ 1 Ο Α. Να επιλέξετε τη φράση που συμπληρώνει ορθά κάθε μία από τις ακόλουθες προτάσεις: 1. Ως φορείς κλωνοποίησης χρησιμοποιούνται: ΜΑΘΗΜΑ / ΤΑΞΗ : ΒΙΟΛΟΓΙΑ ΚΑΤΕΥΘΥΝΣΗΣ / Γ ΛΥΚΕΙΟΥ ΧΕΙΜΕΡΙΝΑ ΣΕΙΡΑ: ΗΜΕΡΟΜΗΝΙΑ: 04/03/12 ΘΕΜΑ 1 Ο Α. Να επιλέξετε τη φράση που συμπληρώνει ορθά κάθε μία από τις ακόλουθες προτάσεις: 1. Ως φορείς κλωνοποίησης

Διαβάστε περισσότερα



Διαβάστε περισσότερα

ΑΠΑΝΤΗΣΕΙΣ. Α. Να επιλέξετε τη φράση που συμπληρώνει ορθά κάθε μία από τις ακόλουθες προτάσεις:

ΑΠΑΝΤΗΣΕΙΣ. Α. Να επιλέξετε τη φράση που συμπληρώνει ορθά κάθε μία από τις ακόλουθες προτάσεις: ΘΕΜΑ 1 Ο ΑΠΑΝΤΗΣΕΙΣ Α. Να επιλέξετε τη φράση που συμπληρώνει ορθά κάθε μία από τις ακόλουθες προτάσεις: 1. Στο οπερόνιο της λακτόζης: Α. Η πρωτεΐνη καταστολέας συνδέεται με το ρυθμιστικό γονίδιο Β. Το

Διαβάστε περισσότερα