ΒΙΟΛΟΓΙΑ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ

Μέγεθος: px
Εμφάνιση ξεκινά από τη σελίδα:

Download "ΒΙΟΛΟΓΙΑ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ"

Transcript

1 Βιολογία Θετικής Κατεύθυνσης ΒΙΟΛΟΓΙΑ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ ΙΑΓΩΝΙΣΜΑ Β κ Θέµα 1 ο Από τις παρακάτω πολλαπλές απαντήσεις να επιλέξετε τη σωστή. 1. Ο γενετικός κώδικας είναι µη επικαλυπτόµενος, δηλαδή: α. διαβάζεται συνεχώς ανά τρία νουκλεοτίδια χωρίς να παραλείπεται κάποιο νουκλεοτίδιο β. µε εξαίρεση 2 αµινοξέα τα υπόλοιπα κωδικοποιούνται από 2 µέχρι και 6 διαφορετικά κωδικόνια γ. κάθε νουκλεοτίδιο ανήκει σε ένα κωδικόνιο δ. κάθε νουκλεοτίδιο κωδικοποιεί ένα διαφορετικό αµινοξύ 2. Ο αριθµός των διαφορετικών trna που συναντάται στα κύτταρα είναι: α. 61 β. 64 γ. 20 δ Κατά τη γονιδιακή ρύθµιση στους ευκαρυωτικούς οργανισµούς, η ικανότητα του mrna να προσδένεται στα ριβοσώµατα καθορίζεται: α. στο επίπεδο της µεταγραφής β. στο επίπεδο µετά τη µεταγραφή γ. στο επίπεδο της µετάφρασης δ. στο επίπεδο µετά τη µετάφραση 4. Ο όρος κλωνοποίηση γενικά αναφέρεται: α. στη διαδικασία δηµιουργίας κλώνων βακτηρίων β. στη διαδικασία δηµιουργίας πανοµοιότυπων ζώων (αµφιβίων και θηλαστικών) γ. στη δηµιουργία εκατοµµυρίων αντιγράφων µιας ειδικής αλληλουχίας DNA δ. στην κατασκευή, κατά προτίµηση, µεγάλου αριθµού πανοµοιότυπων µορίων, κυττάρων ή οργανισµών 5. Η µελαγχρωµατική ξηροδερµία οφείλεται σε: 1

2 ΘΕΤΙΚΟ ΦΡΟΝΤΙΣΤΗΡΙΟ α. µετάλλαξη των γονιδίων που κωδικοποιούν τα επιδιορθωτικά ένζυµα β. έλλειψη γονιδίων γ. µια χρωµοσωµική ανωµαλία, συνηθέστερα µετατόπιση δ. συσσώρευση µεταλλάξεων τόσο σε ογκογονίδια όσο και σε ογκοκατασταλτικά Θέµα 2 ο 1. Όπως είναι γνωστό η τροποποίηση του γενετικού υλικού των ζώων είναι δυνατή µε διάφορες τεχνικές. Α. Ποια ζώα ονοµάζονται διαγονιδιακά; (Μονάδες 3) Β. Ποια είναι η σηµαντικότερη µέθοδος που ακολουθούµε για να δηµιουργήσουµε ένα διαγονιδιακό ζώο; Περιγράψτε την. (Μονάδες 6) Γ. Ποια βήµατα ακολουθούµε για την παραγωγή µιας φαρµακευτικής πρωτεϊνης ανθρώπινης προέλευσης από ένα διαγονιδιακό ζώο; (Μονάδες 6) 2. Αν θελουµε να αναπτύξουµε στο εργαστήριο σε στερεά θρεπτικά υλικά τα βακτήρια του γένους Lactobacillus, Α. ποια θρεπτικά υλικά πρέπει να χρησιµοποιήσουµε; Β. σε τι τιµές θα ρυθµίσουµε το ph και ποια βήµατα θα ακολουθήσουµε ώστε να φτιάξουµε καλλιέργειες Lactobacillus στο εργαστήριο και να τις διατηρήσουµε για αρκετά µεγάλο χρονικό διάστηµα; Θέµα 3 ο ίνεται µόριο DNA που περιέχει γονίδιο παραγωγής φαρµακευτικής πρωτεϊνης 3 CATCTTAAGAGTCCCAAAGTACTTAAGCA5 5 GTAGAATTCTCAGGGTTTCATGAATTCGT3 Σε πείραµα Γενετικής Μηχανικής το παραπάνω µόριο DNA κόβεται µε την περιοριστική ενδονουκλεάση EcoRI και το ενδιάµεσο τµήµα που προκύπτει ενσωµατώνεται σε πλασµίδιο που έχει κοπεί µε την ίδια περιοριστική ενδονουκλεάση. Με το ανασυνδυασµένο πλασµίδιο µετασχηµατίζονται βακτήρια µε σκοπό την παραγωγή της φαρµακευτικής πρωτεϊνης. 2

3 Βιολογία Θετικής Κατεύθυνσης Αν το πλασµίδιο διαθέτει δυο γονίδια ανθεκτικότητας σε πενικιλίνη και αµπικιλίνη εκτός της θέσης που το διασπά η EcoRI και το βακτήριο ξενιστής φέρει στο κύριο DNA του γονίδιο ανθεκτικότητας στην πενικιλίνη να απαντήσετε στα παρακάτω: Α. Να παρουσιάσετε το παραπάνω τµήµα DNA που θα προκύψει απ τη διάσπαση του µορίου µε την EcoRI. Να προδιορίσετε την κωδική και µη κωδική αλυσίδα του γονιδίου στο τµήµα αυτό. Ποιο το παραγόµενο mrna και από ποια αµινοξέα αποτελείται η φαρµακευτική πρωτεϊνη που θα παραχθεί; ίνεται ο γενετικός κώδικας. (Μονάδες 8) Β.Να περιγράψετε τη διαδικασία µε την οποία κατασκευάζουµε το ανασυνδυασµένο πλασµίδιο. (Μονάδες 7) Γ. Αναλύστε τον τρόπο µε τον οποίο θα µπορούσαµε να αποµακρύνουµε τα βακτήρια που δε µετασχηµατίστηκαν.. Πώς θα εξηγούσατε την παρουσία γονιδίου ανθεκτικότητας σε αντιβιοτικό στο κύριο µόριο DNA ενός βακτηρίου; Θέµα 4 ο Ζευγάρι υποψήφιων γονέων ζήτησε γενετική καθοδήγηση. Ο ειδικός επιστήµονας διαπίστωσε πως οι δυο υποψήφιοι γονείς ήταν ετερόζυγοι για το γονίδιο β της β- θαλασσαιµίας που βρίσκεται στο 5 ο ζεύγος των οµόλογων χρωµοσωµάτων τους. ιαπίστωσε επίσης ότι στο 3 ο ζεύγος των χρωµοσωµάτων τους είχαν ο καθένας από ένα υπολειπόµενο θνησιγόνο αλληλόµορφο για το ίδιο γονίδιο. Α. Σε τι είδους µετάλλαξη οφείλεται η β-θαλασσαιµία και ποια τα συµπτώµατά της; (Μονάδες 8) Β. Ποια γονίδια αποκαλούνται θνησιγόνα και τι προβλήµατα προκαλούν; (Μονάδες 7) Γ.Ποια πιθανότητα έχει το συγκεκριµένο ζευγάρι να αποκτήσει: i) παιδί φυσιολογικό και ii) παιδί µε β θαλασσαιµία; Να αιτιολογήσετε την απάντησή σας. (Μονάδες 10) Θέµα 1 ο 1.γ, 2.α, 3.γ, 4.δ 5.α ΑΠΑΝΤΗΣΕΙΣ 3

4 ΘΕΤΙΚΟ ΦΡΟΝΤΙΣΤΗΡΙΟ Θέµα 2 ο 1. Α. Σελ.133 σχολ. Βιβλ. «ιαγονιδιακά ονοµάζονται...άλλο είδος.» Β. Σελ. 133 σχολ. Βιβλ. «Υπάρχουν αρκετές...χοίρων και αιγών.» Γ. Σελ. 135 σχολ. Βιβλ. «Συνοψίζοντας...καθαρισµός της φαρµακευτικής πρωτεϊνης.» 2. Α.Σελ. 108 σχολ. Βιβλ. «Οπως και όλοι...ως συστατικά διαφόρων µορίων.» και σελ. 109 «Τα θρεπτικά υλικά που χρησιµοποιούνται...σε µικρότερες θερµοκρασίες.» Β.Τα βακτήρια του γένους Lactobacillus αναπτύσσονται σε ph 4-5. Αρα θα ρυθµίσουµε το ph της καλλιέργειας σε αυτές τις τιµές. Και σελ.109 σχολ. Βιβλ. «Μια καλλιέργεια ξεκινάει...έναρξη της καλλιέργειας.» Θέµα 3 ο Α. Η περιοριστική ενδονουκλεάση EcoRI που αποµονώθηκε από το βακτήριο Escherichia coli όποτε συναντά την αλληλουχία: 5 GAATTC 3 3 CTTAAG 5 στο γονιδίωµα, κόβει κάθε αλυσίδα µεταξύ του G και του A (µε κατεύθυνση 5 προς 3 ) αφήνοντας µονόκλωνα άκρα από αζευγάρωτες βάσεις στα κοµµένα άκρα. Στο συγκεκριµένο µόριο DNA συναντάται 2 φορές η παραπάνω αλληλουχία, 3 CATCTTAAGAGTCCCAAAGTACTTAAGCA 5 5 GTAGAATTCTCAGGGTTTCATGAATTCGT 3 άρα µετα τη δράση της EcoRI θα προκύψει το τµήµα: 3 GAGTCCCAAAGTACTTAA 5 5 AATTCTCAGGGTTTCATG 3 Η κάτω αλυσίδα είναι η µη κωδική (µεταγραφόµενη) γιατί διαβάζοντάς την από δεξιά προς τα αριστερά (από 3 προς 5 ) συναντώ την τριπλέτα 3 TAC5 που αντιστοιχεί στο κωδικόνιο έναρξης 5 AUG3 του mrna και συνεχίζοντας το διάβασµα ανά τριπλέτα, συναντώ την τριπλέτα 3 ACT5 που αντιστοιχεί στο κωδικόνιο λήξης 5 UGA3 του mrna. Γνωρίζουµε πως το mrna είναι αντιπαράλληλο και συµπληρωµατικό της µη κωδικής αλυσίδας του γονιδίου. Αρα η πάνω αλυσίδα του τµήµατος DNA είναι η κωδική. mrna 5 AAUUCAUGAAACCCUGAGAAUU 3 4

5 Βιολογία Θετικής Κατεύθυνσης Ο γενετικός κώδικας είναι κώδικας τριπλέτας, δηλαδή ανά τρία τα νουκλεοτίδια του mrna κωδικοποιούν ένα αµινοξύ. Εξαιρείται το κωδικόνιο λήξης που δεν αντιστοιχεί σε trna και δεν κωδικοποιεί αµινοξύ. Αµινοξέα επίσης δεν κωδικοποιούνται και από τις 5, 3 αµετάφραστες περιοχές του mrna που βρίσκονται πριν το κωδικόνιο έναρξης και µετά το κωδικόνιο λήξης αντίστοιχα. Αρα θα κωδικοποιηθεί το τριπεπτίδιο: NH2-Met-Lys-Pro-COOH Β. Σελ σχολ. Βιβλ. «Τα πλασµίδια που χρησιµοποιούνται...dna του οργανισµού.» Γ. Σελ. 59 σχολ. Βιβλ. «Η επιλογή...στο συγκεκριµένο αντιβιοτικό.» Στη συγκεκριµένη περίπτωση τόσο τα µετασχηµατισµένα όσο και τα µη µετασχηµατισµένα βακτήρια διαθέτουν γονίδιο ανθεκτικότητας στην πενικιλίνη στο κύριο µόριο DNA τους. Οµως µόνο τα µετασχηµατισµένα διαθέτουν γονίδιο ανθεκτικότητας στην αµπικιλίνη στο πλασµίδιο που έχουν δεχτεί. Εποµένως θα χρησιµοποιήσουµε αµπικιλίνη για να αποµακρύνουµε (σκοτώσουµε) τα βακτήρια που δε µετασχηµατίστηκαν.. Μεταξύ των γονιδίων που συναντούµε στα πλασµίδια των βακτηρίων, υπάρχουν γονίδια ανθεκτικότητας σε αντιβιοτικά. Τα πλασµίδια ωστόσο έχουν την ικανότητα να ανταλλάσσουν γενετικό υλικό τόσο µεταξύ τους όσο και µε το κύριο µόριο DNA του βακτηρίου. Ετσι θα µπορούσαµε να εξηγήσουµε την παρουσία ενός γονιδίου ανθεκτικότητας σε αντιβιοτικό στο κύριο βακτηριακό DNA. Θέµα 4 ο Α. Σελ. 93 σχολ. Βιβλ. «Μια από τις σοβαρότερες...25%». Β. Σελ. 76,77 σχολ. Βιβλ. «Τα γονίδια αρχίζουν...µέχρι τη γέννηση.» Γ. Εστω: Β, αυτοσωµικό επικρατές γονίδιο, φυσιολογικό, υπεύθυνο για την παραγωγή β αλυσίδων της αιµοσφαιρίνης και β, αυτοσωµικό υπολειπόµενο γονίδιο, υπεύθυνο για τη β-θαλασσαιµία. Επίσης έστω Α, αυτοσωµικό επικρατές γονίδιο φυσιολογικό και α, αυτοσωµικό υπολειπόµενο γονίδιο θνησιγόνο. Οι δυο γονείς είναι ετερόζυγοι και για τα δυο ζεύγη γονιδίων. Τα δυο ζεύγη γονιδίων βρίσκονται σε διαφορετικά ζεύγη χρωµοσωµάτων, άρα καταλαβαίνουµε πως ισχύει ο 2 ος νόµος του Mendel ή νόµος της ανεξάρτητης µεταβίβασης των γονιδίων. 5

6 ΘΕΤΙΚΟ ΦΡΟΝΤΙΣΤΗΡΙΟ AaBβ/ΑαΒβ ΑΒ Αβ αβ αβ ΑΒ ΑΑΒΒ ΑΑΒβ ΑαΒΒ ΑαΒβ Αβ ΑΑΒβ Ααββ ΑαΒβ Ααββ αβ ΑαΒΒ ΑαΒβ ααββ ααββ αβ ΑαΒβ Ααββ ααββ Ααββ Φ.Α.: 9 φυσιολογικά :3 β-θαλασσαιµία :4 πεθαίνουν λόγω έκφρασης του θνησιγόνου i. Η πιθανότητα το συγκεκριµένο ζευγάρι να αποκτήσει φυσιολογικό παιδί είναι 9/16 επί των συνολικών περιπτώσεων εγκυµοσύνης ή 9/12 (75%) επί των απογόνων που επιζούν. ii. Η πιθανότητα το συγκεκριµένο ζευγάρι να αποκτήσει παιδί µε β-θαλασσαιµία είναι 3/16 επί των συνολικών περιπτώσεων εγκυµοσύνης ή 3/12 (25%) επί των απογόνων που επιζούν. Τα παραπάνω αποτελέσµατα καθορίζονται από τον 1 ο και 2 ο νόµο του Mendel καθώς και από τη δράση των θνησιγόνων γονιδίων που τροποποιούν τις αναµενόµενες φαινοτυπικές αναλογίες. Ενα άτοµο που είναι οµόζυγο στο υπολειπόµενο θνησιγόνο γονίδιο δεν επιβιώνει µέχρι τη γέννηση και συνεπώς ο αντίστοιχος φαινότυπος χάνεται. Σελ.71 σχολ. Βιβλ. «Ο τρόπος µε τον οποίο...διαχωρισµού των αλληλόµορφων γονιδίων.» και σελ. 73 σχολ. Βιβλ. «...ο Mendel πρότεινε...δηµιουργία των γαµετών.» Επιµέλεια: Γερολυµάτου Ανδρονίκη 6

ΑΠΑΝΤΗΣΕΙΣ ΣΤΗ ΒΙΟΛΟΓΙΑ ΚΑΤΕΥΘΥΝΣΗΣ 24 ΜΑΪΟΥ 2013

ΑΠΑΝΤΗΣΕΙΣ ΣΤΗ ΒΙΟΛΟΓΙΑ ΚΑΤΕΥΘΥΝΣΗΣ 24 ΜΑΪΟΥ 2013 ΑΠΑΝΤΗΣΕΙΣ ΣΤΗ ΒΙΟΛΟΓΙΑ ΚΑΤΕΥΘΥΝΣΗΣ 24 ΜΑΪΟΥ 2013 ΘΕΜΑ Α Α1. γ Α2. β Α3. α Α4. δ Α5. α ΘΕΜΑ Β Β1. Σελ. 123 124 σχολ. βιβλίου: «Η διαδικασία που ακολουθείται παράγουν το ένζυμο ADA». Β2. Σελ. 133 σχολ.

Διαβάστε περισσότερα

ΒΙΟΛΟΓΙΑ ΚΑΤΕΥΘΥΝΣΗΣ

ΒΙΟΛΟΓΙΑ ΚΑΤΕΥΘΥΝΣΗΣ ΒΙΟΛΟΓΙΑ ΚΑΤΕΥΘΥΝΣΗΣ ΘΕΜΑ Α Α1 γ Α2 β Α3 α Α4 δ Α5 α ΘΕΜΑ Β Β1. Σχολικό βιβλίο, Σελ.: 123-124: «Η διαδικασία που ακολουθείται με ενδοφλέβια ένεση στον οργανισμό». Β2. Σχολικό βιβλίο, Σελ.: 133: «Διαγονιδιακά

Διαβάστε περισσότερα

ΒΙΟΛΟΓΙΑ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ

ΒΙΟΛΟΓΙΑ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ Βιολογία Θετικής Κατεύθυνσης ΒΙΟΛΟΓΙΑ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ ΙΑΓΩΝΙΣΜΑ Α κ Θέµα 1 ο Από τις παρακάτω πολλαπλές απαντήσεις να επιλέξετε τη σωστή. 1. Αν ένα γονίδιο βακτηριακού DNA έχει µήκος 1500 ζεύγη βάσεων,

Διαβάστε περισσότερα

ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ

ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ ΘΕΜΑΤΑ ΘΕΜΑ Α Να γράψετε στο τετράδιό σας τον αριθμό κάθε μίας από τις παρακάτω ημιτελείς προτάσεις Α1 έως Α5 και δίπλα το γράμμα, που αντιστοιχεί στη λέξη ή στη φράση, η οποία

Διαβάστε περισσότερα

ΠΑΝΕΛΛΗΝΙΕΣ 2013 ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ ΑΠΑΝΤΗΣΕΙΣ

ΠΑΝΕΛΛΗΝΙΕΣ 2013 ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ ΑΠΑΝΤΗΣΕΙΣ ΘΕΜΑ Α. Α1 γ Α2 β Α3 α Α4 δ Α5 α ΘΕΜΑ Β. ΠΑΝΕΛΛΗΝΙΕΣ 2013 ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ ΑΠΑΝΤΗΣΕΙΣ Β1. Σελ 123 σχολ. Βιβλίου: Από «Η γονιδιακή θεραπεία εφαρμόστηκε για πρώτη φορά το Σεπτέμβριο του 1990»

Διαβάστε περισσότερα

ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ

ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ Απαντήσεις στα θέματα των Εισαγωγικών Εξετάσεων τέκνων Ελλήνων του Εξωτερικού και τέκνων Ελλήνων Υπαλλήλων στο εξωτερικό 2013 ΘΕΜΑ Α Α1. γ Α2. β Α3. δ Α4. α Α5. δ ΘΕΜΑ Β Β1.

Διαβάστε περισσότερα

B.3 Σχολικό βιβλίο, σελίδες : «Θεραπευτικά. χημειοθεραπείας.»

B.3 Σχολικό βιβλίο, σελίδες : «Θεραπευτικά. χημειοθεραπείας.» 23 Ιουνίου 2014 ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ Απαντήσεις Θεμάτων Πανελληνίων Εξετάσεων Ημερησίων Γενικών Λυκείων ΘΕΜΑ Α Α.1 γ Α.2 β Α.3 β Α.4 δ Α.5 α ΘΕΜΑ Β B.1 Σχολικό βιβλίο, σελίδα 34: «Η αλληλουχία

Διαβάστε περισσότερα

Σελίδα 123 σχολικού βιβλίου : Η διαδικασία που ακολουθείται... και εισάγεται πάλι

Σελίδα 123 σχολικού βιβλίου : Η διαδικασία που ακολουθείται... και εισάγεται πάλι ΠΡΟΤΕΙΝΟΜΕΝΕΣ ΑΠΑΝΤΗΣΕΙΣ ΒΙΟΛΟΓΙΑΣ ΚΑΤΕΥΘΥΝΣΗΣ ΘΕΜΑ Α Α1. γ Α2. β Α3. α Α4. δ Α5. α ΘΕΜΑ Β Β1. Σελίδα 123 σχολικού βιβλίου : Η διαδικασία που ακολουθείται... και εισάγεται πάλι σ αυτόν. Β2. Σελίδα 133

Διαβάστε περισσότερα

Πανελλήνιες Εξετάσεις Ημερήσιων Γενικών Λυκείων. Εξεταζόμενο Μάθημα: Βιολογία Θετικής Κατεύθυνσης, Ημ/νία: 24 Μαΐου 2013. Απαντήσεις Θεμάτων

Πανελλήνιες Εξετάσεις Ημερήσιων Γενικών Λυκείων. Εξεταζόμενο Μάθημα: Βιολογία Θετικής Κατεύθυνσης, Ημ/νία: 24 Μαΐου 2013. Απαντήσεις Θεμάτων Πανελλήνιες Εξετάσεις Ημερήσιων Γενικών Λυκείων Εξεταζόμενο Μάθημα: Βιολογία Θετικής Κατεύθυνσης, Ημ/νία: 24 Μαΐου 2013 Απαντήσεις Θεμάτων ΘΕΜΑ Α Α1. Βασική μονάδα οργάνωσης αποτελεί το Γ. νουκλεόσωμα

Διαβάστε περισσότερα

ΘΕΜΑ Α Να επιλέξετε τη φράση που συμπληρώνει ορθά κάθε μία από τις ακόλουθες προτάσεις:

ΘΕΜΑ Α Να επιλέξετε τη φράση που συμπληρώνει ορθά κάθε μία από τις ακόλουθες προτάσεις: ΜΑΘΗΜΑ / ΤΑΞΗ: ΒΙΟΛΟΓΙΑ ΟΠ Γ ΛΥΚΕΙΟΥ (ΘΕΡΙΝΑ) ΗΜΕΡΟΜΗΝΙΑ: 22/01/2017 ΕΠΙΜΕΛΕΙΑ ΔΙΑΓΩΝΙΣΜΑΤΟΣ: ΝΟΤΑ ΛΑΖΑΡΑΚΗ ΘΕΜΑ Α Να επιλέξετε τη φράση που συμπληρώνει ορθά κάθε μία από τις ακόλουθες προτάσεις: 1. Από

Διαβάστε περισσότερα

ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ 24 ΜΑΪΟΥ 2013 ΑΠΑΝΤΗΣΕΙΣ ÍÅÏ

ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ 24 ΜΑΪΟΥ 2013 ΑΠΑΝΤΗΣΕΙΣ ÍÅÏ ΘΕΜΑ Α Α1: γ Α2: β Α3: α Α4: δ Α5: α ΘΕΜΑ B ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ 24 ΜΑΪΟΥ 2013 ΑΠΑΝΤΗΣΕΙΣ Β1. Η γονιδιακή θεραπεία εφαρµόστηκε για πρώτη φορά το Σεπτέµβριο του 1990 σε ένα τετράχρονο

Διαβάστε περισσότερα

ΕΠΑΝΑΛΗΠΤΙΚΕΣ ΠΑΝΕΛΛΑΔΙΚΕΣ ΕΞΕΤΑΣΕΙΣ Δ ΤΑΞΗΣ ΕΣΠΕΡΙΝΟΥ ΓΕΝΙΚΟΥ ΛΥΚΕΙΟΥ ΔΕΥΤΕΡΑ 23 ΙΟΥΝΙΟΥ 2014 ΕΞΕΤΑΖΟΜΕΝΟ ΜΑΘΗΜΑ: ΒΙΟΛΟΓΙΑ ΚΑΤΕΥΘΥΝΣΗΣ ΑΠΑΝΤΗΣΕΙΣ

ΕΠΑΝΑΛΗΠΤΙΚΕΣ ΠΑΝΕΛΛΑΔΙΚΕΣ ΕΞΕΤΑΣΕΙΣ Δ ΤΑΞΗΣ ΕΣΠΕΡΙΝΟΥ ΓΕΝΙΚΟΥ ΛΥΚΕΙΟΥ ΔΕΥΤΕΡΑ 23 ΙΟΥΝΙΟΥ 2014 ΕΞΕΤΑΖΟΜΕΝΟ ΜΑΘΗΜΑ: ΒΙΟΛΟΓΙΑ ΚΑΤΕΥΘΥΝΣΗΣ ΑΠΑΝΤΗΣΕΙΣ 1 ΕΠΑΝΑΛΗΠΤΙΚΕΣ ΠΑΝΕΛΛΑΔΙΚΕΣ ΕΞΕΤΑΣΕΙΣ Δ ΤΑΞΗΣ ΕΣΠΕΡΙΝΟΥ ΓΕΝΙΚΟΥ ΛΥΚΕΙΟΥ ΔΕΥΤΕΡΑ 23 ΙΟΥΝΙΟΥ 2014 ΕΞΕΤΑΖΟΜΕΝΟ ΜΑΘΗΜΑ: ΒΙΟΛΟΓΙΑ ΚΑΤΕΥΘΥΝΣΗΣ ΘΕΜΑ Α Α1. γ Α2. β Α3. γ Α4. δ Α5. α ΑΠΑΝΤΗΣΕΙΣ ΘΕΜΑ Β Β1. Σχολικό

Διαβάστε περισσότερα

ΕΝΔΕΙΚΤΙΚΕΣ ΑΠΑΝΤΗΣΕΙΣ

ΕΝΔΕΙΚΤΙΚΕΣ ΑΠΑΝΤΗΣΕΙΣ Επαναληπτικό διαγώνισμα ΒΙΟΛΟΓΙΑΣ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ ΚΕΦΑΛΑΙΑ 1-9 ΗΜΕΡΟΜΗΝΙΑ 1/3/2015 ΕΝΔΕΙΚΤΙΚΕΣ ΑΠΑΝΤΗΣΕΙΣ Σημείωση: η διπλή αρίθμηση στις σελίδες αφορά την παλιά και τη νέα έκδοση του σχολικού βιβλίου

Διαβάστε περισσότερα

ΑΠΟΛΥΤΗΡΙΕΣ ΕΞΕΤΑΣΕΙΣ ΤΗΣ Γ' ΛΥΚΕΙΟΥ ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ

ΑΠΟΛΥΤΗΡΙΕΣ ΕΞΕΤΑΣΕΙΣ ΤΗΣ Γ' ΛΥΚΕΙΟΥ ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ ΑΠΟΛΥΤΗΡΙΕΣ ΕΞΕΤΑΣΕΙΣ ΤΗΣ Γ' ΛΥΚΕΙΟΥ ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ ΟΙ ΛΥΣΕΙΣ ΤΩΝ ΘΕΜΑΤΩΝ ΑΠΟ ΤΟΝ ΚΑΘΗΓΗΤΗ κύριο ΤΡΙΓΚΑ ΓΕΩΡΓΙΟ του ΦΡΟΝΤΙΣΤΗΡΙΟΥ του ΦΡΟΝΤΙΣΤΗΡΙΟΥ www.orion.edu.gr ΘΕΜΑ A A1. γ A2. β A3.

Διαβάστε περισσότερα

ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ ΑΠΑΝΤΗΣΕΙΣ ΣΤΑ ΘΕΜΑΤΑ ΕΞΕΤΑΣΕΩΝ 2011

ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ ΑΠΑΝΤΗΣΕΙΣ ΣΤΑ ΘΕΜΑΤΑ ΕΞΕΤΑΣΕΩΝ 2011 ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ ΑΠΑΝΤΗΣΕΙΣ ΣΤΑ ΘΕΜΑΤΑ ΕΞΕΤΑΣΕΩΝ 2011 ΘΕΜΑ Α Α1. α Α2. δ Α3. γ Α4. β Α5. β ΘΕΜΑ Β Β1. Σελ. 13: Το 1928 ο Griffith χρησιμοποίησε δύο στελέχη του βακτηρίου πνευμονιόκοκκος δεν

Διαβάστε περισσότερα

Γ' ΛΥΚΕΙΟΥ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ ΒΙΟΛΟΓΙΑ ΑΠΑΝΤΗΣΕΙΣ ÏÅÖÅ

Γ' ΛΥΚΕΙΟΥ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ ΒΙΟΛΟΓΙΑ ΑΠΑΝΤΗΣΕΙΣ ÏÅÖÅ 1 Γ' ΛΥΚΕΙΟΥ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ ΒΙΟΛΟΓΙΑ ΘΕΜΑ 1 o 1 Β 2 3 Γ 4 5 Β. ΘΕΜΑ 2 o ΑΠΑΝΤΗΣΕΙΣ Α. Όπως στο σχολικό, σελίδα 20: «Κάθε φυσιολογικό µεταφασικό ως προς τη θέση του κεντροµεριδίου» και σελίδα «Κατά

Διαβάστε περισσότερα

ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ 22 ΜΑΪΟΥ 2015 ΑΠΑΝΤΗΣΕΙΣ

ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ 22 ΜΑΪΟΥ 2015 ΑΠΑΝΤΗΣΕΙΣ ΘΕΜΑ Α Α1. Β Α2. Γ Α3. Α Α4. Α5. Γ ΘΕΜΑ Β ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ 22 ΜΑΪΟΥ 2015 ΑΠΑΝΤΗΣΕΙΣ B1. Α (Σωµατικά κύτταρα στην αρχή της µεσόφασης): 1, 4, 5, 6 Β (Γαµέτες): 2, 3, 7, 8 Β2. (Κάθε

Διαβάστε περισσότερα

Φάσμα. προπαρασκευή για Α.Ε.Ι. & Τ.Ε.Ι.

Φάσμα. προπαρασκευή για Α.Ε.Ι. & Τ.Ε.Ι. σύγχρονο Φάσμα προπαρασκευή για Α.Ε.Ι. & Τ.Ε.Ι. μαθητικό φροντιστήριο 25ης Μαρτίου 111 - ΠΕΤΡΟΥΠΟΛΗ - 210 50 20 990-210 50 27 990 25ης Μαρτίου 74 - ΠΕΤΡΟΥΠΟΛΗ - 210 50 50 658-210 50 60 845 Γραβιάς 85 -

Διαβάστε περισσότερα

Πανελλήνιες Εξετάσεις Ημερήσιων Γενικών Λυκείων. Εξεταζόμενο Μάθημα: Βιολογία Θετικής Κατεύθυνσης, Ημ/νία: 04 Ιουνίου 2014. Απαντήσεις Θεμάτων

Πανελλήνιες Εξετάσεις Ημερήσιων Γενικών Λυκείων. Εξεταζόμενο Μάθημα: Βιολογία Θετικής Κατεύθυνσης, Ημ/νία: 04 Ιουνίου 2014. Απαντήσεις Θεμάτων Πανελλήνιες Εξετάσεις Ημερήσιων Γενικών Λυκείων Εξεταζόμενο Μάθημα: Βιολογία Θετικής Κατεύθυνσης, Ημ/νία: 04 Ιουνίου 2014 Απαντήσεις Θεμάτων ΘΕΜΑ Α A1. Τα πλασμίδια είναι: δ. κυκλικά δίκλωνα μόρια DNA

Διαβάστε περισσότερα

ΜΑΘΗΜΑ / ΤΑΞΗ : ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΟΥ ΠΡΟΣΑΝΑΤΟΛΙΣΜΟΥ / Γ ΙΑΤΡ ΓΘΕΤ 2 ΗΜΕΡΟΜΗΝΙΑ: 20/03/2016 ΘΕΜΑ Α

ΜΑΘΗΜΑ / ΤΑΞΗ : ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΟΥ ΠΡΟΣΑΝΑΤΟΛΙΣΜΟΥ / Γ ΙΑΤΡ ΓΘΕΤ 2 ΗΜΕΡΟΜΗΝΙΑ: 20/03/2016 ΘΕΜΑ Α ΜΑΘΗΜΑ / ΤΑΞΗ : ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΟΥ ΠΡΟΣΑΝΑΤΟΛΙΣΜΟΥ / Γ ΙΑΤΡ ΓΘΕΤ 2 ΗΜΕΡΟΜΗΝΙΑ: 20/03/2016 ΘΕΜΑ Α 1. α 2. δ 3. γ 4. δ 5. γ. ΘΕΜΑ Β 1. Τα αντισώματα αποτελούν το πιο αποτελεσματικό φυσικό φάρμακο για την αντιμετώπιση

Διαβάστε περισσότερα

ΕΞΕΤΑΖΟΜΕΝΟ ΜΑΘΗΜΑ ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ

ΕΞΕΤΑΖΟΜΕΝΟ ΜΑΘΗΜΑ ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ ΕΞΕΤΑΖΟΜΕΝΟ ΜΑΘΗΜΑ ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ ΘΕΜΑ Α Να γράψετε στο τετράδιό σας τον αριθμό καθεμιάς από τις παρακάτω ημιτελείς προτάσεις Α1 έως Α5 και δίπλα το γράμμα που αντιστοιχεί στη λέξη

Διαβάστε περισσότερα

Γ1. Το γνώρισμα για το μέγεθος των φτερών ελέγχεται από αυτοσωμικό γονίδιο.

Γ1. Το γνώρισμα για το μέγεθος των φτερών ελέγχεται από αυτοσωμικό γονίδιο. ΠΑΝΕΛΛΗΝΙΕΣ ΒΙΟΛΟΓΙΑΣ ΚΑΤΕΥΘΥΝΣΗΣ 2013 AΠΑΝΤΗΣΕΙΣ ΘΕΜΑ Α Α1.γ Α2.β Α3.α Α4.δ Α5.α ΘΕΜΑ Β Β1. Η γονιδιακή θεραπεία εφαρμόστηκε για πρώτη φορά το 1990 σε ένα κορίτσι που έπασχε από έλλειψη της απαμινάσης

Διαβάστε περισσότερα

ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ

ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ 24 Μαΐου 2013 ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ Απαντήσεις Θεμάτων Πανελληνίων Εξετάσεων Ημερησίων Γενικών Λυκείων ΘΕΜΑ Α Α1. γ Α2. β Α3. α Α4. δ Α5. α ΘΕΜΑ B B1. Η διαδικασία που εφαρμόστηκε για πρώτη φορά

Διαβάστε περισσότερα

ΕΠΑΝΑΛΗΠΤΙΚΑ ΘΕΜΑΤΑ 2016 B ΦΑΣΗ. ΒΙΟΛΟΓΙΑ Ηµεροµηνία: Τετάρτη 4 Μαΐου 2016 ιάρκεια Εξέτασης: 3 ώρες ΕΚΦΩΝΗΣΕΙΣ ÏÅÖÅ

ΕΠΑΝΑΛΗΠΤΙΚΑ ΘΕΜΑΤΑ 2016 B ΦΑΣΗ. ΒΙΟΛΟΓΙΑ Ηµεροµηνία: Τετάρτη 4 Μαΐου 2016 ιάρκεια Εξέτασης: 3 ώρες ΕΚΦΩΝΗΣΕΙΣ ÏÅÖÅ ΤΑΞΗ: Γ ΓΕΝΙΚΟΥ ΛΥΚΕΙΟΥ ΠΡΟΣΑΝΑΤΟΛΙΣΜΟΣ: ΘΕΤΙΚΩΝ ΣΠΟΥ ΩΝ ΜΑΘΗΜΑ: ΒΙΟΛΟΓΙΑ Ηµεροµηνία: Τετάρτη 4 Μαΐου 2016 ιάρκεια Εξέτασης: 3 ώρες ΘΕΜΑ Α ΕΚΦΩΝΗΣΕΙΣ Να γράψετε στο τετράδιό σας τον αριθµό καθεµιάς από

Διαβάστε περισσότερα

ΘΕΜΑΤΑ ΚΑΙ ΑΠΑΝΤΗΣΕΙΣ ΠΑΝΕΛΛΑΔΙΚΩΝ ΕΞΕΤΑΣΕΩΝ 2013 ΒΙΟΛΟΓΙΑ ΚΑΤΕΥΘΥΝΣΗΣ

ΘΕΜΑΤΑ ΚΑΙ ΑΠΑΝΤΗΣΕΙΣ ΠΑΝΕΛΛΑΔΙΚΩΝ ΕΞΕΤΑΣΕΩΝ 2013 ΒΙΟΛΟΓΙΑ ΚΑΤΕΥΘΥΝΣΗΣ ΒΙΟΛΟΓΙΑ ΚΑΤΕΥΘΥΝΣΗΣ ΘΕΜΑ Α Να γράψετε στο τετράδιό σας τον αριθμό κάθε μίας από τις παρακάτω ημιτελείς προτάσεις Α1 έως Α5 και δίπλα το γράμμα, που αντιστοιχεί στη λέξη ή στη φράση, η οποία συμπληρώνει

Διαβάστε περισσότερα

ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ

ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ 24 Μαΐου 2013 ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ Απαντήσεις Θεμάτων Πανελληνίων Εξετάσεων Ημερησίων Γενικών Λυκείων ΘΕΜΑ Α Α1. γ Α2. β Α3. α Α4. δ Α5. α ΘΕΜΑ B B1. Η διαδικασία που εφαρμόστηκε για πρώτη φορά

Διαβάστε περισσότερα

Η Επιτροπή Παιδείας της ΠΕΒ. Αθήνα, 24/5/2013 ΠΑΝΕΛΛΗΝΙΑ ΕΝΩΣΗ ΒΙΟΕΠΙΣΤΗΜΟΝΩΝ

Η Επιτροπή Παιδείας της ΠΕΒ. Αθήνα, 24/5/2013 ΠΑΝΕΛΛΗΝΙΑ ΕΝΩΣΗ ΒΙΟΕΠΙΣΤΗΜΟΝΩΝ Αθήνα, 24/5/2013 ΠΑΝΕΛΛΗΝΙΑ ΕΝΩΣΗ ΒΙΟΕΠΙΣΤΗΜΟΝΩΝ Σας αποστέλλουµε τις προτεινόµενες απαντήσεις που αφορούν τα θέµατα της Βιολογίας Θετικής Κατεύθυνσης των Ηµερησίων Γενικών Λυκείων και ΕΠΑΛ (Οµάδα Β ).

Διαβάστε περισσότερα

ΑΠΑΝΤΗΣΕΙΣ ΣΤΟ ΚΡΙΤΗΡΙΟ ΑΞΙΟΛΟΓΗΣΗΣ ΣΤΗ: ΒΙΟΛΟΓΙΑ ΠΡΟΣΑΝΑΤΟΛΙΣΜΟΥ ΕΞΕΤΑΣΤΕΑ ΥΛΗ: ΚΕΦΑΛΑΙΑ 1, 2, 4, 5

ΑΠΑΝΤΗΣΕΙΣ ΣΤΟ ΚΡΙΤΗΡΙΟ ΑΞΙΟΛΟΓΗΣΗΣ ΣΤΗ: ΒΙΟΛΟΓΙΑ ΠΡΟΣΑΝΑΤΟΛΙΣΜΟΥ ΕΞΕΤΑΣΤΕΑ ΥΛΗ: ΚΕΦΑΛΑΙΑ 1, 2, 4, 5 ΑΠΑΝΤΗΣΕΙΣ ΣΤΟ ΚΡΙΤΗΡΙΟ ΑΞΙΟΛΟΓΗΣΗΣ ΣΤΗ: ΒΙΟΛΟΓΙΑ ΠΡΟΣΑΝΑΤΟΛΙΣΜΟΥ ΕΞΕΤΑΣΤΕΑ ΥΛΗ: ΚΕΦΑΛΑΙΑ 1, 2, 4, 5 ΦΡΟΝΤΙΣΤΗΡΙΟ: ΚΟΡΥΦΑΙΟ ΗΜΕΡΟΜΗΝΙΑ: ΘΕΜΑ Α Α. 1 Β. 4 Γ. 3 Δ. 2 Ε. 1 ΘΕΜΑ Β Β1. Οι λόγοι που μπορεί να

Διαβάστε περισσότερα

ΠΑΝΕΛΛΗΝΙΕΣ ΕΞΕΤΑΣΕΙΣ ΗΜΕΡΗΣΙΟΥ ΓΕΝΙΚΟΥ ΛΥΚΕΙΟΥ ΚΑΙ ΤΕΤΑΡΤΗ 30 ΜΑΪΟΥ 2012 ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ ΑΠΑΝΤΗΣΕΙΣ

ΠΑΝΕΛΛΗΝΙΕΣ ΕΞΕΤΑΣΕΙΣ ΗΜΕΡΗΣΙΟΥ ΓΕΝΙΚΟΥ ΛΥΚΕΙΟΥ ΚΑΙ ΤΕΤΑΡΤΗ 30 ΜΑΪΟΥ 2012 ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ ΑΠΑΝΤΗΣΕΙΣ ΠΑΝΕΛΛΗΝΙΕΣ ΕΞΕΤΑΣΕΙΣ ΗΜΕΡΗΣΙΟΥ ΓΕΝΙΚΟΥ ΛΥΚΕΙΟΥ ΚΑΙ ΤΕΤΑΡΤΗ 30 ΜΑΪΟΥ 2012 ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ ΑΠΑΝΤΗΣΕΙΣ ΘΕΜΑ Α Α1 α Α2 γ Α3 δ Α4 β Α5 γ ΘΕΜΑ Β Β1. Σελ. 120 σχολ. βιβλίου: «Για την επιλογή οργάνων

Διαβάστε περισσότερα

ΤΕΛΟΣ 1ΗΣ ΑΠΟ 4 ΣΕΛΙ ΕΣ

ΤΕΛΟΣ 1ΗΣ ΑΠΟ 4 ΣΕΛΙ ΕΣ ΑΡΧΗ 1ΗΣ ΣΕΛΙ ΑΣ ΕΙΣΑΓΩΓΙΚΕΣ ΕΞΕΤΑΣΕΙΣ ΤΕΚΝΩΝ ΕΛΛΗΝΩΝ ΤΟΥ ΕΞΩΤΕΡΙΚΟΥ ΚΑΙ ΤΕΚΝΩΝ ΕΛΛΗΝΩΝ ΥΠΑΛΛΗΛΩΝ ΣΤΟ ΕΞΩΤΕΡΙΚΟ ΤΕΤΑΡΤΗ 11 ΣΕΠΤΕΜΒΡΙΟΥ 2013 ΕΞΕΤΑΖΟΜΕΝΟ ΜΑΘΗΜΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ: ΒΙΟΛΟΓΙΑ ΣΥΝΟΛΟ ΣΕΛΙΔΩΝ:

Διαβάστε περισσότερα

ΑΠΑΝΤΗΣΕΙΣ ΒΙΟΛΟΓΙΑ Θετική Κατεύθυνση

ΑΠΑΝΤΗΣΕΙΣ ΒΙΟΛΟΓΙΑ Θετική Κατεύθυνση ΑΠΑΝΤΗΣΕΙΣ ΒΙΟΛΟΓΙΑ Θετική Κατεύθυνση ΘΕΜΑ Α Α1. α Α2. γ Α3. δ Α4. β Α5. γ ΘΕΜΑ Β Β1. Σελίδα 120 σχολικού βιβλίου : «Τα κύτταρα των οργάνων να είναι επιτυχείς.» Β2. Σελίδα 136 σχολικού βιβλίου : «Το 1997

Διαβάστε περισσότερα

ΒΙΟΛΟΓΙΑ ΚΑΤΕΥΘΥΝΣΗΣ ΕΝ ΕΙΚΤΙΚΕΣ ΑΠΑΝΤΗΣΕΙΣ. Β1. Σελ. 123 από «Η γονιδιακή θεραπεία εφαρμόστηκε» έως «ενζυμο ADA»

ΒΙΟΛΟΓΙΑ ΚΑΤΕΥΘΥΝΣΗΣ ΕΝ ΕΙΚΤΙΚΕΣ ΑΠΑΝΤΗΣΕΙΣ. Β1. Σελ. 123 από «Η γονιδιακή θεραπεία εφαρμόστηκε» έως «ενζυμο ADA» 1 ΒΙΟΛΟΓΙΑ ΚΑΤΕΥΘΥΝΣΗΣ ΕΝ ΕΙΚΤΙΚΕΣ ΑΠΑΝΤΗΣΕΙΣ ΘΕΜΑ Α Α1. γ Α2. β Α3. α Α4. δ Α5. α ΘΕΜΑ Β Β1. Σελ. 123 από «Η γονιδιακή θεραπεία εφαρμόστηκε» έως «ενζυμο ADA» Β2. Σελ. 133 από «Διαγονιδιακά ονομάζονται»

Διαβάστε περισσότερα

ΒΙΟΛΟΓΙΑ ΠΡΟΣΑΝΑΤΟΛΙΣΜΟΥ ΘΕΤΙΚΩΝ ΣΠΟΥ ΩΝ 2017 ΑΠΑΝΤΗΣΕΙΣ ËÁÌÉÁ

ΒΙΟΛΟΓΙΑ ΠΡΟΣΑΝΑΤΟΛΙΣΜΟΥ ΘΕΤΙΚΩΝ ΣΠΟΥ ΩΝ 2017 ΑΠΑΝΤΗΣΕΙΣ ËÁÌÉÁ ΘΕΜΑ Α Α1: δ Α2: δ Α3: β Α4: γ Α5: α ΘΕΜΑ Β ΒΙΟΛΟΓΙΑ ΠΡΟΣΑΝΑΤΟΛΙΣΜΟΥ ΘΕΤΙΚΩΝ ΣΠΟΥ ΩΝ 2017 ΑΠΑΝΤΗΣΕΙΣ Β1. Ι Α, ΙΙ Ε, ΙΙΙ ΣΤ, ΙV Β, V Ζ, VII Γ, VII - Β2. Η εικόνα 1 αντιστοιχεί σε προκαρυωτικό κύτταρο. Αυτό

Διαβάστε περισσότερα

ΘΕΜΑ Α Α1. γ Α2. γ Α3. α Α4. β Α5. β ΘΕΜΑ B B1. B2.

ΘΕΜΑ Α Α1. γ Α2. γ Α3. α Α4. β Α5. β ΘΕΜΑ B B1. B2. ΘΕΜΑ Α Α1. γ (το πριμόσωμα) Α2. γ (οι υποκινητές και οι μεταγραφικοί παράγοντες κάθε γονιδίου) Α3. α (μεταφέρει ένα συγκεκριμένο αμινοξύ στο ριβόσωμα) Α4. β (αποδιάταξη των δύο συμπληρωματικών αλυσίδων)

Διαβάστε περισσότερα

ΕΠΑΝΑΛΗΠΤΙΚΑ ΘΕΜΑΤΑ 2016 B ΦΑΣΗ. ΒΙΟΛΟΓΙΑ Ηµεροµηνία: Τετάρτη 4 Μαΐου 2016 ιάρκεια Εξέτασης: 3 ώρες ΑΠΑΝΤΗΣΕΙΣ ÊÏÌÏÔÇÍÇ

ΕΠΑΝΑΛΗΠΤΙΚΑ ΘΕΜΑΤΑ 2016 B ΦΑΣΗ. ΒΙΟΛΟΓΙΑ Ηµεροµηνία: Τετάρτη 4 Μαΐου 2016 ιάρκεια Εξέτασης: 3 ώρες ΑΠΑΝΤΗΣΕΙΣ ÊÏÌÏÔÇÍÇ ΤΑΞΗ: Γ ΓΕΝΙΚΟΥ ΛΥΚΕΙΟΥ ΠΡΟΣΑΝΑΤΟΛΙΣΜΟΣ: ΘΕΤΙΚΩΝ ΣΠΟΥ ΩΝ ΜΑΘΗΜΑ: ΘΕΜΑ Α Α1. β Α2. δ Α3. α Α4. β A5. δ ΘΕΜΑ Β ΒΙΟΛΟΓΙΑ Ηµεροµηνία: Τετάρτη 4 Μαΐου 2016 ιάρκεια Εξέτασης: 3 ώρες ΑΠΑΝΤΗΣΕΙΣ Β1. Σελίδα 32-33

Διαβάστε περισσότερα

ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ ΠΑΝΕΛΛΗΝΙΕΣ ΕΞΕΤΑΣΕΙΣ 2015 ΗΜΕΡΗΣΙΑ ΓΕΝΙΚΑ ΛΥΚΕΙΑ ΚΑΙ ΕΠΑΛ (ΟΜΑ Α Β )

ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ ΠΑΝΕΛΛΗΝΙΕΣ ΕΞΕΤΑΣΕΙΣ 2015 ΗΜΕΡΗΣΙΑ ΓΕΝΙΚΑ ΛΥΚΕΙΑ ΚΑΙ ΕΠΑΛ (ΟΜΑ Α Β ) ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ ΠΑΝΕΛΛΗΝΙΕΣ ΕΞΕΤΑΣΕΙΣ 2015 ΗΜΕΡΗΣΙΑ ΓΕΝΙΚΑ ΛΥΚΕΙΑ ΚΑΙ ΕΠΑΛ (ΟΜΑ Α Β ) ΠΡΟΤΕΙΝΟΜΕΝΕΣ ΑΠΑΝΤΗΣΕΙΣ ΘΕΜΑ Α Α1 β Α2 γ Α3 α Α4 δ Α5 γ ΘΕΜΑ Β Β1: 1 Α 2 Β 3 Β 4 Α 5 Α 6 Α 7 Β 8 Β Β2:

Διαβάστε περισσότερα

ÍÅÏ ÄÕÍÁÌÉÊÏ ÓÔÁÕÑÏÕÐÏËÇ

ÍÅÏ ÄÕÍÁÌÉÊÏ ÓÔÁÕÑÏÕÐÏËÇ 1 ΘΕΜΑ 1 o Γ' ΛΥΚΕΙΟΥ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ ΕΚΦΩΝΗΣΕΙΣ ΒΙΟΛΟΓΙΑ Α. Για τις ερωτήσεις 1 5 να γράψετε στο τετράδιό σας τον αριθµό της ερώτησης και δίπλα του το γράµµα, που αντιστοιχεί στη σωστή απάντηση. 1.

Διαβάστε περισσότερα

ΦΡΟΝΤΙΣΤΗΡΙΟ ΜΕΣΗΣ ΕΚΠΑΙΔΕΥΣΗΣ ΗΡΑΚΛΕΙΤΟΣ ΚΩΛΕΤΤΗ

ΦΡΟΝΤΙΣΤΗΡΙΟ ΜΕΣΗΣ ΕΚΠΑΙΔΕΥΣΗΣ ΗΡΑΚΛΕΙΤΟΣ ΚΩΛΕΤΤΗ ΠΑΝΕΛΛΗΝΙΕΣ ΕΞΕΤΑΣΕΙΣ Γ ΤΑΞΗΣ ΗΜΕΡΗΣΙΟΥ ΓΕΝΙΚΟΥ ΛΥΚΕΙΟΥ ΠΑΡΑΣΚΕΥΗ 16 ΙΟΥΝΙΟΥ 2017 ΕΞΕΤΑΖΟΜΕΝΟ ΜΑΘΗΜΑ: ΒΙΟΛΟΓΙΑ ΠΡΟΣΑΝΑΤΟΛΙΣΜΟΥ Ε Ν Δ Ε Ι Κ Τ Ι Κ Ε Σ Α Π Α Ν Τ Η Σ Ε Ι Σ Θ Ε Μ Α Τ Ω Ν ΘΕΜΑ Α Α1-δ Α2-δ Α3-β

Διαβάστε περισσότερα

ΑΠΑΝΤΗΣΕΙΣ. ΘΕΜΑ Α A1. β Α2. γ Α3. γ Α4. α Α5. δ

ΑΠΑΝΤΗΣΕΙΣ. ΘΕΜΑ Α A1. β Α2. γ Α3. γ Α4. α Α5. δ ΘΕΜΑ Α A1. β Α2. γ Α3. γ Α4. α Α5. δ ΕΠΑΝΑΛΗΠΤΙΚΕΣ ΠΑΝΕΛΛΑΔΙΚΕΣ ΕΞΕΤΑΣΕΙΣ Γ ΤΑΞΗΣ ΗΜΕΡΗΣΙΟΥ ΓΕΝΙΚΟΥ ΛΥΚΕΙΟΥ ΚΑΙ ΕΠΑΛ (ΟΜΑΔΑ Β ) ΤΕΤΑΡΤΗ 15 ΙΟΥΝΙΟΥ 2016 ΕΞΕΤΑΖΟΜΕΝΟ ΜΑΘΗΜΑ: ΒΙΟΛΟΓΙΑ ΠΡΟΣΑΝΑΤΟΛΙΣΜΟΥ (ΝΕΟ

Διαβάστε περισσότερα

Β1. «σελ. 120 σχ. βιβλίου: Για την επιλογή οργάνων συμβατών για μεταμόσχευση» Β2. «σελ. 136 σχ. βιβλίου: Το πρόβατο Dolly κλωνοποίηση θηλαστικών»

Β1. «σελ. 120 σχ. βιβλίου: Για την επιλογή οργάνων συμβατών για μεταμόσχευση» Β2. «σελ. 136 σχ. βιβλίου: Το πρόβατο Dolly κλωνοποίηση θηλαστικών» Βιολογία Κατεύθυνσης Γ Λυκείου Απαντήσεις 2012 Α1. α Α2. γ Α3. δ Α4. β Α5. γ ΘΕΜΑ Β ΘΕΜΑ Α Β1. «σελ. 120 σχ. βιβλίου: Για την επιλογή οργάνων συμβατών για μεταμόσχευση» Β2. «σελ. 136 σχ. βιβλίου: Το πρόβατο

Διαβάστε περισσότερα

ΒΙΟΛΟΓΙΑ ΚΑΤΕΥΘΥΝΣΗΣ

ΒΙΟΛΟΓΙΑ ΚΑΤΕΥΘΥΝΣΗΣ ΘΕΜΑ Α Α1 δ Α2 γ Α3 β Α4 γ Α5 β ΒΙΟΛΟΓΙΑ ΚΑΤΕΥΘΥΝΣΗΣ ΘΕΜΑ Β Β1. 4 2 1 6 3 5 Β2. α. DNA πολυμεράση β. πριμόσωμα γ. DNA δεσμάση δ. DNA ελκάση ε. RNA πολυμεράση Β3. Σχολικό βιβλίο, Σελ.: 98: «Η διάγνωση των

Διαβάστε περισσότερα

Πανελλήνιες Εξετάσεις Ημερήσιων Γενικών Λυκείων. Εξεταζόμενο Μάθημα: Βιολογία Θετικής Κατεύθυνσης, Ημ/νία: 04 Ιουνίου 2014. Απαντήσεις Θεμάτων

Πανελλήνιες Εξετάσεις Ημερήσιων Γενικών Λυκείων. Εξεταζόμενο Μάθημα: Βιολογία Θετικής Κατεύθυνσης, Ημ/νία: 04 Ιουνίου 2014. Απαντήσεις Θεμάτων Πανελλήνιες Εξετάσεις Ημερήσιων Γενικών Λυκείων Εξεταζόμενο Μάθημα: Βιολογία Θετικής Κατεύθυνσης, Ημ/νία: 04 Ιουνίου 2014 Απαντήσεις Θεμάτων ΘΕΜΑ Α A1. Τα πλασμίδια είναι: δ. κυκλικά δίκλωνα μόρια DNA

Διαβάστε περισσότερα

ΟΜΟΣΠΟΝ ΙΑ ΕΚΠΑΙ ΕΥΤΙΚΩΝ ΦΡΟΝΤΙΣΤΩΝ ΕΛΛΑ ΟΣ (Ο.Ε.Φ.Ε.) ΕΠΑΝΑΛΗΠΤΙΚΑ ΘΕΜΑΤΑ ΕΠΑΝΑΛΗΠΤΙΚΑ ΘΕΜΑΤΑ 2013 ÁÍÅËÉÎÇ

ΟΜΟΣΠΟΝ ΙΑ ΕΚΠΑΙ ΕΥΤΙΚΩΝ ΦΡΟΝΤΙΣΤΩΝ ΕΛΛΑ ΟΣ (Ο.Ε.Φ.Ε.) ΕΠΑΝΑΛΗΠΤΙΚΑ ΘΕΜΑΤΑ ΕΠΑΝΑΛΗΠΤΙΚΑ ΘΕΜΑΤΑ 2013 ÁÍÅËÉÎÇ ΤΑΞΗ: ΚΑΤΕΥΘΥΝΣΗ: ΜΑΘΗΜΑ: Γ ΓΕΝΙΚΟΥ ΛΥΚΕΙΟΥ ΘΕΤΙΚΗ ΒΙΟΛΟΓΙΑ Ηµεροµηνία: Κυριακή 28 Απριλίου 2013 ιάρκεια Εξέτασης: 3 ώρες ΕΚΦΩΝΗΣΕΙΣ ΘΕΜΑ Α Να γράψετε στο τετράδιό σας τον αριθµό καθεµιάς από τις παρακάτω

Διαβάστε περισσότερα

Γ' ΛΥΚΕΙΟΥ ΘΕΤΙΚΗ ΚΑΤΕΥΘΥΝΣΗ ΒΙΟΛΟΓΙΑ ΑΠΑΝΤΗΣΕΙΣ ÏÅÖÅ

Γ' ΛΥΚΕΙΟΥ ΘΕΤΙΚΗ ΚΑΤΕΥΘΥΝΣΗ ΒΙΟΛΟΓΙΑ ΑΠΑΝΤΗΣΕΙΣ ÏÅÖÅ 1 Γ' ΛΥΚΕΙΟΥ ΘΕΤΙΚΗ ΚΑΤΕΥΘΥΝΣΗ ΒΙΟΛΟΓΙΑ ΘΕΜΑ 1 ο Α. 1 - Γ 2 - Β 3-4 - Γ 5 - Β. 1 - Σ 2 - Λ 3 - Λ 4 - Λ 5 - Σ ΘΕΜΑ 2 ο ΑΠΑΝΤΗΣΕΙΣ 1. Κάθε είδος αντισώµατος που αναγνωρίζει έναν αντιγονικό καθοριστή παράγεται

Διαβάστε περισσότερα

ÖÑÏÍÔÉÓÔÇÑÉÏ ÈÅÙÑÇÔÉÊÏ ÊÅÍÔÑÏ ÁÈÇÍÁÓ - ÐÁÔÇÓÉÁ

ÖÑÏÍÔÉÓÔÇÑÉÏ ÈÅÙÑÇÔÉÊÏ ÊÅÍÔÑÏ ÁÈÇÍÁÓ - ÐÁÔÇÓÉÁ ΘΕΜΑ 1 ο ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ 2009 ΕΚΦΩΝΗΣΕΙΣ Να γράψετε στο τετράδιό σας τον αριθµό καθεµιάς από τις παρακάτω ηµιτελείς προτάσεις 1 έως 5 και δίπλα το γράµµα που αντιστοιχεί στη λέξη ή τη φράση,

Διαβάστε περισσότερα

Παρασκευή, 22 Μαΐου 2009 Γ ΛΥΚΕΙΟΥ ΚΑΤΕΥΘΥΝΣΗΣ ΒΙΟΛΟΓΙΑ

Παρασκευή, 22 Μαΐου 2009 Γ ΛΥΚΕΙΟΥ ΚΑΤΕΥΘΥΝΣΗΣ ΒΙΟΛΟΓΙΑ Παρασκευή, 22 Μαΐου 2009 Γ ΛΥΚΕΙΟΥ ΚΑΤΕΥΘΥΝΣΗΣ ΒΙΟΛΟΓΙΑ ΘΕΜΑ 1o Να γράψετε στο τετράδιο σας τον αριθμό καθεμιάς από τις παρακάτω ημιτελείς προτάσεις 1 έως 5 και δίπλα το γράμμα που αντιστοιχεί στη λέξη

Διαβάστε περισσότερα

Θετικών Σπουδών. Ενδεικτικές απαντήσεις θεμάτων

Θετικών Σπουδών. Ενδεικτικές απαντήσεις θεμάτων Πανελλαδικές Εξετάσεις Ημερήσιων Γενικών Λυκείων Εξεταζόμενο μάθημα: Βιολογία Προσανατολισμού Θετικών Σπουδών Παρασκευή, 16 Ιουνίου 2017 Ενδεικτικές απαντήσεις θεμάτων Θέμα Α Α1. α) 3 CAT 5 β) 3 TAC 5

Διαβάστε περισσότερα

σύγχρονο προπαρασκευή για Α.Ε.Ι. & Τ.Ε.Ι. & Group µαθητικό φροντιστήριο Γραβιάς 85 ΚΗΠΟΥΠΟΛΗ

σύγχρονο προπαρασκευή για Α.Ε.Ι. & Τ.Ε.Ι. & Group µαθητικό φροντιστήριο Γραβιάς 85 ΚΗΠΟΥΠΟΛΗ σύγχρονο Φάσµα & Group προπαρασκευή για Α.Ε.Ι. & Τ.Ε.Ι. µαθητικό φροντιστήριο Γραβιάς 85 ΚΗΠΟΥΠΟΛΗ 210 50 51 557 210 50 56 296 25ης Μαρτίου 111 ΠΕΤΡΟΥΠΟΛΗ 210 50 20 990 210 50 27 990 25ης Μαρτίου 74 ΠΕΤΡΟΥΠΟΛΗ

Διαβάστε περισσότερα

ΑΡΧΗ 1ΗΣ ΣΕΛΙ ΑΣ Γ ΗΜΕΡΗΣΙΩΝ

ΑΡΧΗ 1ΗΣ ΣΕΛΙ ΑΣ Γ ΗΜΕΡΗΣΙΩΝ ΑΡΧΗ 1ΗΣ ΣΕΛΙ ΑΣ Γ ΗΜΕΡΗΣΙΩΝ ΠΑΝΕΛΛΑΔΙΚΕΣ ΕΞΕΤΑΣΕΙΣ Γ ΤΑΞΗΣ ΗΜΕΡΗΣΙΟΥ ΓΕΝΙΚΟΥ ΛΥΚΕΙΟΥ ΚΑΙ ΕΠΑΛ (ΟΜΑΔΑ Β ) ΠΑΡΑΣΚΕΥΗ 24 ΜΑΪΟΥ 2013 - ΕΞΕΤΑΖΟΜΕΝΟ ΜΑΘΗΜΑ: ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ ΣΥΝΟΛΟ ΣΕΛΙΔΩΝ: ΤΕΣΣΕΡΙΣ

Διαβάστε περισσότερα

Βιολογία προσανατολισμού

Βιολογία προσανατολισμού Βιολογία προσανατολισμού Α. 1. β. 2. γ. 3. γ. 4. α. 5. δ. ΘΕΜΑ Α ΘΕΜΑ Β Β1. Σχολικό βιβλίο σελ. 131 «Το βακτήριο... στο σώμα των φυτών.» Β2.1 Ε, 2 Δ, 3 Α, 4 Β Β3. Σχολικό βιβλίο σελ. 108 «Η θερμοκρασία..

Διαβάστε περισσότερα

ΘΕΩΡΗΤΙΚΟ ΦΡΟΝΤΙΣΤΗΡΙΟ

ΘΕΩΡΗΤΙΚΟ ΦΡΟΝΤΙΣΤΗΡΙΟ ΘΕΜΑ Α Α1. β Α2. γ Α3. α Α4. δ Α5. γ ΘΕΜΑ Β Β1. ΠΑΝΕΛΛΑΔΙΚΕΣ ΕΞΕΤΑΣΕΙΣ Γ ΤΑΞΗΣ ΗΜΕΡΗΣΙΟΥ ΓΕΝΙΚΟΥ ΛΥΚΕΙΟΥ ΚΑΙ ΕΠΑΛ (ΟΜΑΔΑ Β ) ΠΑΡΑΣΚΕΥΗ 22 ΜΑΪΟΥ 2015 ΕΞΕΤΑΖΟΜΕΝΟ ΜΑΘΗΜΑ: ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ 1.

Διαβάστε περισσότερα

ΠΑΝΕΛΛΗΝΙΕΣ Απαντήσεις Βιολογίας κατεύθυνσης (ΕΠΑΝΑΛΛΗΠΤΙΚΕΣ ΗΜΕΡΗΣΙΟ)

ΠΑΝΕΛΛΗΝΙΕΣ Απαντήσεις Βιολογίας κατεύθυνσης (ΕΠΑΝΑΛΛΗΠΤΙΚΕΣ ΗΜΕΡΗΣΙΟ) ΠΑΝΕΛΛΗΝΙΕΣ 2016 Απαντήσεις Βιολογίας κατεύθυνσης (ΕΠΑΝΑΛΛΗΠΤΙΚΕΣ ΗΜΕΡΗΣΙΟ) Μιχάλης Χαλικιόπουλος ΘΕΜΑ Α Α1 β Α2 γ Α3 γ Α4 α Α5 δ ΘΕΜΑ Β Β1. Το βακτήριο Agrobacterium tumefaciens, το οποίο ζει στο έδαφος,

Διαβάστε περισσότερα

ΘΕΜΑ Α Α1. α, Α2. γ, Α3. δ, Α4. β, Α5. γ ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ (30-05-2012) ΑΠΑΝΤΗΣΕΙΣ ΘΕΜΑ Β Β1. Σελ.120 Τα µονοκλωνικά αντισώµατα χρησιµοποιούνται για την επιλογή οργάνων συµβατών για µεταµόσχευση.

Διαβάστε περισσότερα

ΑΠΑΝΤΗΣΕΙΣ ΘΕΜΑΤΩΝ ΒΙΟΛΟΓΙΑΣ ΚΑΤΕΥΘΥΝΣΗΣ ΖΗΤΗΜΑ 1 Ο 1. δ 2. δ 3. δ 4. β 5. δ

ΑΠΑΝΤΗΣΕΙΣ ΘΕΜΑΤΩΝ ΒΙΟΛΟΓΙΑΣ ΚΑΤΕΥΘΥΝΣΗΣ ΖΗΤΗΜΑ 1 Ο 1. δ 2. δ 3. δ 4. β 5. δ ΑΠΑΝΤΗΣΕΙΣ ΘΕΜΑΤΩΝ ΒΙΟΛΟΓΙΑΣ ΚΑΤΕΥΘΥΝΣΗΣ 2008 ΖΗΤΗΜΑ 1 Ο 1. δ 2. δ 3. δ 4. β 5. δ ΖΗΤΗΜΑ 2 Ο 1. Σχολ. βιβλ. σελ. 41-42 : «Η ρύθµιση της έκφρασης των γονιδίων στα ευκαρυωτικά κύτταρα.µπορεί να υποστεί τροποποιήσεις

Διαβάστε περισσότερα

ΑΡΧΗ 1ΗΣ ΣΕΛΙΔΑΣ Γ ΗΜΕΡΗΣΙΩΝ

ΑΡΧΗ 1ΗΣ ΣΕΛΙΔΑΣ Γ ΗΜΕΡΗΣΙΩΝ ΑΡΧΗ 1ΗΣ ΣΕΛΙΔΑΣ Γ ΗΜΕΡΗΣΙΩΝ ΕΠΑΝΑΛΗΠΤΙΚΕΣ ΠΑΝΕΛΛΑΔΙΚΕΣ ΕΞΕΤΑΣΕΙΣ Γ ΤΑΞΗΣ ΗΜΕΡΗΣΙΟΥ ΓΕΝΙΚΟΥ ΛΥΚΕΙΟΥ ΔΕΥΤΕΡΑ 23 ΙΟΥΝΙΟΥ 2014 ΕΞΕΤΑΖΟΜΕΝΟ ΜΑΘΗΜΑ: ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ ΣΥΝΟΛΟ ΣΕΛΙΔΩΝ: ΠΕΝΤΕ (5) ΘΕΜΑ

Διαβάστε περισσότερα

ΠΑΝΕΛΛΑΔΙΚΕΣ ΕΞΕΤΑΣΕΙΣ Γ ΤΑΞΗΣ ΗΜΕΡΗΣΙΟΥ ΓΕΝΙΚΟΥ ΛΥΚΕΙΟΥ ΚΑΙ ΕΠΑΛ (ΟΜΑΔΑ Β ) ΠΑΡΑΣΚΕΥΗ 24 ΜΑΪΟΥ ΕΞΕΤΑΖΟΜΕΝΟ ΜΑΘΗΜΑ:

ΠΑΝΕΛΛΑΔΙΚΕΣ ΕΞΕΤΑΣΕΙΣ Γ ΤΑΞΗΣ ΗΜΕΡΗΣΙΟΥ ΓΕΝΙΚΟΥ ΛΥΚΕΙΟΥ ΚΑΙ ΕΠΑΛ (ΟΜΑΔΑ Β ) ΠΑΡΑΣΚΕΥΗ 24 ΜΑΪΟΥ ΕΞΕΤΑΖΟΜΕΝΟ ΜΑΘΗΜΑ: ΠΑΝΕΛΛΑΔΙΚΕΣ ΕΞΕΤΑΣΕΙΣ Γ ΤΑΞΗΣ ΗΜΕΡΗΣΙΟΥ ΓΕΝΙΚΟΥ ΛΥΚΕΙΟΥ ΚΑΙ ΕΠΑΛ (ΟΜΑΔΑ Β ) ΠΑΡΑΣΚΕΥΗ 24 ΜΑΪΟΥ 2013 - ΕΞΕΤΑΖΟΜΕΝΟ ΜΑΘΗΜΑ: ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ ΑΠΑΝΤΗΣΕΙΣ Θέμα Α. Α.1. γ. Α.2. β. Α.3. α. Α.4. δ.

Διαβάστε περισσότερα

Με τον εμβολιασμό προστίθενται στο θρεπτικό υλικό μιας καλλιέργειας πρωτεΐνες πλασμίδια αντισώματα δ. μικροοργανισμοί

Με τον εμβολιασμό προστίθενται στο θρεπτικό υλικό μιας καλλιέργειας πρωτεΐνες πλασμίδια αντισώματα δ. μικροοργανισμοί ΠΑΝΕΛΛΑΔΙΚΕΣ ΕΞΕΤΑΣΕΙΣ Γ' ΤΑΞΗΣ ΗΜΕΡΗΣΙΟΥ ΓΕΝΙΚΟΥ ΛΥΚΕΙΟΥ ΚΑΙ ΕΠΑΛ (ΟΜΑΔΑ Β') ΠΑΡΑΣΚΕΥΗ 24 ΜΑΪΟΥ 2013 ΕΞΕΤΑΖΟΜΕΝΟ ΜΑΘΗΜΑ: ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ ΘΕΜΑ Α Να γράψετε στο τετράδιό σας τον αριθμό κάθε

Διαβάστε περισσότερα

ΦΡΟΝΤΙΣΤΗΡΙΑ ΜΕΤΑΒΑΣΗ

ΦΡΟΝΤΙΣΤΗΡΙΑ ΜΕΤΑΒΑΣΗ ΘΕΜΑ 1 Ο ΑΠΑΝΤΗΣΕΙΣ ΒΙΟΛΟΓΙΑ ΚΑΤ 2002 Α. 1. γ 2. β Β. 1. (Σελ. 36 σχολικού βιβλίου: «Η αλληλουχία βάσεων ενός γονιδίου.ενώ το κωδικόνιο λήξης όχι»). 2. Ζύµωση είναι η διαδικασία ανάπτυξης µικροοργανισµών

Διαβάστε περισσότερα

ΘΕΜΑ Α. Α1 δ Α2 γ Α3 β Α4 γ Α5 β ΘΕΜΑ Β 3-2 - 5-1 - 6-4. α-dna πολυμεράση β-πριμόσημα γ- DNA δεσμάση δ- DNA ελικάση ε- RNA πολυμεράση

ΘΕΜΑ Α. Α1 δ Α2 γ Α3 β Α4 γ Α5 β ΘΕΜΑ Β 3-2 - 5-1 - 6-4. α-dna πολυμεράση β-πριμόσημα γ- DNA δεσμάση δ- DNA ελικάση ε- RNA πολυμεράση ΠΑΝΕΛΛΑΔΙΚΕΣ ΕΞΕΤΑΣΕΙΣ Γ ΤΑΞΗΣ ΗΜΕΡΗΣΙΟΥ ΓΕΝΙΚΟΥ ΛΥΚΕΙΟΥ ΚΑΙ ΕΠΑΛ (ΟΜΑΔΑ Β ) Τετάρτη, 4 Ιουνίου 2014 - ΕΞΕΤΑΖΟΜΕΝΟ ΜΑΘΗΜΑ: ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗ ΚΑΤΕΥΘΥΝΣΗΣ ΑΠΑΝΤΗΣΕΙΣ ΘΕΜΑ Α Α1 δ Α2 γ Α3 β Α4 γ Α5 β ΘΕΜΑ Β

Διαβάστε περισσότερα

ΑΠΑΝΤΗΣΕΙΣ. Επιµέλεια: Οµάδα Βιολόγων της Ώθησης

ΑΠΑΝΤΗΣΕΙΣ. Επιµέλεια: Οµάδα Βιολόγων της Ώθησης ΑΠΑΝΤΗΣΕΙΣ Επιµέλεια: Οµάδα Βιολόγων της Ώθησης 1 Τετάρτη, 18 Μαΐου 2011 Γ ΛΥΚΕΙΟΥ ΚΑΤΕΥΘΥΝΣΗΣ ΒΙΟΛΟΓΙΑ ΘΕΜΑ Α Να γράψετε στο τετράδιό σας τον αριθμό καθεμιάς από τις παρακάτω ημιτελείς προτάσεις Α1 έως

Διαβάστε περισσότερα

ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ Θέµα 1 ο

ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ Θέµα 1 ο ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ Θέµα 1 ο Α. Να σηµειώσετε τη σωστή απάντηση: 1. Ο γονότυπος των φυσιολογικών γονιών ενός ατόµου που έχει σύνδροµο Kleinefelter και πάσχει από αιµορροφιλία είναι :

Διαβάστε περισσότερα

ΠΑΝΕΛΛΑΔΙΚΕΣ ΕΞΕΤΑΣΕΙΣ 2013 Γ ΤΑΞΗΣ ΗΜΕΡΗΣΙΟΥ ΓΕΝΙΚΟΥ ΛΥΚΕΙΟΥ ΠΑΡΑΣΚΕΥΗ 24 ΜΑΪΟΥ 2013 ΕΞΕΤΑΖΟΜΕΝΟ ΜΑΘΗΜΑ: ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ ΑΠΑΝΤΗΣΕΙΣ

ΠΑΝΕΛΛΑΔΙΚΕΣ ΕΞΕΤΑΣΕΙΣ 2013 Γ ΤΑΞΗΣ ΗΜΕΡΗΣΙΟΥ ΓΕΝΙΚΟΥ ΛΥΚΕΙΟΥ ΠΑΡΑΣΚΕΥΗ 24 ΜΑΪΟΥ 2013 ΕΞΕΤΑΖΟΜΕΝΟ ΜΑΘΗΜΑ: ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ ΑΠΑΝΤΗΣΕΙΣ ΠΑΝΕΛΛΑΔΙΚΕΣ ΕΞΕΤΑΣΕΙΣ 2013 Γ ΤΑΞΗΣ ΗΜΕΡΗΣΙΟΥ ΓΕΝΙΚΟΥ ΛΥΚΕΙΟΥ ΠΑΡΑΣΚΕΥΗ 24 ΜΑΪΟΥ 2013 ΕΞΕΤΑΖΟΜΕΝΟ ΜΑΘΗΜΑ: ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ ΑΠΑΝΤΗΣΕΙΣ ΘΕΜΑ Α Α.1. γ Α.2. β Α.3. α Α.4. δ Α.5. α ΘΕΜΑ Β Β.1. Σελ.

Διαβάστε περισσότερα

Πανελλαδικές εξετάσεις Γ Τάξης Ημερήσιου Γενικού Λυκείου Βιολογία Κατεύθυνσης 24 Μαΐου 2013

Πανελλαδικές εξετάσεις Γ Τάξης Ημερήσιου Γενικού Λυκείου Βιολογία Κατεύθυνσης 24 Μαΐου 2013 Πανελλαδικές εξετάσεις Γ Τάξης Ημερήσιου Γενικού Λυκείου Βιολογία Κατεύθυνσης 24 Μαΐου 2013 ΘΕΜΑ Α Α1.γ Α2.β Α3.α Α4.δ Α5.α ΘΕΜΑ Β Β1. «Η γονιδιακή θεραπεία εφαρμόστηκε για πρώτη φορά τροποποιούνται έξω

Διαβάστε περισσότερα

ΟΜΟΣΠΟΝ ΙΑ ΕΚΠΑΙ ΕΥΤΙΚΩΝ ΦΡΟΝΤΙΣΤΩΝ ΕΛΛΑ ΟΣ (Ο.Ε.Φ.Ε.) ΕΠΑΝΑΛΗΠΤΙΚΑ ΘΕΜΑΤΑ ΕΠΑΝΑΛΗΠΤΙΚΑ ΘΕΜΑΤΑ 2016 Α ΦΑΣΗ

ΟΜΟΣΠΟΝ ΙΑ ΕΚΠΑΙ ΕΥΤΙΚΩΝ ΦΡΟΝΤΙΣΤΩΝ ΕΛΛΑ ΟΣ (Ο.Ε.Φ.Ε.) ΕΠΑΝΑΛΗΠΤΙΚΑ ΘΕΜΑΤΑ ΕΠΑΝΑΛΗΠΤΙΚΑ ΘΕΜΑΤΑ 2016 Α ΦΑΣΗ ΤΑΞΗ: Γ ΓΕΝΙΚΟΥ ΛΥΚΕΙΟΥ ΠΡΟΣΑΝΑΤΟΛΙΣΜΟΣ: ΘΕΤΙΚΩΝ ΣΠΟΥ ΩΝ ΜΑΘΗΜΑ: ΒΙΟΛΟΓΙΑ Ηµεροµηνία: Πέµπτη 7 Ιανουαρίου 2016 ιάρκεια Εξέτασης: 3 ώρες ΘΕΜΑ Α Α1 γ, Α2 β, Α3 γ, Α4 δ, Α5 - β ΘΕΜΑ Β ΑΠΑΝΤΗΣΕΙΣ Β1. α. Το

Διαβάστε περισσότερα

ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ

ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ 11 Ιουνίου 2015 ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ Απαντήσεις Θεμάτων Επαναληπτικών Πανελληνίων Εξετάσεων Ημερησίων & Εσπερινών Γενικών Λυκείων ΘΕΜΑ Α Α1. β Α2. γ Α3. α Α4. γ Α5. δ ΘΕΜΑ B Β1. 1. Β 2. Γ 3. Α

Διαβάστε περισσότερα

ΚΡΙΤΗΡΙΟ ΑΞΙΟΛΟΓΗΣΗΣ ΣΤΗ: ΒΙΟΛΟΓΙΑ ΠΡΟΣΑΝΑΤΟΛΙΣΜΟΥ ΕΞΕΤΑΣΤΕΑ ΥΛΗ: ΚΕΦΑΛΑΙΑ 1, 2, 4, 5

ΚΡΙΤΗΡΙΟ ΑΞΙΟΛΟΓΗΣΗΣ ΣΤΗ: ΒΙΟΛΟΓΙΑ ΠΡΟΣΑΝΑΤΟΛΙΣΜΟΥ ΕΞΕΤΑΣΤΕΑ ΥΛΗ: ΚΕΦΑΛΑΙΑ 1, 2, 4, 5 ΚΡΙΤΗΡΙΟ ΑΞΙΟΛΟΓΗΣΗΣ ΣΤΗ: ΒΙΟΛΟΓΙΑ ΠΡΟΣΑΝΑΤΟΛΙΣΜΟΥ ΕΞΕΤΑΣΤΕΑ ΥΛΗ: ΚΕΦΑΛΑΙΑ 1, 2, 4, 5 ΦΡΟΝΤΙΣΤΗΡΙΟ: ΚΟΡΥΦΑΙΟ ΗΜΕΡΟΜΗΝΙΑ: ΟΝΟΜΑΤΕΠΩΝΥΜΟ ΕΞΕΤΑΖΟΜΕΝΟΥ:. ΣΥΝΟΛΟ ΣΕΛΙΔΩΝ: ΠΕΝΤΕ (5) ΘΕΜΑ 1 ο Στις ερωτήσεις Α

Διαβάστε περισσότερα

ΑΠΑΝΤΗΣΕΙΣ. ΘΕΜΑ Α Α1. β Α2. γ Α3. γ Α4. α Α5. δ

ΑΠΑΝΤΗΣΕΙΣ. ΘΕΜΑ Α Α1. β Α2. γ Α3. γ Α4. α Α5. δ ΘΕΜΑ Α Α1. β Α2. γ Α3. γ Α4. α Α5. δ 1 ΕΙΣΑΓΩΓΙΚΕΣ ΕΞΕΤΑΣΕΙΣ ΤΕΚΝΩΝ ΕΛΛΗΝΩΝ ΤΟΥ ΕΞΩΤΕΡΙΚΟΥ ΚΑΙ ΤΕΚΝΩΝ ΕΛΛΗΝΩΝ ΥΠΑΛΛΗΛΩΝ ΣΤΟ ΕΞΩΤΕΡΙΚΟ ΤΕΤΑΡΤΗ 15 ΣΕΠΤΕΜΒΡΙΟΥ 2010 ΕΞΕΤΑΖΟΜΕΝΟ ΜΑΘΗΜΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ:

Διαβάστε περισσότερα

Γ' ΛΥΚΕΙΟΥ ΘΕΤΙΚΗ ΚΑΤΕΥΘΥΝΣΗ ΒΙΟΛΟΓΙΑ ΑΠΑΝΤΗΣΕΙΣ ÏÅÖÅ

Γ' ΛΥΚΕΙΟΥ ΘΕΤΙΚΗ ΚΑΤΕΥΘΥΝΣΗ ΒΙΟΛΟΓΙΑ ΑΠΑΝΤΗΣΕΙΣ ÏÅÖÅ 1 Γ' ΛΥΚΕΙΟΥ ΘΕΤΙΚΗ ΚΑΤΕΥΘΥΝΣΗ ΒΙΟΛΟΓΙΑ ΘΕΜΑ 1 ο 1 γ 2 δ 3 β 4 α 5 γ ΘΕΜΑ 2 ο ΑΠΑΝΤΗΣΕΙΣ Μονάδες 25 (5Χ5) Α. ιαγονιδιακά ζώα ονοµάζονται εκείνα στα οποία το γενετικό τους υλικό έχει τροποποιηθεί µε την

Διαβάστε περισσότερα

ΘΕΜΑ Α Να επιλέξετε την φράση που συμπληρώνει ορθά κάθε μία από τις ακόλουθες προτάσεις:

ΘΕΜΑ Α Να επιλέξετε την φράση που συμπληρώνει ορθά κάθε μία από τις ακόλουθες προτάσεις: ΜΑΘΗΜΑ / ΤΑΞΗ : ΒΙΟΛΟΓΙΑ ΟΠ ΘΕΤΙΚΩΝ ΣΠΟΥΔΩΝ / Γ ΛΥΚΕΙΟΥ (ΘΕΡΙΝΑ) ΣΕΙΡΑ: ΗΜΕΡΟΜΗΝΙΑ: 15/11/2015 ΘΕΜΑ Α Να επιλέξετε την φράση που συμπληρώνει ορθά κάθε μία από τις ακόλουθες προτάσεις: 1. Δεοξυριβονουκλεοτίδια

Διαβάστε περισσότερα

ΠΑΝΕΛΛΑΔΙΚΕΣ ΕΞΕΤΑΣΕΙΣ

ΠΑΝΕΛΛΑΔΙΚΕΣ ΕΞΕΤΑΣΕΙΣ ΒΙΟΛΟΓΙΑ ΘΕΜΑ Α Θετικής κατεύθυνσης Α1. δ Α2. γ Α3. β Α4. γ Α5. β ΘΕΜΑ Β Β1. Η σωστή σειρά είναι: 4 2 1 6 3 5 Β2. α. DNA πολυμεράση β. πριμόσωμα γ. DNA δεσμάση δ. DNA ελικάσες ε. RNA πολυμεράση Β3. Σχολικό

Διαβάστε περισσότερα

ΜΑΘΗΜΑ / ΤΑΞΗ : ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΟΥ ΠΡΟΣΑΝΑΤΟΛΙΣΜΟΥ // Γ γ ΙΑΤΡ λυκείου Γ ΘΕΤ2 ΗΜΕΡΟΜΗΝΙΑ: 29/12/

ΜΑΘΗΜΑ / ΤΑΞΗ : ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΟΥ ΠΡΟΣΑΝΑΤΟΛΙΣΜΟΥ // Γ γ ΙΑΤΡ λυκείου Γ ΘΕΤ2 ΗΜΕΡΟΜΗΝΙΑ: 29/12/ ΜΑΘΗΜΑ / ΤΑΞΗ : ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΟΥ ΠΡΟΣΑΝΑΤΟΛΙΣΜΟΥ // Γ γ ΙΑΤΡ λυκείου Γ ΘΕΤ2 ΗΜΕΡΟΜΗΝΙΑ: 29/12/2015 29 12 2016 ΘΕΜΑ 1 ο Επιλέξτε τη σωστή απάντηση που συμπληρώνει τις παρακάτω προτάσεις: 1. Η περιοριστική

Διαβάστε περισσότερα

ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ

ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ ΘΕΜΑ Α ΠΡΟΤΕΙΝΟΜΕΝΕΣ ΑΠΑΝΤΗΣΕΙΣ Α1. α Α2. γ Α3. δ Α4. β Α5. γ ΘΕΜΑ Β Β1. Σελ. 120 «Τα κύτταρα των οργάνων να είναι επιτυχείς» Β2. Σελ. 136 «Το 1997 γέννησε την Dolly»

Διαβάστε περισσότερα

ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ

ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ ΠΕΙΡΑΜΑΤΙΚΟ ΕΝΙΑΙΟ ΛΥΚΕΙΟ ΠΑΝΕΠΙΣΤΗΜΙΟΥ ΜΑΚΕΔΟΝΙΑΣ ZAΡΦΤΖΙΑΝ ΜΑΡΙΛΕΝΑ ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ ΑΣΚΗΣΕΙΣ ΕΡΩΤΗΣΕΙΣ 4 ου ΚΕΦΑΛΑΙΟΥ 1.Τα παρακάτω στοιχεία να μπουν στην κατάλληλη στήλη ( ΣΥΓΚΡΙΣΗ ΓΟΝΙΔΙΩΜΑΤΙΚΗΣ

Διαβάστε περισσότερα

ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ ΑΠΑΝΤΗΣΕΙΣ ΣΤΑ ΘΕΜΑΤΑ ΕΞΕΤΑΣΕΩΝ 2013

ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ ΑΠΑΝΤΗΣΕΙΣ ΣΤΑ ΘΕΜΑΤΑ ΕΞΕΤΑΣΕΩΝ 2013 ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ ΑΠΑΝΤΗΣΕΙΣ ΣΤΑ ΘΕΜΑΤΑ ΕΞΕΤΑΣΕΩΝ 2013 ΘΕΜΑ Α Α1 Α2 Α3 Α4 Α5 γ β α δ α ΘΕΜΑ Β Β1 Σελ. 123-124: «Η διαδικασία που ακολουθείται στη γονιδιακή θεραπεία της ανεπάρκειας του ανοσοποιητικού

Διαβάστε περισσότερα

ΒΙΟΛΟΓΙΑ ΠΡΟΣΑΝΑΤΟΛΙΣΜΟΥ Γ ΛΥΚΕΙΟΥ ΘΕΜΑ Α. Α1. δ. Α2. δ. Α3. β. Α4. γ. Α5. α ΘΕΜΑ Β. Β1. I A. φωσφορική ομάδα. Ε. υδροξύλιο. ΣΤ. αμινομάδα. Β.

ΒΙΟΛΟΓΙΑ ΠΡΟΣΑΝΑΤΟΛΙΣΜΟΥ Γ ΛΥΚΕΙΟΥ ΘΕΜΑ Α. Α1. δ. Α2. δ. Α3. β. Α4. γ. Α5. α ΘΕΜΑ Β. Β1. I A. φωσφορική ομάδα. Ε. υδροξύλιο. ΣΤ. αμινομάδα. Β. ΜΑΘΗΜΑ: ΒΙΟΛΟΓΙΑ ΠΡΟΣΑΝΑΤΟΛΙΣΜΟΥ Γ ΛΥΚΕΙΟΥ ΘΕΜΑ Α Α1. δ Α2. δ Α3. β Α4. γ Α5. α ΘΕΜΑ Β Β1. I A. φωσφορική ομάδα II III IV V VI VII Ε. υδροξύλιο ΣΤ. αμινομάδα Β. mrna Ζ. RNA πολυμεράση Γ. μεταγραφόμενη

Διαβάστε περισσότερα

θέσεις που κόβουν οι περιοριστικές ενδονουκλεάσες, στον αριθμό των πλασμιδίων που θα χρειαστούν κλπ

θέσεις που κόβουν οι περιοριστικές ενδονουκλεάσες, στον αριθμό των πλασμιδίων που θα χρειαστούν κλπ ΜΕΘΟΔΟΛΟΓΙΑ ΑΣΚΗΣΕΩΝ ΣΤΟ 4 ο ΚΕΦΑΛΑΙΟ 1. Προβλήματα που αναφέρονται στα κομμάτια που θα κοπεί το DNA, στις θέσεις που κόβουν οι περιοριστικές ενδονουκλεάσες, στον αριθμό των πλασμιδίων που θα χρειαστούν

Διαβάστε περισσότερα

ΘΕΜΑΤΑ ΚΑΙ ΑΠΑΝΤΗΣΕΙΣ ΕΠΑΝΑΛΗΠΤΙΚΩΝ ΠΑΝΕΛΛΑ ΙΚΩΝ ΕΞΕΤΑΣΕΩΝ 2015 ΒΙΟΛΟΓΙΑ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ (ΘΕΤΙΚΗ ΚΑΤΕΥΘΥΝΣΗ)

ΘΕΜΑΤΑ ΚΑΙ ΑΠΑΝΤΗΣΕΙΣ ΕΠΑΝΑΛΗΠΤΙΚΩΝ ΠΑΝΕΛΛΑ ΙΚΩΝ ΕΞΕΤΑΣΕΩΝ 2015 ΒΙΟΛΟΓΙΑ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ (ΘΕΤΙΚΗ ΚΑΤΕΥΘΥΝΣΗ) ΒΙΟΛΟΓΙΑ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ (ΘΕΤΙΚΗ ΚΑΤΕΥΘΥΝΣΗ) ΘΕΜΑ Α Να γράψετε στο τετράδιό σας τον αριθµό καθεµιάς από τις παρακάτω ηµιτελείς προτάσεις Α1 έως Α5 και, δίπλα, το γράµµα που αντιστοιχεί στη λέξη ή

Διαβάστε περισσότερα

www.epignosi.edu.gr ΘΕΜΑ Α

www.epignosi.edu.gr ΘΕΜΑ Α ΘΕΜΑ Α Να γράψετε στην κόλλα σας τον αριθμό καθεμιάς από τις παρακάτω ημιτελείς προτάσεις 1 έως 5 και δίπλα το γράμμα που αντιστοιχεί στη λέξη ή τη φράση, η οποία συμπληρώνει σωστά την ημιτελή πρόταση.

Διαβάστε περισσότερα

ΠΑΝΕΛΛΗΝΙΕΣ ΕΞΕΤΑΣΕΙΣ Γ ΤΑΞΗΣ ΗΜΕΡΗΣΙΟΥ ΓΕΝΙΚΟΥ ΛΥΚΕΙΟΥ ΚΑΙ ΕΠΑΛ (ΟΜΑΔΑ Β ) ΤΕΤΑΡΤΗ 30 ΜΑΪΟΥ 2012 ΕΞΕΤΑΖΟΜΕΝΟ ΜΑΘΗΜΑ: ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ

ΠΑΝΕΛΛΗΝΙΕΣ ΕΞΕΤΑΣΕΙΣ Γ ΤΑΞΗΣ ΗΜΕΡΗΣΙΟΥ ΓΕΝΙΚΟΥ ΛΥΚΕΙΟΥ ΚΑΙ ΕΠΑΛ (ΟΜΑΔΑ Β ) ΤΕΤΑΡΤΗ 30 ΜΑΪΟΥ 2012 ΕΞΕΤΑΖΟΜΕΝΟ ΜΑΘΗΜΑ: ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ ΠΑΝΕΛΛΗΝΙΕΣ ΕΞΕΤΑΣΕΙΣ Γ ΤΑΞΗΣ ΗΜΕΡΗΣΙΟΥ ΓΕΝΙΚΟΥ ΛΥΚΕΙΟΥ ΚΑΙ ΕΠΑΛ (ΟΜΑΔΑ Β ) ΤΕΤΑΡΤΗ 30 ΜΑΪΟΥ 2012 ΕΞΕΤΑΖΟΜΕΝΟ ΜΑΘΗΜΑ: ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ ΘΕΜΑ Α Να γράψετε στο τετράδιό σας τον αριθμό καθεμιάς

Διαβάστε περισσότερα

ΘΕΜΑ 1 Ο ΜΑΘΗΜΑ / ΤΑΞΗ : ΑΠΑΝΤΗΣΕΙΣ ΒΙΟΛΟΓΙΑΣ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ ΣΕΙΡΑ: ΘΕΡΙΝΑ ΗΜΕΡΟΜΗΝΙΑ: 01/12/2013

ΘΕΜΑ 1 Ο ΜΑΘΗΜΑ / ΤΑΞΗ : ΑΠΑΝΤΗΣΕΙΣ ΒΙΟΛΟΓΙΑΣ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ ΣΕΙΡΑ: ΘΕΡΙΝΑ ΗΜΕΡΟΜΗΝΙΑ: 01/12/2013 ΜΑΘΗΜΑ / ΤΑΞΗ : ΑΠΑΝΤΗΣΕΙΣ ΒΙΟΛΟΓΙΑΣ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ ΣΕΙΡΑ: ΘΕΡΙΝΑ ΗΜΕΡΟΜΗΝΙΑ: 01/12/2013 ΘΕΜΑ 1 Ο Να επιλέξετε την φράση που συμπληρώνει ορθά κάθε μία από τις ακόλουθες προτάσεις: 1. Τα

Διαβάστε περισσότερα

Πανελλαδικές εξετάσεις Γ Τάξης Ημερήσιου Γενικού Λυκείου Βιολογία Θετικής Κατεύθυνσης Τετάρτη 4 Ιουνίου 2014

Πανελλαδικές εξετάσεις Γ Τάξης Ημερήσιου Γενικού Λυκείου Βιολογία Θετικής Κατεύθυνσης Τετάρτη 4 Ιουνίου 2014 Πανελλαδικές εξετάσεις Γ Τάξης Ημερήσιου Γενικού Λυκείου Βιολογία Θετικής Κατεύθυνσης Τετάρτη 4 Ιουνίου 2014 ΘΕΜΑ Α Α1.δ Α2.γ Α3.β Α4.γ Α5.β ΘΕΜΑ Β Β1. 4,2,1,6,3,5 Β2. α. DNA πολυμεράση β. πριμόσωμα γ.

Διαβάστε περισσότερα

Με την ανάπτυξη αυτής της τεχνολογίας το DNA που ήταν τόσο δύσκολο να µελετηθεί έγινε «παιχνίδι» στα ανθρώπινα χέρια

Με την ανάπτυξη αυτής της τεχνολογίας το DNA που ήταν τόσο δύσκολο να µελετηθεί έγινε «παιχνίδι» στα ανθρώπινα χέρια ΚΕΦΑΛΑΙΟ 4ο: Η τεχνολογία του ανασυνδυασµένου DNA έδωσε στον άνθρωπο την ικανότητα όχι µόνο να ερευνά αλλά και να τροποποιεί το γενετικό υλικό των οργανισµών ΤΕΧΝΟΛΟΓΙΑ ΤΟΥ ΑΝΑΣΥΝ ΥΑΣΜΕΝΟΥ DNA Η τεχνολογία

Διαβάστε περισσότερα

Γ ΤΑΞΗ ΓΕΝΙΚΟΥ ΛΥΚΕΙΟΥ ΚΑΙ ΕΠΑΛ (ΟΜΑΔΑ Β

Γ ΤΑΞΗ ΓΕΝΙΚΟΥ ΛΥΚΕΙΟΥ ΚΑΙ ΕΠΑΛ (ΟΜΑΔΑ Β ΑΡΧΗ 1ΗΣ ΣΕΛΙΔΑΣ Γ ΤΑΞΗ ΓΕΝΙΚΟΥ ΛΥΚΕΙΟΥ ΚΑΙ ΕΠΑΛ (ΟΜΑΔΑ Β ) ΤΕΤΑΡΤΗ 15/04/2015 ΕΞΕΤΑΖΟΜΕΝΟ ΜΑΘΗΜΑ: ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ ΘΕΜΑ Α ΣΥΝΟΛΟ ΣΕΛΙΔΩΝ: ΔΕΚΑ (10) Να γράψετε στο τετράδιό σας τον αριθμό κάθε

Διαβάστε περισσότερα

ΑΠΟΛΥΤΗΡΙΕΣ ΕΞΕΤΑΣΕΙΣ Γ ΤΑΞΗΣ ΕΝΙΑΙΟΥ ΛΥΚΕΙΟΥ ΤΡΙΤΗ 5 ΙΟΥΝΙΟΥ 2001 ΕΞΕΤΑΖΟΜΕΝΟ ΜΑΘΗΜΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ: ΒΙΟΛΟΓΙΑ ΑΠΑΝΤΗΣΕΙΣ ΘΕΜΑΤΩΝ

ΑΠΟΛΥΤΗΡΙΕΣ ΕΞΕΤΑΣΕΙΣ Γ ΤΑΞΗΣ ΕΝΙΑΙΟΥ ΛΥΚΕΙΟΥ ΤΡΙΤΗ 5 ΙΟΥΝΙΟΥ 2001 ΕΞΕΤΑΖΟΜΕΝΟ ΜΑΘΗΜΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ: ΒΙΟΛΟΓΙΑ ΑΠΑΝΤΗΣΕΙΣ ΘΕΜΑΤΩΝ ΑΠΟΛΥΤΗΡΙΕΣ ΕΞΕΤΑΣΕΙΣ Γ ΤΑΞΗΣ ΕΝΙΑΙΟΥ ΛΥΚΕΙΟΥ ΤΡΙΤΗ 5 ΙΟΥΝΙΟΥ 2001 ΕΞΕΤΑΖΟΜΕΝΟ ΜΑΘΗΜΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ: ΒΙΟΛΟΓΙΑ ΑΠΑΝΤΗΣΕΙΣ ΘΕΜΑΤΩΝ ΘΕΜΑ 1 ο Α. Σωστό το γ ιότι ο φαινότυπος που εµφανίζεται στους απογόνους

Διαβάστε περισσότερα

ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ 30 ΜΑΪΟΥ 2012 ΑΠΑΝΤΗΣΕΙΣ

ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ 30 ΜΑΪΟΥ 2012 ΑΠΑΝΤΗΣΕΙΣ ΘΕΜΑ Α Α1. A Α2. Γ Α3. Α4. Β Α5. Γ ΘΕΜΑ Β ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ 30 ΜΑΪΟΥ 2012 ΑΠΑΝΤΗΣΕΙΣ B1. Τα µονοκλωνικά αντισώµατα µεταξύ των άλλων χρησιµοποιούνται και για την επιλογή οργάνων συµβατών

Διαβάστε περισσότερα

ΘΕΜΑ Α Α1. β Α2. β Α3. δ Α4. γ Α5. γ

ΘΕΜΑ Α Α1. β Α2. β Α3. δ Α4. γ Α5. γ ΝΕΟ & ΠΑΛΑΙΟ ΣΥΣΤΗΜΑ Γ ΗΜΕΡΗΣΙΩΝ ΠΑΝΕΛΛΑΔΙΚΕΣ ΕΞΕΤΑΣΕΙΣ Γ ΤΑΞΗΣ ΗΜΕΡΗΣΙΟΥ ΓΕΝΙΚΟΥ ΛΥΚΕΙΟΥ ΚΑΙ ΕΠΑΛ (ΟΜΑΔΑ Β ) ΠΑΡΑΣΚΕΥΗ 27 ΜΑΪΟΥ 2016 ΑΠΑΝΤΗΣΕΙΣ ΣΤΗ ΒΙΟΛΟΓΙΑ ΠΡΟΣΑΝΑΤΟΛΙΣΜΟΥ (ΝΕΟ ΣΥΣΤΗΜΑ) ΚΑΤΕΥΘΥΝΣΗΣ (ΠΑΛΑΙΟ

Διαβάστε περισσότερα

ΕΝΔΕΙΚΤΙΚΕΣ ΑΠΑΝΤΗΣΕΙΣ ΠΑΝΕΛΛΑΔΙΚΩΝ ΕΞΕΤΑΣΕΩΝ 2016 ΒΙΟΛΟΓΙΑ ΠΡΟΣΑΝΑΤΟΛΙΣΜΟΥ

ΕΝΔΕΙΚΤΙΚΕΣ ΑΠΑΝΤΗΣΕΙΣ ΠΑΝΕΛΛΑΔΙΚΩΝ ΕΞΕΤΑΣΕΩΝ 2016 ΒΙΟΛΟΓΙΑ ΠΡΟΣΑΝΑΤΟΛΙΣΜΟΥ ΕΝΔΕΙΚΤΙΚΕΣ ΑΠΑΝΤΗΣΕΙΣ ΠΑΝΕΛΛΑΔΙΚΩΝ ΕΞΕΤΑΣΕΩΝ 2016 ΒΙΟΛΟΓΙΑ ΠΡΟΣΑΝΑΤΟΛΙΣΜΟΥ ΘΕΜΑ Α Α1. Β, Α2. Β, Α3. Δ, Α4. Γ, Α5. γ ΘΕΜΑ Β Β1. 1 Α, 2 Γ, 3 Α,4 Β, 5 Α, 6 Α, 7 Γ Β2. Βλ. σχολικό βιβλίο, σελ.24(έκδοση 2014-15)

Διαβάστε περισσότερα

ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ ΓΕΝΙΚΟΥ ΛΥΚΕΙΟΥ ΚΑΙ ΕΠΑΛ (ΟΜΑ Α Β ) 2011

ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ ΓΕΝΙΚΟΥ ΛΥΚΕΙΟΥ ΚΑΙ ΕΠΑΛ (ΟΜΑ Α Β ) 2011 ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ ΓΕΝΙΚΟΥ ΛΥΚΕΙΟΥ ΚΑΙ ΕΠΑΛ (ΟΜΑ Α Β ) 2011 ΘΕΜΑ Α Να γράψετε στο τετράδιό σας τον αριθμό καθεμιάς από τις παρακάτω ημιτελείς προτάσεις Α1 έως Α5 και δίπλα το γράμμα που αντιστοιχεί

Διαβάστε περισσότερα

ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ 22 ΜΑΪΟΥ 2015 ΕΚΦΩΝΗΣΕΙΣ

ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ 22 ΜΑΪΟΥ 2015 ΕΚΦΩΝΗΣΕΙΣ ΘΕΜΑ Α ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ 22 ΜΑΪΟΥ 2015 ΕΚΦΩΝΗΣΕΙΣ Να γράψετε στο τετράδιό σας τον αριθµό καθεµίας από τις παρακάτω ηµιτελείς προτάσεις Α1 έως Α5 και δίπλα το γράµµα που αντιστοιχεί

Διαβάστε περισσότερα

ΚεφάΠαιο 4 ΤεχνοΠογία ίου ανασυνουασμένου DNA

ΚεφάΠαιο 4 ΤεχνοΠογία ίου ανασυνουασμένου DNA ΚεφάΠαιο 4 ΤεχνοΠογία ίου ανασυνουασμένου DNA 1. Γιατί οι περιοριστικές ενδονουκλεάσες και οι φορείς κλωνοποίησης είναι απαραίτητα εργαλεία για τη Γενετική Μηχανική; Οι περιοριστικές ενδονουκλεάσες είναι

Διαβάστε περισσότερα

ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ ΓΕΝΙΚΟΥ ΛΥΚΕΙΟΥ ΚΑΙ ΕΠΑΛ (ΟΜΑ Α Β ) 2012

ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ ΓΕΝΙΚΟΥ ΛΥΚΕΙΟΥ ΚΑΙ ΕΠΑΛ (ΟΜΑ Α Β ) 2012 ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ ΓΕΝΙΚΟΥ ΛΥΚΕΙΟΥ ΚΑΙ ΕΠΑΛ (ΟΜΑ Α Β ) 2012 ΘΕΜΑ Α Να γράψετε στο τετράδιό σας τον αριθμό καθεμιάς από τις παρακάτω ημιτελείς προτάσεις Α1 έως Α5 και δίπλα το γράμμα που αντιστοιχεί

Διαβάστε περισσότερα

ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ

ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ ΘΕΜΑ 1ο Να γράψετε στο τετράδιό σας τον αριθμό καθεμιάς από τις παρακάτω ημιτελείς προτάσεις 1 έως 5 και δίπλα το γράμμα που αντιστοιχεί στη λέξη ή τη φράση, η οποία

Διαβάστε περισσότερα

β) Σχολικό βιβλίο σελ. 96: «Αν κατά τη διάρκεια της µείωσης...τρισωµία», σελ. 97: «Η έλλειψη είναι η απώλεια γενετικού

β) Σχολικό βιβλίο σελ. 96: «Αν κατά τη διάρκεια της µείωσης...τρισωµία», σελ. 97: «Η έλλειψη είναι η απώλεια γενετικού ΠΡΟΣΟΜΟΙΩΣΗ ΑΠΟΛΥΤΗΡΙΩΝ ΕΞΕΤΑΣΕΩΝ Γ ΤΑΞΗΣ ΗΜΕΡΗΣΙΟΥ ΓΕΝΙΚΟΥ ΛΥΚΕΙΟΥ ΚΥΡΙΑΚΗ 4 ΜΑΪΟΥ 2014 ΕΞΕΤΑΖΟΜΕΝΟ ΜΑΘΗΜΑ: ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ ΘΕΜΑ Α Α1. α, Α2. β, Α3. δ, Α4. β, Α5. β ΑΠΑΝΤΗΣΕΙΣ ΘΕΜΑ Β Β1.

Διαβάστε περισσότερα

ΕΠΑΝΑΛΗΠΤΙΚΑ ΘΕΜΑΤΑ Ο.Ε.Φ.Ε. 2004 ΘΕΜΑΤΑ ΒΙΟΛΟΓΙΑΣ Γ ΛΥΚΕΙΟΥ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ

ΕΠΑΝΑΛΗΠΤΙΚΑ ΘΕΜΑΤΑ Ο.Ε.Φ.Ε. 2004 ΘΕΜΑΤΑ ΒΙΟΛΟΓΙΑΣ Γ ΛΥΚΕΙΟΥ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ ΕΠΑΝΑΛΗΠΤΙΚΑ ΘΕΜΑΤΑ Ο.Ε.Φ.Ε. 2004 ΘΕΜΑ 1 Ο Α. Να επιλέξετε την ορθή πρόταση: ΘΕΜΑΤΑ ΒΙΟΛΟΓΙΑΣ Γ ΛΥΚΕΙΟΥ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ 1. Το κωδικόνιο του mrna που κωδικοποιεί το αµινοξύ µεθειονίνη είναι α. 5 GUA

Διαβάστε περισσότερα

ΘΕΜΑ Α ΘΕΜΑ Β ΘΕΜΑ Γ. Α1. δ. Α2. γ. Α3. β. Α4. γ. Α5. β Β1. Η σωστή σειρά είναι: 4,2,1,6,3,5. Β2. α. DNA πολυμεράση. β. Πριμόσωμα. γ.

ΘΕΜΑ Α ΘΕΜΑ Β ΘΕΜΑ Γ. Α1. δ. Α2. γ. Α3. β. Α4. γ. Α5. β Β1. Η σωστή σειρά είναι: 4,2,1,6,3,5. Β2. α. DNA πολυμεράση. β. Πριμόσωμα. γ. ΘΕΜΑ Α ΠΑΝΕΛΛΑ ΙΚΕΣ ΕΞΕΤΑΣΕΙΣ Γ ΤΑΞΗΣ ΗΜΕΡΗΣΙΟΥ ΚΑΙ ΓΕΝΙΚΟΥ ΛΥΚΕΙΟΥ ΚΑΙ ΕΠΑΛ(ΟΜΑ Α Β ) ΤΕΤΑΡΤΗ 4 ΙΟΥΝΙΟΥ 2014 - ΕΞΕΤΑΖΟΜΕΝΟ ΜΑΘΗΜΑ: ΒΙΟΛΟΓΙΑ ΚΑΤΕΥΘΥΝΣΗΣ Α1. δ Α2. γ Α3. β Α4. γ Α5. β ΘΕΜΑ Β Β1. Η σωστή

Διαβάστε περισσότερα

ΒΙΟΛΟΓΙΑ ΠΡΟΣΑΝΑΤΟΛΙΣΜΟΥ

ΒΙΟΛΟΓΙΑ ΠΡΟΣΑΝΑΤΟΛΙΣΜΟΥ ΕΝΔΕΙΚΤΙΚΕΣ ΑΠΑΝΤΗΣΕΙΣ ΠΑΝΕΛΛΗΝΙΩΝ 2017 ΘΕΜΑ Α Α1. δ Α2. δ Α3. β Α4. γ Α5. α ΘΕΜΑ Β Β1. Ι Α, ΙΙ Ε, ΙΙΙ ΣΤ, ΙV Β, V Ζ, VII Γ, VII Δ Β2. Η εικόνα 1 αντιστοιχεί σε προκαρυωτικό κύτταρο. Στους προκαρυωτικούς

Διαβάστε περισσότερα

ΘΕΜΑΤΑ ΚΑΙ ΑΠΑΝΤΗΣΕΙΣ ΕΠΑΝΑΛΗΠΤΙΚΩΝ ΠΑΝΕΛΛΑ ΙΚΩΝ ΕΞΕΤΑΣΕΩΝ 2016 ΒΙΟΛΟΓΙΑ ΠΡΟΣΑΝΑΤΟΛΙΣΜΟΥ Γ ΛΥΚΕΙΟΥ ΒΙΟΛΟΓΙΑ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ

ΘΕΜΑΤΑ ΚΑΙ ΑΠΑΝΤΗΣΕΙΣ ΕΠΑΝΑΛΗΠΤΙΚΩΝ ΠΑΝΕΛΛΑ ΙΚΩΝ ΕΞΕΤΑΣΕΩΝ 2016 ΒΙΟΛΟΓΙΑ ΠΡΟΣΑΝΑΤΟΛΙΣΜΟΥ Γ ΛΥΚΕΙΟΥ ΒΙΟΛΟΓΙΑ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ ΘΕΜΑ Α ΘΕΜΑΤΑ ΚΑΙ ΑΠΑΝΤΗΣΕΙΣ ΕΠΑΝΑΛΗΠΤΙΚΩΝ ΒΙΟΛΟΓΙΑ ΠΡΟΣΑΝΑΤΟΛΙΣΜΟΥ Γ ΛΥΚΕΙΟΥ (ΝΕΟ ΣΥΣΤΗΜΑ) ΒΙΟΛΟΓΙΑ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ (ΠΑΛΑΙΟ ΣΥΣΤΗΜΑ) Να γράψετε στο τετράδιό σας τον αριθµό καθεµιάς από τις παρακάτω

Διαβάστε περισσότερα

Απαντήσεις Πανελλαδικών Βιολογίας Προσανατολισμού 2017

Απαντήσεις Πανελλαδικών Βιολογίας Προσανατολισμού 2017 Σελίδα1 Απαντήσεις Πανελλαδικών Βιολογίας Προσανατολισμού 2017 ΘΕΜΑ Α Α1. δ Α2. δ Α3. β Α4. γ Α5. α ΘΕΜΑ Β Β1. I Α, II Ε, III ΣΤ, IV Β, V Ζ, VI Γ, VII Δ (7 μον.) Β2. Πρόκειται για προκαρυωτικό κύτταρο,

Διαβάστε περισσότερα

ΘΕΜΑ Α ΘΕΜΑ Β ΑΠΑΝΤΗΣΕΙΣ. Α1. β. Α2. γ. Α3. δ. Α4. γ. Α5. β Β1. 5, 4, 2, 1, 3. Β2. Τα δομικά μέρη του οπερονίου της λακτόζης είναι κατά σειρά τα εξής:

ΘΕΜΑ Α ΘΕΜΑ Β ΑΠΑΝΤΗΣΕΙΣ. Α1. β. Α2. γ. Α3. δ. Α4. γ. Α5. β Β1. 5, 4, 2, 1, 3. Β2. Τα δομικά μέρη του οπερονίου της λακτόζης είναι κατά σειρά τα εξής: ΕΙΣΑΓΩΓΙΚΕΣ ΕΞΕΤΑΣΕΙΣ ΤΕΚΝΩΝ ΕΛΛΗΝΩΝ ΤΟΥ ΕΞΩΤΕΡΙΚΟΥ ΚΑΙ ΤΕΚΝΩΝ ΕΛΛΗΝΩΝ ΥΠΑΛΛΗΛΩΝ ΣΤΟ ΕΞΩΤΕΡΙΚΟ ΔΕΥΤΕΡΑ 10 ΣΕΠΤΕΜΒΡΙΟΥ 2014 ΕΞΕΤΑΖΟΜΕΝΟ ΜΑΘΗΜΑ: ΒΙΟΛΟΓΙΑ ΑΠΑΝΤΗΣΕΙΣ ΘΕΜΑ Α Α1. β Α2. γ Α3. δ Α4. γ Α5. β ΘΕΜΑ

Διαβάστε περισσότερα