ΘΕΜΑΤΑ ΠΑΝΕΛΛΗΝΙΩΝ ΕΞΕΤΑΣΕΩΝ ΣΤΗΝ ΤΕΧΝΟΛΟΓΙΑ ΑΝΑΣΥΝ ΥΑΣΜΕΝΟΥ DNA

Save this PDF as:
 WORD  PNG  TXT  JPG

Μέγεθος: px
Εμφάνιση ξεκινά από τη σελίδα:

Download "ΘΕΜΑΤΑ ΠΑΝΕΛΛΗΝΙΩΝ ΕΞΕΤΑΣΕΩΝ ΣΤΗΝ ΤΕΧΝΟΛΟΓΙΑ ΑΝΑΣΥΝ ΥΑΣΜΕΝΟΥ DNA"

Transcript

1 1 ο ΓΕΝΙΚΟ ΛΥΚΕΙΟ ΗΡΑΚΛΕΙΟΥ - ΚΑΠΕΤΑΝΑΚΕΙΟ ΘΕΜΑΤΑ ΠΑΝΕΛΛΗΝΙΩΝ ΕΞΕΤΑΣΕΩΝ ΣΤΗΝ ΤΕΧΝΟΛΟΓΙΑ ΑΝΑΣΥΝ ΥΑΣΜΕΝΟΥ DNA 2000 ΗΜΕΡΗΣΙΟ 5. Οι περιοριστικές ενδονουκλεάσες: α. συµµετέχουν στην ωρίµανση του RΝΑ β. είναι απαραίτητες για την έναρξη της αντιγραφής γ. συµµετέχουν στη µεταγραφή του DΝΑ δ. κόβουν το DΝΑ σε καθορισµένες θέσεις () 2001 ΗΜΕΡΗΣΙΟ ΘΕΜΑ 2 o 2. Να περιγράψετε τον τρόπο κατασκευής µιας cdna βιβλιοθήκης. Μονάδες ΕΣΠΕΡΙΝΟ 2. Οι περιοριστικές ενδονουκλεάσες συνδέουν κοµµάτια του DNA ενώ η DNA δεσµάση κόβει κάθε αλυσίδα του DNA σε συγκεκριµένες θέσεις. (Σ-Λ) 2001 ΟΜΟΓΕΝΕΙΣ ΘΕΜΑ 3ο 1. Η τεχνολογία του ανασυνδυασµένου DNA περιλαµβάνει όλες τις τεχνικές που οδηγούν σε µεταφορά του γενετικού υλικού από τον έναν οργανισµό στον άλλο. Να περιγράψετε τα στάδια της διαδικασίας αυτής ΗΜΕΡΗΣΙΟ ΘΕΜΑ 3ο 1. ίνεται το παρακάτω τµήµα µορίου DNA προκαρυωτικού κυττάρου. 5 GAATTCTTAATGCΑAGATCATAAAGAATTCTAG 3 3 CTTAAGAATTACGΤTCTAGTATTTCTTAAGATC 5 Το παραπάνω τµήµα DNA κόβεται µε EcoRI, προκειµένου να ενσωµατωθεί σε κατάλληλο πλασµίδιο που έχει κοπεί µε την ίδια περιοριστική ενδονουκλεάση, µε τελικό σκοπό να εισαχθεί σε βακτήριο για την παραγωγή φαρµακευτικού πολυπεπτιδίου. Να βρείτε την αλληλουχία των αµινοξέων του πολυπεπτιδίου µε χρήση του παρατιθέµενου γενετικού κώδικα. Να αιτιολογήσετε την απάντησή σας. Μονάδες ΗΜΕΡΗΣΙΟ 2. Οι περιοριστικές ενδονουκλεάσες παράγονται από ευκαρυωτικά κύτταρα. (Σ-Λ) Μονάδες 2 3. Η µέθοδος αλυσιδωτής αντίδρασης πολυµεράσης (PCR) επιτρέπει την επιλεκτική αντιγραφή µορίων DNA, χωρίς τη µεσολάβηση ζωικών κυττάρων. (Σ-Λ) Μονάδες 2 3. Μια γονιδιωµατική βιβλιοθήκη περιέχει: α. το σύνολο του m-rna ενός οργανισµού β. το σύνολο του DNA ενός οργανισµού γ. αντίγραφα ενός µόνο ανασυνδυασµένου πλασµιδίου δ. αντίγραφα ανασυνδυασµένων κυττάρων. 1. Τι ονοµάζεται υβριδοποίηση νουκλεϊκών οξέων; 2003 ΕΣΠΕΡΙΝΟ 2. Οι περιοριστικές παράγονται από και ο φυσιολογικός τους ρόλος είναι να τα προστατεύουν από την εισβολή «ξένου» DNA. 1 ο ΓΕΝΙΚΟ ΛΥΚΕΙΟ ΗΡΑΚΛΕΙΟΥ - ΚΑΠΕΤΑΝΑΚΕΙΟ 1

2 3. Η διαδικασία δηµιουργίας κλώνων βακτηρίων ονοµάζεται. Το σύνολο των βακτηριακών κλώνων αποτελεί τη βιβλιοθήκη ΗΜΕΡΗΣΙΟ Μια cdna βιβλιοθήκη περιέχει α. το σύνολο του DNA ενός οργανισµού. β. αντίγραφα των mrna όλων των γονιδίων που εκφράζονται σε συγκεκριµένα κύτταρα. γ. αντίγραφα του mrna ενός µόνο γονιδίου. δ. αντίγραφα που περιέχουν κοµµάτια γονιδίων και άλλα τµήµατα DNA ΕΣΠΕΡΙΝΟ Η διαδικασία δηµιουργίας κλώνων βακτηρίων ονοµάζεται ΕΠΑΝΑΛΗΠΤΙΚΕΣ ΗΜΕΡΗΣΙΟΥ 2. Οι περιοριστικές ενδονουκλεάσες α. συµµετέχουν στην ωρίµανση του mrna. β. συµµετέχουν στη µεταγραφή του DNA. γ. αναγνωρίζουν ειδικές αλληλουχίες DNA. δ. συµµετέχουν στην αντιγραφή του DNA. 5. Η εισαγωγή ανασυνδυασµένου DNA σε βακτηριακό κύτταρο ξενιστή ονοµάζεται α. εµβολιασµός. β. µικροέγχυση. γ. ιχνηθέτηση. δ. µετασχηµατισµός ΟΜΟΓΕΝΕΙΣ Β. Τι περιέχει α. µια γονιδιωµατική βιβλιοθήκη; β. µια C-DNA βιβλιοθήκη; Μονάδες ΕΣΠΕΡΙΝΟ 3. Η επιλογή ενός βακτηριακού κλώνου που περιέχει το επιθυµητό τµήµα DNA γίνεται µε α. χρήση αντιβιοτικών. β. χρήση ειδικών µορίων ανιχνευτών. γ. ένζυµα πρωτεϊνοσύνθεσης. δ. χρήση βιοαντιδραστήρων ΘΕΜΑ 4ο ίνεται τµήµα µορίου DNA ευκαρυωτικού κυττάρου που περιέχει ασυνεχές γονίδιο, εσώνιο G A A T T C A T G T T T CCCCAG G T T T A A G A A T T C C T T A A G T A C A A A GGGGTC C A A A T T C T T A A G εσώνιο το οποίο είναι υπεύθυνο για τη σύνθεση του παρακάτω πεπτιδίου, που δεν έχει υποστεί καµιά τροποποίηση: H 2 N - Μεθειονίνη - φαινυλαλανίνη - βαλίνη - COOH Να γράψετε την κωδική και τη µη κωδική αλυσίδα του γονιδίου, το πρόδροµο m-rna και το ώριµο m-rna(μονάδες 4) και να ορίσετε τα 3 και 5 άκρα των παραπάνω νουκλεοτιδικών αλυσίδων αιτιολογώντας την απάντησή σας (Μονάδες 8). Να αναφέρετε τις διαδικασίες κατά την πορεία από το γονίδιο στο πεπτίδιο και τις περιοχές του κυττάρου στις οποίες πραγµατοποιούνται (). Πώς µπορούµε να δηµιουργήσουµε ένα ανασυνδυασµένο 1 ο ΓΕΝΙΚΟ ΛΥΚΕΙΟ ΗΡΑΚΛΕΙΟΥ - ΚΑΠΕΤΑΝΑΚΕΙΟ 2

3 πλασµίδιο, που να περιέχει το συγκεκριµένο γονίδιο χρησιµοποιώντας την περιοριστική ενδονουκλεάση EcoRI; (Μονάδες 7). ίνονται οι παρακάτω αντιστοιχίσεις αµινοξέων και κωδικονίων από το γενετικό κώδικα: Μεθειονίνη ΑUG Φαινυλαλανίνη UUU Βαλίνη GUU Μονάδες ΕΠΑΝΑΛΗΠΤΙΚΕΣ ΗΜΕΡΗΣΙΟΥ 2. Τι µπορούµε να πετύχουµε µε τη µέθοδο της αλυσιδωτής αντίδρασης πολυµεράσης (PCR) και ποιες είναι οι πρακτικές εφαρµογές της; Μονάδες ΟΜΟΓΕΝΕΙΣ 1. Οι περιοριστικές ενδονουκλεάσες παράγονται από α. µύκητες. β. βακτήρια. γ. ιούς. δ. φυτά. 3. Η εισαγωγή του ανασυνδυασµένου µορίου DNA σε βακτηριακό κύτταρο-ξενιστή ονοµάζεται α. γονιδιωµατική βιβλιοθήκη. β. cdna βιβλιοθήκη. γ. βακτηριακός κλώνος. δ. µετασχηµατισµός ΗΜΕΡΗΣΙΟ 3. Η µέθοδος της αλυσιδωτής αντίδρασης PCR µας επιτρέπει α. τη δηµιουργία αντιγράφων των πολυπεπτιδικών αλυσίδων ενός οργανισµού. β. την αντιγραφή συγκεκριµένων αλληλουχιών DNA, χωρίς µεσολάβηση ζωντανών κυττάρων. γ. τον προσδιορισµό όλων των σωµατικών κυττάρων ενός οργανισµού. δ. τον ανασυνδυασµό πολλών πλασµιδίων από διαφορετικά βακτήρια ΕΣΠΕΡΙΝΟ 3. Οι περιοριστικές ενδονουκλεάσες α. παράγονται από ιούς. β. είναι απαραίτητες για την έναρξη της αντιγραφής. γ. συµµετέχουν στην αντίστροφη µεταγραφή. δ. παράγονται από βακτήρια ΕΠΑΝΑΛΗΠΤΙΚΕΣ ΗΜΕΡΗΣΙΟΥ 3. Για τη δηµιουργία ανασυνδυασµένου DNA ενώνονται τµήµατα DNA διαφορετικών οργανισµών, τα οποία κόπηκαν από την ίδια περιοριστική ενδονουκλεάση. Η ένωση αυτή γίνεται µε τη βοήθεια του ενζύµου α. DNA ελικάση. β. DNA πολυµεράση. γ. RNA πολυµεράση. δ. DNA δεσµάση. 2. Ποια βήµατα ακολουθούνται για την κατασκευή µιας cdna βιβλιοθήκης; Μονάδες ΟΜΟΓΕΝΕΙΣ ΘΕΜΑ 4ο ίνεται το παρακάτω τµήµα DNA ενός προκαρυωτικού οργανισµού: 1 ο ΓΕΝΙΚΟ ΛΥΚΕΙΟ ΗΡΑΚΛΕΙΟΥ - ΚΑΠΕΤΑΝΑΚΕΙΟ 3

4 5 CCAGΑATTCAATTCAGGACGAAAAGAATTCAAC 3 3 GGTCTTAAGTTAAGTCCTGCTTTΤCTTAAGTTG 5 To παραπάνω τµήµα DNA κόβεται µε περιοριστική ενδονουκλεάση EcoRI. Να γράψετε το τµήµα DNA που προκύπτει µετά από τη δράση της EcoRI και να δικαιολογήσετε την απάντησή σας. Μονάδες 8 Το τµήµα του DNA που προέκυψε µετά τη δράση της EcoRI µεταγράφεται. Ποια αλυσίδα από αυτό το DNA µεταγράφεται και γιατί; Να γράψετε την αλληλουχία του mrna που προκύπτει από αυτή τη µεταγραφή και να σηµειώσετε το 5 και το 3 άκρο της. Ποιοι οργανισµοί διαθέτουν περιοριστικές ενδονουκλεάσες και ποιος είναι ο φυσιολογικός τους ρόλος; 2007 ΗΜΕΡΗΣΙΟ 4. Το πλασµίδιο είναι α. δίκλωνο γραµµικό µόριο DNA. β. δίκλωνο κυκλικό µόριο DNA. γ. δίκλωνο κυκλικό µόριο RNA. δ. δίκλωνο γραµµικό µόριο RNA. ΘΕΜΑ 3 ο Η Βιοτεχνολογία µε την ανάπτυξη της τεχνολογίας του ανασυνδυασµένου DNA, τη χρήση της τεχνικής PCR και την παραγωγή µονοκλωνικών αντισωµάτων συνεισφέρει σε τοµείς, όπως η γεωργία, η κτηνοτροφία και η Ιατρική. 1. Τι επιτρέπει η µέθοδος της αλυσιδωτής αντίδρασης της πολυµεράσης (PCR); (µονάδες 4) Να αναφέρετε τρεις πρακτικές εφαρµογές της (µονάδες 3) ΕΣΠΕΡΙΝΟ 3. Ο φορέας κλωνοποίησης είναι α. ειδικό ένζυµο που αποκόπτει γονίδια. β. ένα µόριο DNA όπως για παράδειγµα ένα πλασµίδιο. γ. ένας οργανισµός που έχει υποστεί κλωνοποίηση. δ. κρατικός φορέας που ελέγχει τις κλωνοποιήσεις. Μονάδες ΗΜΕΡΗΣΙΟ ΕΠΑΝΑΛΗΠΤΙΚΑ 2. Τα βακτηριακά ένζυµα που κόβουν το δίκλωνο DNA σε συγκεκριµένες θέσεις ονοµάζονται α. DNA πολυµεράσες. β. DNA δεσµάσες. γ. περιοριστικές ενδονουκλεάσες. δ. RNA πολυµεράσες. 1. Πώς µπορούµε να εντοπίσουµε ένα συγκεκριµένο κοµµάτι κλωνοποιηµένου DNA σε µία γονιδιωµατική βιβλιοθήκη; 2007 ΟΜΟΓΕΝΕΙΣ 2. Μια γονιδιωµατική βιβλιοθήκη περιέχει α. το ολικό «ώριµο» mrna ενός οργανισµού. β. όλα τα είδη RNA ενός οργανισµού. γ. όλο το γονιδίωµα ενός οργανισµού. δ. µόνο ορισµένα γονίδια ενός οργανισµού. 1 ο ΓΕΝΙΚΟ ΛΥΚΕΙΟ ΗΡΑΚΛΕΙΟΥ - ΚΑΠΕΤΑΝΑΚΕΙΟ 4

5 2008 ΗΜΕΡΗΣΙΟ 4. Οι περιοριστικές ενδονουκλεάσες: α. είναι απαραίτητες για την έναρξη της µεταγραφής. β. κόβουν τις πολυνουκλεοτιδικές αλυσίδες του RNA σε ειδικές θέσεις. γ. περιορίζουν τη µεταγραφή του DNA. δ. κόβουν το DNA σε ειδικές θέσεις ΕΣΠΕΡΙΝΟ 1. Οι περιοριστικές ενδονουκλεάσες α. παράγονται µόνο από µύκητες. β. είναι απαραίτητες για τη διαδικασία της αντίστροφης µεταγραφής. γ. παράγονται από βακτήρια. δ. είναι απαραίτητες για την έναρξη της αντιγραφής του DNA ΟΜΟΓΕΝΕΙΣ 3. Μια γονιδιωµατική βιβλιοθήκη περιλαµβάνει α. αντίγραφα πολλών ανασυνδυασµένων κυττάρων. β. το σύνολο του DNA ενός οργανισµού. γ. το σύνολο του m-rna ενός οργανισµού. δ. αντίγραφα ενός µόνο ανασυνδυασµένου πλασµιδίου ΗΜΕΡΗΣΙΟ 5. Μετασχηµατισµός βακτηριακού κυττάρου ξενιστή είναι α. η εισαγωγή αντισώµατος. β. η εισαγωγή DNA πλασµιδίου. γ. η εισαγωγή θρεπτικών συστατικών. δ. η εισαγωγή αντίστροφης µεταγραφάσης ΕΣΠΕΡΙΝΟ 2. Τα υβριδώµατα µπορούν να παράγουν µεγάλες ποσότητες α. ινσουλίνης. β. ιντερφερονών. γ. µονοκλωνικών αντισωµάτων. δ. α 1 αντιθρυψίνης. 4. Η επιλογή ενός βακτηριακού κλώνου που περιέχει το ανασυνδυασµένο πλασµίδιο γίνεται µε: α. χρήση ειδικών µορίων ανιχνευτών. β. χρήση αντιβιοτικών. γ. ένζυµα πρωτεϊνοσύνθεσης. δ. χρήση βιοαντιδραστήρων ΗΜΕΡΗΣΙΟ ΕΠΑΝΑΛΗΠΤΙΚΑ 3. Αποδιάταξη είναι το φαινόµενο κατά το οποίο α. κόβεται το DNA. β. αποχωρίζονται οι κλώνοι του DNA. γ. συνδέονται µεταξύ τους οι κλώνοι του DNA. δ. ιχνηθετείται το DNA ΟΜΟΓΕΝΕΙΣ 4. Η µεταφορά ανασυνδυασµένου µορίου DNA στο κύτταρο ξενιστή λέγεται α. µετασχηµατισµός. β. υβριδοποίηση. 1 ο ΓΕΝΙΚΟ ΛΥΚΕΙΟ ΗΡΑΚΛΕΙΟΥ - ΚΑΠΕΤΑΝΑΚΕΙΟ 5

6 γ. αποδιάταξη. δ. κλωνοποίηση ΕΣΠΕΡΙΝΟ Α4. Οι περιοριστικές ενδονουκλεάσες α. κόβουν το DNA σε καθορισµένες θέσεις. β. παράγονται από βακτήρια. γ. προστατεύουν το βακτήριο από την εισβολή ξένου DNA. δ. όλα τα παραπάνω ΗΜΕΡΗΣΙΟ Α4. Η εισαγωγή ανασυνδυασµένου DNA σε βακτηριακό κύτταρο-ξενιστή ονοµάζεται α. ιχνηθέτηση β. µετασχηµατισµός γ. εµβολιασµός δ. µικροέγχυση Γ3. ίνεται µείγµα µορίων DNA και ένας ανιχνευτής RΝΑ. Να εξηγήσετε τι είναι ανιχνευτής (µονάδες 2), να περιγράψετε τις διαδικασίες που θα ακολουθηθούν προκειµένου ο ανιχνευτής να υβριδοποιήσει την κατάλληλη αλληλουχία DNA (µονάδες 4) και να εξηγήσετε ποιος είναι ο κλώνος του DNA που θα υβριδοποιηθεί (µονάδες 4) ΗΜΕΡΗΣΙΟ ΕΠΑΝΑΛΗΠΤΙΚΑ Β4. Να ορίσετε τι είναι η γονιδιωµατική βιβλιοθήκη. Μονάδες ΟΜΟΓΕΝΕΙΣ B2. Τι είναι κλωνοποίηση; ΘΕΜΑ ίνεται το παρακάτω δίκλωνο τµήµα DNA το οποίο αντιγράφεται in vitro. 5 TAAGTATACTAAACGAAΤΤCATATTAT 3 3 ATTCATATGATTTGCTTAAGTATAATA 5 Κατά τη διάρκεια της αντιγραφής οι DNA πολυµεράσες ενσωµατώνουν κατά λάθος στη θέση 12, απέναντι από το νουκλεοτίδιο Α (αδενίνη) το νουκλεοτίδιο C (κυτοσίνη), αντί του νουκλεοτιδίου T (θυµίνη). Το λάθος αυτό παραµένει και µετά το τέλος της αντιγραφής. 1. Να γράψετε τα δίκλωνα τµήµατα DNA που θα προκύψουν µετά το τέλος της αντιγραφής και να δικαιολογήσετε την απάντησή σας. Μονάδες Πόσα τµήµατα DNA θα προκύψουν, αν µετά το τέλος της αντιγραφής προσθέσουµε στο µίγµα το ένζυµο EcoRΙ. Να δικαιολογήσετε την απάντησή σας. Μονάδες ΗΜΕΡΗΣΙΟ Α2. Οι περιοριστικές ενδονουκλεάσες 1 ο ΓΕΝΙΚΟ ΛΥΚΕΙΟ ΗΡΑΚΛΕΙΟΥ - ΚΑΠΕΤΑΝΑΚΕΙΟ 6

7 α. συµµετέχουν στη µεταγραφή του DNA. β. καταλύουν την ωρίµανση του mrna. γ. συµµετέχουν στη µετάφραση του mrna. δ. αναγνωρίζουν ειδικές αλληλουχίες DNA. Β3. Τι είναι: α) γονιδιωµατική βιβλιοθήκη. β) cdna βιβλιοθήκη ΕΣΠΕΡΙΝΟ ΕΠΑΝΑΛΗΠΤΙΚΑ Β3. Ποιος είναι ο ρόλος της περιοριστικής ενδονουκλεάσης EcoRI στην τεχνολογία του ανασυνδυασµένου DNA; 2011 ΟΜΟΓΕΝΕΙΣ A2. Οι περιοριστικές ενδονουκλεάσες α. συµµετέχουν στη µετάφραση του RNA. β. συµµετέχουν στη µεταγραφή του DNA. γ. είναι απαραίτητες για την έναρξη της αντιγραφής. δ. κόβουν το DNA σε καθορισµένες θέσεις. B4. Τι µας επιτρέπει να κάνουµε η µέθοδος αλυσιδωτής αντίδρασης πολυµεράσης (PCR); 2012 ΗΜΕΡΗΣΙΟ ίνεται το παρακάτω τµήµα βακτηριακού DNA, το οποίο κωδικοποιεί ένα ολιγοπεπτίδιο. Αλυσίδα 1: GTTGAATTCTTAGCTTAAGTCGGGCATGAATTCTC Αλυσίδα 2: CAACTTAAGAATCGAATTCAGCCCGTACTTAAGAG 3. To παραπάνω τµήµα DNA κόβεται µε το ένζυµο EcoRI, προκειµένου να ενσωµατωθεί σε ένα από τα δύο πλασµίδια Α και Β που δίνονται παρακάτω. Ποιο από τα δύο πλασµίδια θα επιλέξετε για τη δηµιουργία ανασυνδυασµένου πλασµιδίου (µονάδα 1); Να αιτιολογήσετε την απάντησή σας (µονάδες 4). Πόσοι φωσφοδιεστερικοί δεσµοί θα διασπαστούν στο πλασµίδιο που επιλέξατε και πόσοι θα δηµιουργηθούν κατά το σχηµατισµό του ανασυνδυασµένου πλασµιδίου (µονάδες 2); Μονάδες ΕΣΠΕΡΙΝΟ ΘΕΜΑ ίνεται το παρακάτω πεπτίδιο που παράγεται από ένα βακτήριο: HOOC µεθειονίνη αλανίνη σερίνη ασπαραγίνη µεθειονίνη NH 2 1. Να γράψετε το τµήµα του δίκλωνου DNA που κωδικοποιεί το παραπάνω πεπτίδιο (µονάδες 2). Να ορίσετε το 5 και 3 άκρο κάθε αλυσίδας (µονάδες 2) και να αιτιολογήσετε την απάντησή σας (µονάδες 4). Να καθορίσετε την κωδική και τη µη κωδική αλυσίδα (µονάδες 2) και να αιτιολογήσετε την απάντησή σας (µονάδες 5). ίνονται τα κωδικόνια : 1 ο ΓΕΝΙΚΟ ΛΥΚΕΙΟ ΗΡΑΚΛΕΙΟΥ - ΚΑΠΕΤΑΝΑΚΕΙΟ 7

8 αλανίνη GCU, ασπαραγίνη AAU, µεθειονίνη AUG, σερίνη UCU. Το κωδικόνιο λήξης είναι το: UGA. Μονάδες Μπορεί η παραπάνω αλυσίδα να κοπεί από την περιοριστική ενδονουκλεάση EcoRI (µονάδες 1); Να αιτιολογήσετε την απάντησή σας (µονάδες 4) ΗΜΕΡΗΣΙΟ ΕΠΑΝΑΛΗΠΤΙΚΑ Α5. Να γράψετε στο τετράδιό σας τα γράµµατα της Στήλης Ι και, δίπλα σε κάθε γράµµα, έναν από τους αριθµούς της Στήλης ΙΙ, ώστε να προκύπτει η σωστή αντιστοίχιση. (Ένα στοιχείο της Στήλης ΙI περισσεύει). Στήλη Ι Στήλη ΙΙ α. Αντιγραφή 1. πολύσωµα β. Μεταγραφή 2. DNA πολυµεράση γ. Ωρίµανση 3. EcoRI δ. Μετάφραση 4. απαµινάση της αδενοσίνης ε. Κόψιµο του DNA. 5. RNA πολυµεράση 6. µικρά ριβονουκλεοπρωτεϊνικά σωµατίδια. Γ. Ένα πλασµίδιο, που χρησιµοποιείται ως φορέας κλωνοποίησης ενός τµήµατος DNA, έχει ένα γονίδιο ανθεκτικότητας στο u945 αντιβιοτικό αµπικιλίνη και ένα γονίδιο ανθεκτικότητας στο αντιβιοτικό τετρακυκλίνη. Το γονίδιο ανθεκτικότητας στην τετρακυκλίνη περιέχει την αλληλουχία που αναγνωρίζεται από την περιοριστική ενδονουκλεάση EcoRI. ηµιουργούµε ανασυνδυασµένα πλασµιδία µε τη χρήση της περιοριστικής ενδονουκλεάσης EcoRI. Τα ανασυνδυασµένα πλασµίδια χρησιµοποιήθηκαν για το µετασχηµατισµό βακτηρίων που δεν είχαν κανένα πλασµίδιο. Στη συνέχεια τα βακτήρια καλλιεργούνται σε θρεπτικό υλικό. Γ1. Ποια βακτήρια επιζούν, αν στο θρεπτικό υλικό της καλλιέργειας προσθέσουµε το αντιβιοτικό αµπικιλίνη (µονάδα 1); Να αιτιολογήσετε την απάντησή σας (µονάδες 5). Γ2. Ποια βακτήρια επιζούν, αν στο θρεπτικό υλικό της καλλιέργειας προσθέσουµε το αντιβιοτικό τετρακυκλίνη αντί της αµπικιλίνης (µονάδα 1); Να αιτιολογήσετε την απάντησή σας (µονάδες 5). 3. ίνεται το παρακάτω τµήµα DNA που περιέχει τα κωδικόνια που κωδικοποιούν τα επτά πρώτα αµινοξέα της φυσιολογικής β-πολυπεπτιδικής αλυσίδας της HbA. 5 GTG CAC CTG ACT CCT GAG GAG 3 3 CAC GTG GAC TGA GGA CTC CTC 5 Η περιοριστική ενδονουκλεάση DdeI αναγνωρίζει την αλληλουχία 5 CTGAG 3 3 GACTC 5 και κόβει κάθε αλυσίδα µεταξύ του C και του Τ (µε κατεύθυνση 5 3 ). Η αλληλουχία που αναγνωρίζει η DdeI βρίσκεται στο παραπάνω τµήµα DNA. Από ένα άτοµο φορέα της δρεπανοκυτταρικής αναιµίας αποµονώθηκαν τµήµατα DNA, που περιέχουν τα κωδικόνια τα οποία κωδικοποιούν τα επτά πρώτα αµινοξέα της β-πολυπεπτιδικής αλυσίδας. Στα τµήµατα αυτά επιδράσαµε µε την περιοριστική ενδονουκλεάση DdeI. Πόσα τµήµατα DNA διαφορετικού µήκους θα προκύψουν µετά τη δράση της DdeI (µονάδα 1); Να αιτιολογήσετε την απάντησή σας (µονάδες 6). Μονάδες ΟΜΟΓΕΝΕΙΣ B4. Ποια διαδικασία ονοµάζεται αποδιάταξη και πώς µπορεί αυτή να πραγµατοποιηθεί; 2013 ΗΜΕΡΗΣΙΟ ΘΕΜΑ Παρακάτω σας δίνονται τέσσερις µονόκλωνες αλυσίδες DNA: 1 ο ΓΕΝΙΚΟ ΛΥΚΕΙΟ ΗΡΑΚΛΕΙΟΥ - ΚΑΠΕΤΑΝΑΚΕΙΟ 8

9 1. 5 -AAATGAAACCAGGATAAG AATTCGGGGGGC AATTCTTATCCTGGTTTCATTT AATTGCCCCCCG-3 Οι αλυσίδες αυτές τοποθετούνται σε κατάλληλο περιβάλλον υβριδοποίησης. 1. Να γράψετε τα µόρια DNA που θα προκύψουν µετά την υβριδοποίηση, τα οποία θα ονοµάσετε υβριδοποιηµένο µόριο 1 και υβριδοποιηµένο µόριο 2. Μονάδες 2 2. Στο ένα από τα δύο υβριδοποιηµένα µόρια DNA που θα προκύψουν εµπεριέχεται γονίδιο, το οποίο κωδικοποιεί ένα ολιγοπεπτίδιο. Να γράψετε το mrna που θα προκύψει (µονάδα 1) και να αιτιολογήσετε την απάντησή σας (µονάδες 2). Μονάδες 3 3. Το πεπτίδιο που προκύπτει από τη µετάφραση του παραπάνω mrna είναι: H 2 N Μεθειονίνη Λυσίνη Προλίνη Γλυκίνη COOH Ποιο είναι το αντικωδικόνιο του trna που θα τοποθετηθεί στο ριβόσωµα µετά την αποσύνδεση του trna, το οποίο µεταφέρει το αµινοξύ λυσίνη (µονάδες 2); Να αιτιολογήσετε την απάντησή σας (µονάδες 6). Μονάδες 8 4. Στα υβριδοποιηµένα µόρια 1 και 2 προστίθεται το ένζυµο DNA δεσµάση. Να γράψετε τα πιθανά ανασυνδυασµένα µόρια DNA που θα προκύψουν από την δράση της DNA δεσµάσης, σηµειώνοντας τους προσανατολισµούς των αλυσίδων (µονάδες 4) και αιτιολογώντας την απάντησή σας (µονάδες 4). Εάν στη συνέχεια προστεθεί η περιοριστική ενδονουκλεάση EcoRI, να εξηγήσετε πόσα τµήµατα DNA θα προκύψουν (µονάδες 4). Μονάδες ΗΜΕΡΗΣΙΟ ΕΠΑΝΑΛΗΠΤΙΚΑ Α2. Η σύνθεση ενός µορίου cdna καταλύεται από το ένζυµο α. περιοριστική ενδονουκλεάση β. DNA δεσµάση γ. αντίστροφη µεταγραφάση δ. DNA ελικάση ΗΜΕΡΗΣΙΟ Α3. Η εισαγωγή ανασυνδυασµένου DNA σε βακτήριο-ξενιστή ονοµάζεται α. µικροέγχυση β. µετασχηµατισµός γ. εµβολιασµός δ. κλωνοποίηση ΗΜΕΡΗΣΙΟ ΕΠΑΝΑΛΗΠΤΙΚΑ ΘΕΜΑ Στην Εικόνα 1 δίνεται ένα πλασµίδιο που φέρει γονίδια ανθεκτικότητας στα αντιβιοτικά αµπικιλίνη Εικόνα 1 και στρεπτοµυκίνη, έναν υποκινητή και αλληλουχίες λήξης της µεταγραφής. Στις θέσεις Α, Β, Γ 1 ο ΓΕΝΙΚΟ ΛΥΚΕΙΟ ΗΡΑΚΛΕΙΟΥ - ΚΑΠΕΤΑΝΑΚΕΙΟ 9

10 και βρίσκονται αλληλουχίες, οι οποίες αναγνωρίζονται από τις περιοριστικές ενδονουκλεάσες α, β, γ και δ αντίστοιχα. Το πλασµίδιο αυτό το χρησιµοποιούµε ως φορέα για την κλωνοποίηση ενός ανθρώπινου συνεχούς γονιδίου µε σκοπό να παράγουµε ένα ολιγοπεπτίδιο σε καλλιέργειες in vitro. Στα βακτήρια που θα χρησιµοποιηθούν για τον µετασχηµατισµό περιέχονται όλοι οι µεταγραφικοί παράγοντες που απαιτούνται για τη µεταγραφή και δεν περιέχονται πλασµίδια. 1. Ποια από τις περιοριστικές ενδονουκλεάσες α, β, γ ή δ είναι η κατάλληλη για τη χρήση του πλασµιδίου αυτού ως φορέα κλωνοποίησης; (µονάδα 1) Να αιτιολογήσετε την απάντησή σας. (µονάδες 3) Μονάδες 4 2. Με ποιον τρόπο µπορούµε να επιλέξουµε τους βακτηριακούς κλώνους που έχουν προσλάβει πλασµίδιο (ανασυνδυασµένο ή µη) από τους κλώνους που δεν έχουν προσλάβει πλασµίδιο; Να αιτιολογήσετε την απάντησή σας. Μονάδες 3 Στην Εικόνα 2 δίνεται τµήµα DNA το οποίο περιέχει το συνεχές ανθρώπινο γονίδιο που επιθυµούµε να εισαγάγουµε στο πλασµίδιο της Εικόνας Να εντοπίσετε την κωδική αλυσίδα του γονιδίου της Εικόνας 2. (µονάδα 1) Να γράψετε το mrna και να σηµειώσετε τον προσανατολισµό του. (µονάδες 2) Nα αιτιολογήσετε την απάντησή σας. (µονάδες 4) Μονάδες 7 4. Σύµφωνα µε την Εικόνα 2, να γράψετε την αλληλουχία µήκους έξι ζευγών βάσεων που αναγνωρίζει η περιοριστική ενδονουκλεάση, την οποία προσδιορίσατε στο ερώτηµα 1, για την κλωνοποίηση του γονιδίου. 5. Να εξηγήσετε γιατί η κλωνοποίηση του γονιδίου της Εικόνας 2 στο πλασµίδιο της Εικόνας 1 µπορεί να οδηγήσει i) στη δηµιουργία βακτηριακών κλώνων που παράγουν το ολιγοπεπτίδιο και ii) στη δηµιουργία βακτηριακών κλώνων που δεν παράγουν το ολιγοπεπτίδιο παρόλο που περιέχουν το ανασυνδυασµένο πλασµίδιο. Α 3. Μια γονιδιωµατική βιβλιοθήκη περιέχει α. το σύνολο του ώριµου mrna ενός οργανισµού β. το σύνολο του DNA ενός οργανισµού γ. αντίγραφα ενός µόνο ανασυνδυασµένου πλασµιδίου δ. αντίγραφα όλων των cdna ενός κυττάρου ΗΜΕΡΗΣΙΟ ΕΠΑΝΑΛΗΠΤΙΚΑ ΘΕΜΑ Στην εικόνα 2 απεικονίζεται ένα ασυνεχές γονίδιο ανθρώπινου ηπατικού κυττάρου. Το γονίδιο αυτό είναι υπεύθυνο για την παραγωγή του ολιγοπεπτιδίου της εικόνας 3. 1 ο ΓΕΝΙΚΟ ΛΥΚΕΙΟ ΗΡΑΚΛΕΙΟΥ - ΚΑΠΕΤΑΝΑΚΕΙΟ 10

11 1. Να εντοπίσετε και να γράψετε την αλληλουχία βάσεων του εσωνίου του γονιδίου της εικόνας 2 (µονάδες 2). Να αιτιολογήσετε την απάντησή σας (µονάδες 4). 2. Να γράψετε το πρόδροµο µόριο του mrna που δηµιουργείται από την µεταγραφή του γονιδίου της εικόνας 2 (µονάδα 1). Να γράψετε το ώριµο mrna που προκύπτει από τη διαδικασία της ωρίµανσης (µονάδες 2). Μονάδες 3 Ένας ερευνητής θέλει να κλωνοποιήσει το γονίδιο της εικόνας 2 για να το µελετήσει. Επίσης, θέλει να κλωνοποιήσει το ίδιο γονίδιο, για την παραγωγή του ολιγοπεπτιδίου της εικόνας 3, από βακτηριακή καλλιέργεια σε µεγάλη ποσότητα. 3. Τι είδους βιβλιοθήκη θα πρέπει να κατασκευάσει σε καθεµία περίπτωση (µονάδες 2); Να αιτιολογήσετε την απάντησή σας (µονάδες 4). Ο ίδιος ερευνητής έχει στην διάθεσή του µια γονιδιωµατική βιβλιοθήκη και µία cdna βιβλιοθήκη ανθρώπινων ηπατικών κυττάρων και τα δύο µόρια ανιχνευτές Α και Β της εικόνας Να διερευνήσετε την καταλληλότητα του ανιχνευτή Α και του ανιχνευτή Β να εντοπίζει σε κάθε µια από τις δύο βιβλιοθήκες τον βακτηριακό κλώνο που περιέχει το υπεύθυνο γονίδιο για τη σύνθεση του ολιγοπεπτιδίου της εικόνας Να εξηγήσετε γιατί ο αριθµός των αµινοξέων του ολιγοπεπτιδίου της εικόνας 3 είναι διαφορετικός από τον αριθµό των κωδικονίων του ώριµου mrna από το οποίο προκύπτει. Μονάδες 4 ίνονται: 2015 ΗΜΕΡΗΣΙΟ Β3. Σήµερα µπορούµε να κατασκευάσουµε στο δοκιµαστικό σωλήνα ένα «ανασυνδυασµένο» µόριο DNA. Τι είναι το ανασυνδυασµένο µόριο DNA; Μονάδες ΕΣΠΕΡΙΝΟ Α5. Οι περιοριστικές ενδονουκλεάσες α. παράγονται φυσιολογικά από ευκαρυωτικά κύτταρα β. αναγνωρίζουν και κόβουν µόρια DΝΑ σε συγκεκριµένες αλληλουχίες γ. παράγονται από ιούς δ. εισάγονται στα βακτήρια από βακτηριοφάγους ΟΜΟΓΕΝΕΙΣ A2. Η περιοριστική ενδονουκλεάση EcoRI α. αναγνωρίζει ειδικές αλληλουχίες δίκλωνου DNA β. κόβει µονόκλωνα µόρια DNA γ. παράγεται από ευκαρυωτικά κύτταρα δ. αναγνωρίζει ειδικές αλληλουχίες RNA. A3. Η σύνδεση µονόκλωνων συµπληρωµατικών αλυσίδων DNA ονοµάζεται α. αποδιάταξη β. µετασχηµατισµός γ. υβριδοποίηση 1 ο ΓΕΝΙΚΟ ΛΥΚΕΙΟ ΗΡΑΚΛΕΙΟΥ - ΚΑΠΕΤΑΝΑΚΕΙΟ 11

12 δ. κλωνοποίηση ΗΜΕΡΗΣΙΟ ΕΠΑΝΑΛΗΠΤΙΚΑ Β5. Να ορίσετε τα ακόλουθα: α. Μετασχηµατισµός βακτηρίων (µονάδες 2) β. Γονιδιωµατική βιβλιοθήκη (µονάδες 3) γ. Φορέας κλωνοποίησης (µονάδες 6) ΕΣΠΕΡΙΝΟ 2016 ΟΜΟΓΕΝΕΙΣ B4. Τι είναι η αποδιάταξη και τι η υβριδοποίηση των νουκλεϊκών οξέων; Μονάδες 4 ΘΕΜΑ Το τµήµα βακτηριακού DNA της εικόνας 2 περιέχει γονίδιο που κωδικοποιεί ολιγοπεπτίδιο. Το ίδιο τµήµα DNA της εικόνας 2 µπορεί να κοπεί µε µία περιοριστική ενδονουκλεάση Α η οποία αναγνωρίζει την αλληλουχία και κόβει µεταξύ G-G, όπως φαίνεται στην εικόνα Να γράψετε το τµήµα του βακτηριακού DNA που θα προκύψει µετά τη δράση της περιοριστικής ενδονουκλεάσης Α (µονάδες 4). Να σηµειώσετε τα 5 και 3 άκρα των αλυσίδων (µονάδες 4). Μονάδες 8 2. Να εξηγήσετε ποια από τις αλυσίδες I ή II είναι η κωδική αλυσίδα του γονιδίου. 3. Να γράψετε τον αριθµό των t-rna που θα χρησιµοποιηθούν για τη µετάφραση του m-rna που προκύπτει από τη µεταγραφή του γονιδίου της εικόνας 2 (µονάδες 2). Να γράψετε τα αντικωδικόνια µε τα σωστά άκρα των δυο πρώτων t-rna που χρησιµοποιήθηκαν (µονάδες 4). 4. Αν συµβεί αντικατάσταση βάσης στο 3 ο νουκλεοτίδιο του 2 ου κωδικονίου της κωδικής αλυσίδας και η κυτοσίνη (C) αντικατασταθεί µε γουανίνη (G), ποια θα είναι η επίπτωση της µετάλλαξης αυτής στο γονιδιακό προϊόν; 1 ο ΓΕΝΙΚΟ ΛΥΚΕΙΟ ΗΡΑΚΛΕΙΟΥ - ΚΑΠΕΤΑΝΑΚΕΙΟ 12

13 ΘΕΜΑΤΑ ΟΕΦΕ ΣΤΟ 3 Ο ΚΕΦΑΛΑΙΟ (ΤΕΧΝΟΛΟΓΙΑ ΑΝΑΣΥΝ ΥΑΣΜΕΝΟΥ DNA) Ο σχεδόν καθολικός χαρακτήρας του γενετικού κώδικα βρίσκει σήµερα εφαρµογή: α. στην αλυσιδωτή αντίδραση πολυµεράσης β. στην κατασκευή ανασυνδυασµένου DNA κατά τη γονιδιακή θεραπεία γ. στην κατασκευή c DNA βιβλιοθήκης. δ. στην παραγωγή φαρµακευτικών πρωτεϊνών από διαγονιδιακά ζώα 4. Η µέθοδος της αλυσιδωτής αντίδρασης πολυµεράσης επιτρέπει την επιλεκτική αντιγραφή µίας ειδικής αλληλουχίας DNA από ένα σύνθετο µίγµα µορίων DNA και τη δηµιουργία κλώνου µεγάλου αριθµού αντιγράφων της αλληλουχίας αυτής. (Σ-Λ) 2. Η επώαση ενός µορίου DNA µε µία περιοριστική ενδονουκλεάση δηµιουργεί διαφορετικό αριθµό θραυσµάτων από εκείνον που προκύπτει από την επώαση ενός µορίου DNA του οµόλογου χρωµοσώµατος µε την ίδια περιοριστική ενδονουκλεάση. Για ποιο λόγο συµβαίνει αυτό; (3 µονάδες) ΘΕΜΑ 3 ο Α. Ένα εργαστήριο γενετικής χρησιµοποιούσε συστηµατικά ένα στέλεχος της Escherichia coli ως δότη του πλασµιδίου που χρειάζονται οι επιστήµονες για να δηµιουργήσουν γονιδιωµατικές βιβλιοθήκες. Μετά από κάποιο χρονικό διάστηµα, το πλασµίδιο κρίθηκε ως ακατάλληλος φορέας κλωνοποίησης και έπαψε να χρησιµοποιείται. 1. Ποιος είναι ο ρόλος του φορέα κλωνοποίησης στην ανάπτυξη της γονιδιωµατικής βιβλιοθήκης; Γνωρίζεται άλλον φορέα κλωνοποίησης εκτός από τα πλασµίδια; Ποια τα πλεονεκτήµατα του καθενός; (5 µονάδες) 2. Μπορείτε εσείς να υποθέσετε τι συνέβη στο στέλεχος αυτό, που κατέστησε το πλασµίδιό του ακατάλληλο ως φορέα κλωνοποίησης; (8 µονάδες) 2004 ΘΕΜΑ 4 Ο γονιδίου είναι η µη κωδική; Στα ακόλουθα σχήµατα παριστάνονται: τµήµα DNA προκαρυωτικού κυττάρου, στο οποίο περιέχεται ένα γονίδιο και ο υποκινητής του (α) πλασµίδιο που πρόκειται να χρησιµοποιηθεί ως φορέας κλωνοποίησης του εν λόγω γονιδίου για την παραγωγή της πρωτεΐνης που κωδικοποιεί στο κυτταρόπλασµα βακτηρίου-ξενιστή (β). Το σηµείο Ε υποδηλώνει τη θέση αναγνώρισης της περιοριστικής ενδονουκλεάσης EcoRI. Στο τµήµα DNA απεικονίζονται τα µονόκλωνα άκρα που αναγνωρίζει και κόβει η EcoRI. Τα σηµεία Β, Ν και Η υποδεικνύουν επιπλέον τις θέσεις αναγνώρισης των περιοριστικών ενδονουκλεασών BamHI, NotI και HindIII αντίστοιχα. Να απαντήσετε στα ερωτήµατα: i) Ποια από τις δύο αλυσίδες του 1 ο ΓΕΝΙΚΟ ΛΥΚΕΙΟ ΗΡΑΚΛΕΙΟΥ - ΚΑΠΕΤΑΝΑΚΕΙΟ 13

14 Μονάδες 3 Να δικαιολογήσετε την απάντησή σας. Μονάδες 7 ii) Ποιο από τα τέσσερα ένζυµα είναι καταλληλότερο για τη δηµιουργία ανασυνδυασµένου DNA; Μονάδες 3 Να δικαιολογήσετε την απάντησή σας. Μονάδες Σε cdna βιβλιοθήκη παγκρεατικού κυττάρου περιέχεται ο κλώνος του γονιδίου της α1- αντιθρυψίνης ενώ στη cdna βιβλιοθήκη ηπατικού κυττάρου περιέχεται ο κλώνος του γονιδίου της ινσουλίνης Στην κατασκευή της γονιδιωµατικής βιβλιοθήκης τα αντιβιοτικά χρησιµοποιούνται για την επιλογή του βακτηριακού κλώνου που περιέχει ένα επιθυµητό γονίδιο. (Σ-Λ) Η σύνδεση του µορίου ανιχνευτή µε συµπληρωµατική αλληλουχία του κλωνοποιηµένου DNA ονοµάζεται υβριδοποίηση. (Σ-Λ) 2006 Οι περιοριστικές ενδονουκλεάσες: α. συνδέουν τµήµατα του ανασυνδυασµένου DNA µε 3-5 φωσφοδιεστερικό δεσµό β. αναγνωρίζουν και κόβουν µονόκλωνες πολυνουκλεοτιδικές αλυσίδες DNA, σε ειδικές θέσεις γ. σπάζουν τους δεσµούς υδρογόνου µεταξύ των βάσεων Α και G δ. παράγονται από τα βακτήρια και ο φυσιολογικός τους ρόλος είναι να τα προστατεύουν από την εισβολή «ξένου» DNA Με ποιο τρόπο τα ανασυνδυασµένα πλασµίδια εισάγονται στα βακτήρια και πώς στη συνέχεια επιλέγουµε τα βακτήρια που δέχθηκαν το ανασυνδυασµένο πλασµίδιο; 2007 Α. Η Γενετική Μηχανική συµβάλλει στη βελτίωση της υγείας και του τρόπου διαβίωσης του ανθρώπου, στηριζόµενη σε µεγάλο ποσοστό στη χρήση βακτηρίων. Να εξηγήσετε το ρόλο των βακτηρίων στην επίτευξη των παραπάνω στόχων της Γενετικής Μηχανικής. (Μονάδες 15) 2008 Για την κατασκευή cdna βιβλιοθήκης δεν χρησιµοποιείται το ένζυµο: Α. αντίστροφη µεταγραφάση Β. DNA ελικάση Γ. περιοριστική ενδονουκλεάση. DNA πολυµεράση Με τη βοήθεια των αντιβιοτικών σε µια βιβλιοθήκη επιλέγονται οι µετασχηµατισµένοι κλώνοι από τους µη µετασχηµατισµένους.(σ-λ) Ποια µόρια ονοµάζονται ανιχνευτές και ποιος είναι ο ρόλος τους στην τεχνολογία του ανασυνδυασµένου DNA; 2009 Η εισαγωγή ενός ανασυνδυασµένου πλασµιδίου µέσα σε βακτήριο ονοµάζεται: A. κατασκευή ανασυνδυασµένου µορίου DNA B. κατασκευή γονιδιωµατικής βιβλιοθήκης Γ. µικροέγχυση. µετασχηµατισµός Η µέθοδος PCR (αλυσιδωτή αντίδραση πολυµεράσης) επιτρέπει να αντιγραφούν επιλεκτικά ειδικές αλληλουχίες DNA µε τη µεσολάβηση κατάλληλου ζωντανού φορέα κλωνοποίησης. (Σ-Λ) ΘΕΜΑ 3 ο 1 ο ΓΕΝΙΚΟ ΛΥΚΕΙΟ ΗΡΑΚΛΕΙΟΥ - ΚΑΠΕΤΑΝΑΚΕΙΟ 14

15 Μοριακός βιολόγος, προκειµένου να παρασκευάσει ινσουλίνη από ανθρώπινα κύτταρα του παγκρέατος, κατασκεύασε cdna βιβλιοθήκη, χρησιµοποιώντας ως κύτταρο - ξενιστή το βακτήριο E. coli. Για τον σκοπό αυτό επιλέγει από τη βιβλιοθήκη τον κλώνο µε το επιθυµητό γονίδιο και εµβολιάζει εργαστηριακή καλλιέργεια χρησιµοποιώντας ως πηγή άνθρακα τον δισακχαρίτη λακτόζη. 1. Με ποιο τρόπο πραγµατοποιείται η επιλογή του βακτηριακού κλώνου που περιέχει το επιθυµητό γονίδιο της προϊνσουλίνης από τη cdna βιβλιοθήκη; Μονάδες ΘΕΜΑ 3 Ο Β. Το πλασµίδιο που απεικονίζεται στο σχήµα χρησιµοποιείται ως φορέας κλωνοποίησης µε τη χρήση µίας περιοριστικής ενδονουκλεάσης. Στο σχήµα απεικονίζονται επίσης δύο γονίδια ανθεκτικότητας σε αντιβιοτικά που φέρει το πλασµίδιο, οι υποκινητές τους, η θέση έναρξης αντιγραφής του και οι θέσεις που τέµνουν το πλασµίδιο οι περιοριστικές ενδονουκλεάσες Ν και Ζ. Αντλώντας πληροφορίες από το σχήµα, να εξηγήσετε ποια περιοριστική ενδονουκλεάση (Ν ή Ζ) είναι κατάλληλη για την κατασκευή του ανασυνδυασµένου πλασµιδίου. Επίσης, να εξηγήσετε τον τρόπο µε τον οποίο επιλέγονται τα βακτήρια που µετασχηµατίζονται µε το εν λόγω πλασµίδιο από εκείνα που δεν δέχθηκαν πλασµίδιο. Μονάδες A1. Για την ανίχνευση της αλληλουχίας 5 GGACTCAAGTTTACATGCAACGTACGG...3 που περιέχεται σε γονιδιωµατική βιβλιοθήκη είναι κατάλληλος ο: α. Ανιχνευτής 1: 5 -TCAACAAATG-3 β. Ανιχνευτής 2: 5 -TTTGAACTCA-3 γ. Ανιχνευτής 3: 5 -UUCAAAUGUA-3 δ. Ανιχνευτής 4: 5 -CGUACGUUGC-3 Α3. Σε ένα ανασυνδυασµένο πλασµίδιο που σχηµατίστηκε µε την επίδραση της EcoRΙ, η αλληλουχία που αναγνωρίζει η συγκεκριµένη περιοριστική ενδονουκλεάση υπάρχει: α. καµία φορά β. µία φορά γ. δύο φορές δ. τέσσερις φορές Β3. Τι είναι τα πλασµίδια, πώς χρησιµοποιούνται στην τεχνολογία του ανασυνδυασµένου DNA και για ποιες ιδιότητές τους; Ποια γονίδια γνωρίζετε ότι είναι δυνατό να υπάρχουν σε ένα πλασµίδιο; Μονάδες Α2. Για την κατασκευή cdna βιβλιοθήκης δεν χρησιµοποιείται το ένζυµο: α. αντίστροφη µεταγραφάση. β. DNA ελικάση. γ. περιοριστική ενδονουκλεάση. 1 ο ΓΕΝΙΚΟ ΛΥΚΕΙΟ ΗΡΑΚΛΕΙΟΥ - ΚΑΠΕΤΑΝΑΚΕΙΟ 15

16 δ. DNA πολυµεράση Για την παραγωγή ανθρώπινης ινσουλίνης από βακτήρια µε τη µέθοδο της cdna βιβλιοθήκης δεν χρησιµοποιείται: Α. Το γονίδιο της προϊνσουλίνης Β. Η DNA πολυµεράση Γ. Η αντίστροφη µεταγραφάση. Μόριο ανιχνευτής ΘΕΜΑ Από ανθρώπινο κύτταρο αποµονώθηκε ένα µόριο µιτοχονδριακού DNA, το οποίο φέρει 4 θέσεις αναγνώρισης από την ενδονουκλεάση EcoRI. Το µόριο υποβάλλεται in vitro σε 2 κύκλους αντιγραφής. 1.Πόσα µόρια µιτοχονδριακού DNA υπάρχουν µετά τους 2 κύκλους αντιγραφής; Να αιτιολογήσετε την απάντηση σας. ΜΟΝΑ ΕΣ 4 Στα αντίγραφα του µιτοχονδριακού DNA προστίθεται EcoRI. Ταυτόχρονα από βακτήρια αποµονώθηκαν 100 αντίγραφα ενός πλασµιδίου, κατάλληλου για την τεχνική της κλωνοποίησης, που φέρει ένα γονίδιο ανθεκτικότητας στο αντιβιοτικό στρεπτοµυκίνη και µία θέση αναγνώρισης από την EcoRI, εκτός της αλληλουχίας του γονιδίου ανθεκτικότητας. Στα πλασµίδια προστίθεται EcoRI και στη συνέχεια αυτά αναµιγνύονται µε τα θραύσµατα από το µιτοχονδριακό DNA και DNA δεσµάση. Κάθε θραύσµα µιτοχονδριακού DNA ενσωµατώνεται σε πλασµίδιο. 2.Πόσα ανασυνδυασµένα και πόσα µη ανασυνδυασµένα πλασµίδια δηµιουργούνται; Να αιτιολογήσετε την απάντηση σας. ΜΟΝΑ ΕΣ 4 Όλα τα πλασµίδια που προκύπτουν µεταφέρονται σε αποικία βακτηρίων µε κατάλληλο θρεπτικό υλικό και επωάζονται σε κατάλληλη θερµοκρασία για 72 ώρες παρουσία του αντιβιοτικού στρεπτοµυκίνη. Κάθε πλασµίδιο εισέρχεται σε ένα βακτήριο. 3.Πόσοι βακτηριακοί κλώνοι υπάρχουν στην καλλιέργεια µετά την επώαση; Να αιτιολογήσετε την απάντηση σας. ΜΟΝΑ ΕΣ 4 Η ανάλυση βάσεων σε ένα από τα θραύσµατα του µιτοχονδριακού DNA έδειξε ότι περιέχεται η αλληλουχία βάσεων: Η αλληλουχία περιέχει ένα ακέραιο συνεχές γονίδιο που κωδικοποιεί πεπτίδιο, τµήµα ενός άλλου γονιδίου, που επίσης κωδικοποιεί πεπτίδιο, καθώς και τους υποκινητές τους (οι οποίοι υποδεικνύονται µε έντονα γράµµατα). 4. Να εξηγήσετε ποιος είναι ο υποκινητής (1 ή 2) του ακέραιου γονιδίου και να γράψετε την αλληλουχία των αµινοξέων του πεπτιδίου που κωδικοποιεί το εν λόγω γονίδιο. 5.Να γράψετε την αλληλουχία των πρώτων τεσσάρων αµινοξέων του πεπτιδίου που κωδικοποιεί το µη ακέραιο γονίδιο, χωρίς να αιτιολογήσετε την απάντησή σας. 6.Η ανάλυση του µιτοχονδριακού DNA ενός άνδρα και µιας γυναίκας έδειξε ότι έχουν πανοµοιότυπη αλληλουχία βάσεων. Να γράψετε δύο πιθανές συγγενικές σχέσεις που µπορεί να έχουν τα άτοµα αυτά και να αιτιολογήσετε την απάντησή σας. ΜΟΝΑ ΕΣ 13 (7+2+4) 2015 Α1. Σε ανασυνδυασµένο πλασµίδιο που έχει δηµιουργηθεί µε τη δράση της EcoRI η αλληλουχία που αναγνωρίζεται από το ένζυµο αυτό υπάρχει: α. Μόνο µια φορά. β. ύο φορές. 1 ο ΓΕΝΙΚΟ ΛΥΚΕΙΟ ΗΡΑΚΛΕΙΟΥ - ΚΑΠΕΤΑΝΑΚΕΙΟ 16

17 γ. Πολλές φορές. δ. Ισχύουν όλα τα παραπάνω. Α5. Το µόριο του cdna σε σχέση µε το µόριο του mrna που χρησιµοποιήθηκε ως καλούπι για τη σύνθεση αυτού: α. Είναι συµπληρωµατικό και αντιπαράλληλο. β. Έχουν την ίδια αλληλουχία αζωτούχων βάσεων. γ. Είναι συµπληρωµατικό, αλλά όχι αντιπαράλληλο. δ. Είναι συµπληρωµατικό και αντιπαράλληλο, δεδοµένου ότι κατά τη σύνθεση του cdna εφαρµόστηκε ο κανόνας της συµπληρωµατικότητας από το ένζυµο DNA πολυµεράση Α3. Τµήµα ενός γονιδίου που αντιστοιχεί στην 5' αµετάφραστη περιοχή ενός µορίου RNA µπορεί να βρεθεί: α. µόνο σε cdna βιβλιοθήκες. β. µόνο σε γονιδιωµατικές βιβλιοθήκες. γ. και σε γονιδιωµατικές και σε cdna βιβλιοθήκες. δ. σε κανένα από τα παραπάνω. Α4. Κατά τη δηµιουργία ανασυνδυασµένου πλασµιδίου µε τη βοήθεια της περιοριστικής ενδονουκλεάσης EcoRI, η DNA δεσµάση, όταν ενώνει τµήµα του DNA του δότη στο πλασµίδιο, καταλύει τη δηµιουργία: α. δύο φωσφοδιεστερικών δεσµών και οκτώ δεσµών υδρογόνου. β. τεσσάρων φωσφοδιεστερικών δεσµών και οκτώ δεσµών υδρογόνου. γ. οκτώ φωσφοδιεστερικών δεσµών και τριάντα δύο δεσµών υδρογόνου. δ. τεσσάρων φωσφοδιεστερικών δεσµών και δεκαέξι δεσµών υδρογόνου. Α4. Η περιοριστική ενδονουκλεάση EcoRI αποτελείται από: α. δεοξυριβονουκλεοτίδια β. αµινοξέα γ. Ριβονουκλεοτίδια Β2. Με την αποδιάταξη του γενετικού υλικού ανθρώπινου σωµατικού κυττάρου, πόσες πολυνουκλεοτιδικές αλυσίδες προκύπτουν; Αιτιολογείστε την απάντησή σας. Β3. Σε τµήµα DNA ενός χλωροπλάστη, που πρόκειται να κλωνοποιηθεί, η αλληλουχία που αναγνωρίζει και κόβει η περιοριστική ενδονουκλεάση EcoRI συναντάται τέσσερις φορές. α. Πόσα κοµµάτια του DNA αυτού θα προκύψουν µετά τη δράση της; β. Αν τα κοµµάτια αυτά αναµειχθούν µε πλασµίδια τα οποία έχουν κοπεί µε την ίδια περιοριστική ενδονουκλεάση, πόσα είδη ανασυνδυασµένων πλασµιδίων θα προκύψουν; Ποια είναι η τύχη τους στη συνέχεια; Μονάδες (2+6) Β4. Ένα ηπατικό και ένα παγκρεατικό κύτταρο του ίδιου ανθρώπου: α. έχουν ίδιες ή διαφορετικές γονιδιωµατικές βιβλιοθήκες; β. έχουν ίδιες ή διαφορετικές cdna βιβλιοθήκες; Να αιτιολογήσετε τις απαντήσεις σας. Γ2. Έχουµε στην διάθεσή µας την γονιδιωµατική βιβλιοθήκη ενός ανθρώπου και την cdna βιβλιοθήκη ενός πρόδροµου ερυθροκυττάρου του ανθρώπου Σηµειώστε µε το σύµβολο (+) ή ( ) στις στήλες ΙΙ και ΙΙΙ το θετικό ή αρνητικό σήµα υβριδοποίησης αντίστοιχα, των µορίων ανιχνευτών της στήλης Ι 1 ο ΓΕΝΙΚΟ ΛΥΚΕΙΟ ΗΡΑΚΛΕΙΟΥ - ΚΑΠΕΤΑΝΑΚΕΙΟ 17

18 Στήλη Ι Στήλη ΙΙ Στήλη ΙΙΙ Ανιχνευτής 1 Γονιδίου της RNA πολυµεράσης 2 Γονιδίου αλυσίδων β της HbA 3 Γονιδίου σύνθεσης του αντιγόνου Α 4 1 ου εσωνίου γονιδίου αλυσίδων α της HbA 5 Υποκινητή γονιδίου αλυσίδων β της HbA Αλληλουχίας λήξης µεταγραφής του γονιδίου 6 αλυσίδων β της HbA 5 αµετάφραστης περιοχής του γονιδίου µιας 7 ιστόνης 8 Ανθρώπινου γονιδίου του trna σερίνης Ανθρώπινου γονιδίου rrna µικρής υποµονάδας 9 ριβοσώµατος 10 Γονιδίου της βακτηριακής RNA πολυµεράσης Γονιδιωµατική βιβλιοθήκη ανθρώπου cdna βιβλιοθήκη πρόδροµου ερυθροκυττάρου Μονάδες 10 1 ο ΓΕΝΙΚΟ ΛΥΚΕΙΟ ΗΡΑΚΛΕΙΟΥ - ΚΑΠΕΤΑΝΑΚΕΙΟ 18

ΘΕΜΑΤΑ ΠΑΝΕΛΛΗΝΙΩΝ ΕΞΕΤΑΣΕΩΝ ΣΤΗΝ ΤΕΧΝΟΛΟΓΙΑ ΑΝΑΣΥΝ ΥΑΣΜΕΝΟΥ DNA

ΘΕΜΑΤΑ ΠΑΝΕΛΛΗΝΙΩΝ ΕΞΕΤΑΣΕΩΝ ΣΤΗΝ ΤΕΧΝΟΛΟΓΙΑ ΑΝΑΣΥΝ ΥΑΣΜΕΝΟΥ DNA 1 ο ΓΕΝΙΚΟ ΛΥΚΕΙΟ ΗΡΑΚΛΕΙΟΥ ΘΕΜΑΤΑ ΠΑΝΕΛΛΗΝΙΩΝ ΕΞΕΤΑΣΕΩΝ ΣΤΗΝ ΤΕΧΝΟΛΟΓΙΑ ΑΝΑΣΥΝ ΥΑΣΜΕΝΟΥ DNA 2000 ΗΜΕΡΗΣΙΟ 5. Οι περιοριστικές ενδονουκλεάσες: α. συµµετέχουν στην ωρίµανση του RΝΑ β. είναι απαραίτητες

Διαβάστε περισσότερα

Θέματα Πανελλαδικών 2000-2013

Θέματα Πανελλαδικών 2000-2013 Θέματα Πανελλαδικών 2000-2013 ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΗΜΕΡΗΣΙΩΝ ΛΥΚΕΙΩΝ ΕΣΠΕΡΙΝΩΝ ΛΥΚΕΙΩΝ ΕΠΑΝΑΛΗΠΤΙΚΕΣ Κεφάλαιο 4 ΚΕΦΑΛΑΙΟ 4 ΘΕΜΑ 1 ο Γράψτε τον αριθμό καθεμιάς από τις παρακάτω προτάσεις και δίπλα το γράμμα

Διαβάστε περισσότερα

ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ

ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ ΠΕΙΡΑΜΑΤΙΚΟ ΕΝΙΑΙΟ ΛΥΚΕΙΟ ΠΑΝΕΠΙΣΤΗΜΙΟΥ ΜΑΚΕΔΟΝΙΑΣ ZAΡΦΤΖΙΑΝ ΜΑΡΙΛΕΝΑ ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ ΑΣΚΗΣΕΙΣ ΕΡΩΤΗΣΕΙΣ 4 ου ΚΕΦΑΛΑΙΟΥ 1.Τα παρακάτω στοιχεία να μπουν στην κατάλληλη στήλη ( ΣΥΓΚΡΙΣΗ ΓΟΝΙΔΙΩΜΑΤΙΚΗΣ

Διαβάστε περισσότερα

Θέματα Πανελλαδικών

Θέματα Πανελλαδικών Θέματα Πανελλαδικών 2000-2015 ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΗΜΕΡΗΣΙΩΝ ΛΥΚΕΙΩΝ ΕΣΠΕΡΙΝΩΝ ΛΥΚΕΙΩΝ ΕΠΑΝΑΛΗΠΤΙΚΕΣ ΟΜΟΓΕΝΩΝ Κεφάλαιο 4 Περιεχόμενα Περιεχόμενα 1 Κεφάλαιο 1 ο Το γενετικό υλικό Θέμα 1 ο 2 Θέμα 2 ο 8 Θέμα

Διαβάστε περισσότερα

ΘΕΜΑ 1 Ο ΜΑΘΗΜΑ / ΤΑΞΗ : ΑΠΑΝΤΗΣΕΙΣ ΒΙΟΛΟΓΙΑΣ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ ΣΕΙΡΑ: ΘΕΡΙΝΑ ΗΜΕΡΟΜΗΝΙΑ: 01/12/2013

ΘΕΜΑ 1 Ο ΜΑΘΗΜΑ / ΤΑΞΗ : ΑΠΑΝΤΗΣΕΙΣ ΒΙΟΛΟΓΙΑΣ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ ΣΕΙΡΑ: ΘΕΡΙΝΑ ΗΜΕΡΟΜΗΝΙΑ: 01/12/2013 ΜΑΘΗΜΑ / ΤΑΞΗ : ΑΠΑΝΤΗΣΕΙΣ ΒΙΟΛΟΓΙΑΣ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ ΣΕΙΡΑ: ΘΕΡΙΝΑ ΗΜΕΡΟΜΗΝΙΑ: 01/12/2013 ΘΕΜΑ 1 Ο Να επιλέξετε την φράση που συμπληρώνει ορθά κάθε μία από τις ακόλουθες προτάσεις: 1. Τα

Διαβάστε περισσότερα

Κεφάλαιο 4: Ανασυνδυασμένο DNA

Κεφάλαιο 4: Ανασυνδυασμένο DNA Κεφάλαιο 4: Ανασυνδυασμένο DNA 1. Η ανάπτυξη της γενετικής μηχανικής επέτρεψε: α. την κατανόηση των μηχανισμών αντιγραφής του γενετικού υλικού β. την απομόνωση των πλασμιδίων από τα βακτήρια γ. την πραγματοποίηση

Διαβάστε περισσότερα

ΘΕΜΑ Α Α1. γ Α2. γ Α3. α Α4. β Α5. β ΘΕΜΑ B B1. B2.

ΘΕΜΑ Α Α1. γ Α2. γ Α3. α Α4. β Α5. β ΘΕΜΑ B B1. B2. ΘΕΜΑ Α Α1. γ (το πριμόσωμα) Α2. γ (οι υποκινητές και οι μεταγραφικοί παράγοντες κάθε γονιδίου) Α3. α (μεταφέρει ένα συγκεκριμένο αμινοξύ στο ριβόσωμα) Α4. β (αποδιάταξη των δύο συμπληρωματικών αλυσίδων)

Διαβάστε περισσότερα

Ανακτήθηκε από την ΕΚΠΑΙΔΕΥΤΙΚΗ ΚΛΙΜΑΚΑ

Ανακτήθηκε από την ΕΚΠΑΙΔΕΥΤΙΚΗ ΚΛΙΜΑΚΑ ΑΡΧΗ 1ΗΣ ΣΕΛΙ ΑΣ Γ ΗΜΕΡΗΣΙΩΝ ΕΠΑΝΑΛΗΠΤΙΚΕΣ ΠΑΝΕΛΛΗΝΙΕΣ ΕΞΕΤΑΣΕΙΣ Γ ΤΑΞΗΣ ΗΜΕΡΗΣΙΟΥ ΓΕΝΙΚΟΥ ΛΥΚΕΙΟΥ ΕΥΤΕΡΑ 18 ΙΟΥΝΙΟΥ 2012 ΕΞΕΤΑΖΟΜΕΝΟ ΜΑΘΗΜΑ: ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ ΣΥΝΟΛΟ ΣΕΛΙ ΩΝ: ΠΕΝΤΕ (5) ΘΕΜΑ

Διαβάστε περισσότερα

Βιολογία προσανατολισμού

Βιολογία προσανατολισμού Βιολογία προσανατολισμού ΘΕΜΑ Α Στις προτάσεις από Α1-Α5 να βρείτε την σωστή απάντηση. Α1. Ένας ερευνητής απομόνωσε ένα ασυνεχές γονίδιο από το γονιδίωμα ανθρώπινων κυττάρων. Το γονίδιο συνδέθηκε με βακτηριακό

Διαβάστε περισσότερα

σύγχρονο προπαρασκευή για Α.Ε.Ι. & Τ.Ε.Ι. & Group µαθητικό φροντιστήριο Γραβιάς 85 ΚΗΠΟΥΠΟΛΗ

σύγχρονο προπαρασκευή για Α.Ε.Ι. & Τ.Ε.Ι. & Group µαθητικό φροντιστήριο Γραβιάς 85 ΚΗΠΟΥΠΟΛΗ σύγχρονο Φάσµα & Group προπαρασκευή για Α.Ε.Ι. & Τ.Ε.Ι. µαθητικό φροντιστήριο Γραβιάς 85 ΚΗΠΟΥΠΟΛΗ 210 50 51 557 210 50 56 296 25ης Μαρτίου 111 ΠΕΤΡΟΥΠΟΛΗ 210 50 20 990 210 50 27 990 25ης Μαρτίου 74 ΠΕΤΡΟΥΠΟΛΗ

Διαβάστε περισσότερα

ΜΑΘΗΜΑ / ΤΑΞΗ : ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΟΥ ΠΡΟΣΑΝΑΤΟΛΙΣΜΟΥ / Γ ΙΑΤΡ ΓΘΕΤ 2 ΗΜΕΡΟΜΗΝΙΑ: 20/03/2016 ΘΕΜΑ Α

ΜΑΘΗΜΑ / ΤΑΞΗ : ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΟΥ ΠΡΟΣΑΝΑΤΟΛΙΣΜΟΥ / Γ ΙΑΤΡ ΓΘΕΤ 2 ΗΜΕΡΟΜΗΝΙΑ: 20/03/2016 ΘΕΜΑ Α ΜΑΘΗΜΑ / ΤΑΞΗ : ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΟΥ ΠΡΟΣΑΝΑΤΟΛΙΣΜΟΥ / Γ ΙΑΤΡ ΓΘΕΤ 2 ΗΜΕΡΟΜΗΝΙΑ: 20/03/2016 ΘΕΜΑ Α 1. α 2. δ 3. γ 4. δ 5. γ. ΘΕΜΑ Β 1. Τα αντισώματα αποτελούν το πιο αποτελεσματικό φυσικό φάρμακο για την αντιμετώπιση

Διαβάστε περισσότερα

Με την ανάπτυξη αυτής της τεχνολογίας το DNA που ήταν τόσο δύσκολο να µελετηθεί έγινε «παιχνίδι» στα ανθρώπινα χέρια

Με την ανάπτυξη αυτής της τεχνολογίας το DNA που ήταν τόσο δύσκολο να µελετηθεί έγινε «παιχνίδι» στα ανθρώπινα χέρια ΚΕΦΑΛΑΙΟ 4ο: Η τεχνολογία του ανασυνδυασµένου DNA έδωσε στον άνθρωπο την ικανότητα όχι µόνο να ερευνά αλλά και να τροποποιεί το γενετικό υλικό των οργανισµών ΤΕΧΝΟΛΟΓΙΑ ΤΟΥ ΑΝΑΣΥΝ ΥΑΣΜΕΝΟΥ DNA Η τεχνολογία

Διαβάστε περισσότερα

Γ ΓΕΝΙΚΟΥ ΛΥΚΕΙΟΥ ΒΙΟΛΟΓΙΑ ΠΡΟΣΑΝΑΤΟΛΙΣΜΟΥ ΘΕΤΙΚΩΝ ΣΠΟΥΔΩΝ. Ημερομηνία: Κυριακή 23 Οκτωβρίου 2016 Διάρκεια Εξέτασης: 3 ώρες ΕΚΦΩΝΗΣΕΙΣ

Γ ΓΕΝΙΚΟΥ ΛΥΚΕΙΟΥ ΒΙΟΛΟΓΙΑ ΠΡΟΣΑΝΑΤΟΛΙΣΜΟΥ ΘΕΤΙΚΩΝ ΣΠΟΥΔΩΝ. Ημερομηνία: Κυριακή 23 Οκτωβρίου 2016 Διάρκεια Εξέτασης: 3 ώρες ΕΚΦΩΝΗΣΕΙΣ ΤΑΞΗ: ΜΑΘΗΜΑ: Γ ΓΕΝΙΚΟΥ ΛΥΚΕΙΟΥ ΒΙΟΛΟΓΙΑ ΠΡΟΣΑΝΑΤΟΛΙΣΜΟΥ ΘΕΤΙΚΩΝ ΣΠΟΥΔΩΝ Ημερομηνία: Κυριακή 23 Οκτωβρίου 2016 Διάρκεια Εξέτασης: 3 ώρες ΕΚΦΩΝΗΣΕΙΣ ΘΕΜΑ Α Στις ημιτελείς προτάσεις Α1 Α4 να γράψετε στο

Διαβάστε περισσότερα

ΓΕΝΕΤΙΚΗ ΜΗΧΑΝΙΚΗ. Η τεχνολογία του ανασυνδυασμένου DNA και οι εφαρμογές της...

ΓΕΝΕΤΙΚΗ ΜΗΧΑΝΙΚΗ. Η τεχνολογία του ανασυνδυασμένου DNA και οι εφαρμογές της... ΓΕΝΕΤΙΚΗ ΜΗΧΑΝΙΚΗ Η τεχνολογία του ανασυνδυασμένου DNA και οι εφαρμογές της... Γενετική Μηχανική o Περιλαμβάνει όλες τις τεχνικές με τις οποίες μπορούμε να επεμβαίνουμε στο γενετικό υλικό των οργανισμών.

Διαβάστε περισσότερα

ΕΠΑΝΑΛΗΠΤΙΚΑ ΘΕΜΑΤΑ Ο.Ε.Φ.Ε. 2004 ΘΕΜΑΤΑ ΒΙΟΛΟΓΙΑΣ Γ ΛΥΚΕΙΟΥ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ

ΕΠΑΝΑΛΗΠΤΙΚΑ ΘΕΜΑΤΑ Ο.Ε.Φ.Ε. 2004 ΘΕΜΑΤΑ ΒΙΟΛΟΓΙΑΣ Γ ΛΥΚΕΙΟΥ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ ΕΠΑΝΑΛΗΠΤΙΚΑ ΘΕΜΑΤΑ Ο.Ε.Φ.Ε. 2004 ΘΕΜΑ 1 Ο Α. Να επιλέξετε την ορθή πρόταση: ΘΕΜΑΤΑ ΒΙΟΛΟΓΙΑΣ Γ ΛΥΚΕΙΟΥ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ 1. Το κωδικόνιο του mrna που κωδικοποιεί το αµινοξύ µεθειονίνη είναι α. 5 GUA

Διαβάστε περισσότερα

ΚΕΦ.4 ΤΕΧΝΟΛΟΓΙΑ ΑΝΑΣΥΝΔΥΑΣΜΕΝΟΥ DNA

ΚΕΦ.4 ΤΕΧΝΟΛΟΓΙΑ ΑΝΑΣΥΝΔΥΑΣΜΕΝΟΥ DNA ΚΕΦ.4 ΤΕΧΝΟΛΟΓΙΑ ΑΝΑΣΥΝΔΥΑΣΜΕΝΟΥ DNA ΕΡΩΤΗΣΕΙΣ ΑΝΑΠΤΥΞΗΣ-ΕΜΒΑΘΥΝΣΗΣ ΘΕΩΡΙΑΣ 4.1. Τι ονομάζεται ανασυνδυασμένο DNA, που χρησιμοποιείται; 4.2. Τι είναι η γενετική μηχανική, ποιοι είναι οι στόχοι της και

Διαβάστε περισσότερα

θέσεις που κόβουν οι περιοριστικές ενδονουκλεάσες, στον αριθμό των πλασμιδίων που θα χρειαστούν κλπ

θέσεις που κόβουν οι περιοριστικές ενδονουκλεάσες, στον αριθμό των πλασμιδίων που θα χρειαστούν κλπ ΜΕΘΟΔΟΛΟΓΙΑ ΑΣΚΗΣΕΩΝ ΣΤΟ 4 ο ΚΕΦΑΛΑΙΟ 1. Προβλήματα που αναφέρονται στα κομμάτια που θα κοπεί το DNA, στις θέσεις που κόβουν οι περιοριστικές ενδονουκλεάσες, στον αριθμό των πλασμιδίων που θα χρειαστούν

Διαβάστε περισσότερα

ΕΡΩΤΗΣΕΙΣ ΚΑΤΑΝΟΗΣΗΣ

ΕΡΩΤΗΣΕΙΣ ΚΑΤΑΝΟΗΣΗΣ ΕΡΩΤΗΣΕΙΣ ΚΑΤΑΝΟΗΣΗΣ ΚΕΦΑΛΑΙΟ 2 ο 1. Με ποιο μηχανισμό αντιγράφεται το DNA σύμφωνα με τους Watson και Crick; 2. Ένα κύτταρο που περιέχει ένα μόνο χρωμόσωμα τοποθετείται σε θρεπτικό υλικό που περιέχει ραδιενεργό

Διαβάστε περισσότερα

Βιολογία Θετικής Κατεύθυνσης. 4 ο Κεφάλαιο - Τεχνολογία του ανασυνδυασμένου DNA

Βιολογία Θετικής Κατεύθυνσης. 4 ο Κεφάλαιο - Τεχνολογία του ανασυνδυασμένου DNA Βιολογία Θετικής Κατεύθυνσης 4 ο Κεφάλαιο - Τεχνολογία του ανασυνδυασμένου DNA Τεχνολογία ανασυνδυασμένου DNA Αναπτύχθηκε λόγω της ανακάλυψης: i. Περιοριστικών ενδονουκλεασών ii. Ειδικών φορέων DNA Έδωσε

Διαβάστε περισσότερα

ΘΕΜΑ Α Να επιλέξετε την φράση που συμπληρώνει ορθά κάθε μία από τις ακόλουθες προτάσεις:

ΘΕΜΑ Α Να επιλέξετε την φράση που συμπληρώνει ορθά κάθε μία από τις ακόλουθες προτάσεις: ΜΑΘΗΜΑ / ΤΑΞΗ : ΒΙΟΛΟΓΙΑ ΟΠ ΘΕΤΙΚΩΝ ΣΠΟΥΔΩΝ / Γ ΛΥΚΕΙΟΥ (ΘΕΡΙΝΑ) ΣΕΙΡΑ: ΗΜΕΡΟΜΗΝΙΑ: 15/11/2015 ΘΕΜΑ Α Να επιλέξετε την φράση που συμπληρώνει ορθά κάθε μία από τις ακόλουθες προτάσεις: 1. Δεοξυριβονουκλεοτίδια

Διαβάστε περισσότερα

28/11/2010 ΒΙΟΛΟΓΙΑ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ. ΘΕΜΑ 1 ο Α. Να βάλετε σε κύκλο το γράμμα που αντιστοιχεί στη σωστή απάντηση. (10 μόρια)

28/11/2010 ΒΙΟΛΟΓΙΑ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ. ΘΕΜΑ 1 ο Α. Να βάλετε σε κύκλο το γράμμα που αντιστοιχεί στη σωστή απάντηση. (10 μόρια) ΕΠΩΝΥΜΟ:... ΤΣΙΜΙΣΚΗ &ΚΑΡΟΛΟΥ ΝΤΗΛ ΓΩΝΙΑ THΛ: 270727 222594 ΟΝΟΜΑ:... ΤΜΗΜΑ:... ΗΜΕΡΟΜΗΝΙΑ:... ΑΡΤΑΚΗΣ 12 - Κ. ΤΟΥΜΠΑ THΛ: 919113 949422 28/11/2010 ΒΙΟΛΟΓΙΑ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ ΘΕΜΑ 1 ο Α. Να βάλετε

Διαβάστε περισσότερα

ΟΜΟΣΠΟΝ ΙΑ ΕΚΠΑΙ ΕΥΤΙΚΩΝ ΦΡΟΝΤΙΣΤΩΝ ΕΛΛΑ ΟΣ (Ο.Ε.Φ.Ε.) ΕΠΑΝΑΛΗΠΤΙΚΑ ΘΕΜΑΤΑ ΕΠΑΝΑΛΗΠΤΙΚΑ ΘΕΜΑΤΑ 2017 Α ΦΑΣΗ

ΟΜΟΣΠΟΝ ΙΑ ΕΚΠΑΙ ΕΥΤΙΚΩΝ ΦΡΟΝΤΙΣΤΩΝ ΕΛΛΑ ΟΣ (Ο.Ε.Φ.Ε.) ΕΠΑΝΑΛΗΠΤΙΚΑ ΘΕΜΑΤΑ ΕΠΑΝΑΛΗΠΤΙΚΑ ΘΕΜΑΤΑ 2017 Α ΦΑΣΗ ΤΑΞΗ: Γ ΓΕΝΙΚΟΥ ΛΥΚΕΙΟΥ ΠΡΟΣΑΝΑΤΟΛΙΣΜΟΣ: ΘΕΤΙΚΩΝ ΣΠΟΥ ΩΝ ΜΑΘΗΜΑ: ΒΙΟΛΟΓΙΑ Ηµεροµηνία: Σάββατο 7 Ιανουαρίου 2017 ιάρκεια Εξέτασης: 3 ώρες ΘΕΜΑ Α ΕΚΦΩΝΗΣΕΙΣ Να γράψετε στο τετράδιό σας τον αριθµό καθεµιάς

Διαβάστε περισσότερα

ÁÎÉÁ ÅÊÐÁÉÄÅÕÔÉÊÏÓ ÏÌÉËÏÓ

ÁÎÉÁ ÅÊÐÁÉÄÅÕÔÉÊÏÓ ÏÌÉËÏÓ ΘΕΜΑ Α ΒΙΟΛΟΓΙΑ ΠΡΟΣΑΝΑΤΟΛΙΣΜΟΥ (ΝΕΟ ΣΥΣΤΗΜΑ) ΚΑΤΕΥΘΥΝΣΗΣ (ΠΑΛΑΙΟ ΣΥΣΤΗΜΑ) 27 ΜΑΪΟΥ 2016 ΕΚΦΩΝΗΣΕΙΣ Να γράψετε στο τετράδιό σας τον αριθµό καθεµιάς από τις παρακάτω ηµιτελείς προτάσεις Α1 έως Α5 και, δίπλα,

Διαβάστε περισσότερα

ΕΡΩΤΗΣΕΙΣ 4 Ο, 7 Ο, 8 Ο, 9 Ο ΚΕΦΑΛΑΙΩΝ

ΕΡΩΤΗΣΕΙΣ 4 Ο, 7 Ο, 8 Ο, 9 Ο ΚΕΦΑΛΑΙΩΝ ΕΡΩΤΗΣΕΙΣ 4 Ο, 7 Ο, 8 Ο, 9 Ο ΚΕΦΑΛΑΙΩΝ 1. Η μεταφορά ανθρώπινου γονιδίου σε βακτήριο δίνει διαφορετικό προϊόν μεταγραφής και μετάφρασης, ενώ σε μύκητες μεταγράφεται κανονικά αλλά το προϊόν μετάφρασης εμφανίζει

Διαβάστε περισσότερα

Ημερομηνία: Πέμπτη 5 Ιανουαρίου 2016 Διάρκεια Εξέτασης: 3 ώρες ΕΚΦΩΝΗΣΕΙΣ

Ημερομηνία: Πέμπτη 5 Ιανουαρίου 2016 Διάρκεια Εξέτασης: 3 ώρες ΕΚΦΩΝΗΣΕΙΣ ΑΠΟ 18/12/2016 ΕΩΣ 05/01/2017 2η ΕΞΕΤΑΣΤΙΚΗ ΠΕΡΙΟΔΟΣ ΤΑΞΗ: ΜΑΘΗΜΑ: Γ ΓΕΝΙΚΟΥ ΛΥΚΕΙΟΥ ΒΙΟΛΟΓΙΑ ΠΡΟΣΑΝΑΤΟΛΙΣΜΟΥ Ημερομηνία: Πέμπτη 5 Ιανουαρίου 2016 Διάρκεια Εξέτασης: 3 ώρες ΕΚΦΩΝΗΣΕΙΣ Στις ημιτελείς προτάσεις

Διαβάστε περισσότερα

ΘΕΜΑΤΑ ΠΡΟΣΟΜΟΙΩΣΗΣ ΠΑΝΕΛΛΑΔΙΚΩΝ ΕΞΕΤΑΣΕΩΝ 2016 ΜΑΘΗΜΑ: ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΩΝ ΣΠΟΥΔΩΝ

ΘΕΜΑΤΑ ΠΡΟΣΟΜΟΙΩΣΗΣ ΠΑΝΕΛΛΑΔΙΚΩΝ ΕΞΕΤΑΣΕΩΝ 2016 ΜΑΘΗΜΑ: ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΩΝ ΣΠΟΥΔΩΝ ΘΕΜΑΤΑ ΠΡΟΣΟΜΟΙΩΣΗΣ ΠΑΝΕΛΛΑΔΙΚΩΝ ΕΞΕΤΑΣΕΩΝ 2016 ΜΑΘΗΜΑ: ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΩΝ ΣΠΟΥΔΩΝ ΕΚΦΩΝΗΣΕΙΣ ΘΕΜΑ Α Να γράψετε στο τετράδιό σας τον αριθμό καθεμίας από τις παρακάτω ημιτελείς προτάσεις Α1 έως Α5 και δίπλα

Διαβάστε περισσότερα

Τηλ: Ανδρέου Δημητρίου 81 & Ακριτών 26 -ΚΑΛΟΓΡΕΖΑ

Τηλ: Ανδρέου Δημητρίου 81 & Ακριτών 26 -ΚΑΛΟΓΡΕΖΑ ΔΙΑΓΩΝΙΣΜΑ ΒΙΟΛΟΓΙΑΣ Γ ΛΥΚΕΙΟΥ- ΘΕΤΙΚΗ ΚΑΤΕΥΘΥΝΣΗ (Ιανουάριος 2014) 1 ο ΘΕΜΑ Απαντήστε στις παρακάτω ερωτήσεις πολλαπλής επιλογής. Μία απάντηση είναι η σωστή. 1. Υβριδοποίηση: Α. Είναι ιδιότητα του DNA

Διαβάστε περισσότερα

Θεωρία (4 Ο Κεφάλαιο) επιμέλεια: Μιχάλης Χαλικιόπουλος καθηγητής Βιολογίας

Θεωρία (4 Ο Κεφάλαιο) επιμέλεια: Μιχάλης Χαλικιόπουλος καθηγητής Βιολογίας Θεωρία (4 Ο Κεφάλαιο) επιμέλεια: Μιχάλης Χαλικιόπουλος καθηγητής Βιολογίας 1 ΤΕΧΝΟΛΟΓΙΑ ΤΟΥ ΑΝΑΣΥΝΔΥΑΣΜΕΝΟΥ DNA 2 Θεωρία (4 Ο Κεφάλαιο) 3 ΤΕΧΝΟΛΟΓΙΑ ΤΟΥ ΑΝΑΣΥΝΔΥΑΣΜΕΝΟΥ DNA 1 2 3 ΚΛΩΝΟΠΟΙΗΣΗ 4 5 6 ορισμός:

Διαβάστε περισσότερα

ΕΠΑΝΑΛΗΠΤΙΚΕΣ ΠΑΝΕΛΛΑΔΙΚΕΣ ΕΞΕΤΑΣΕΙΣ Δ ΤΑΞΗΣ ΕΣΠΕΡΙΝΟΥ ΓΕΝΙΚΟΥ ΛΥΚΕΙΟΥ ΔΕΥΤΕΡΑ 23 ΙΟΥΝΙΟΥ 2014 ΕΞΕΤΑΖΟΜΕΝΟ ΜΑΘΗΜΑ: ΒΙΟΛΟΓΙΑ ΚΑΤΕΥΘΥΝΣΗΣ ΑΠΑΝΤΗΣΕΙΣ

ΕΠΑΝΑΛΗΠΤΙΚΕΣ ΠΑΝΕΛΛΑΔΙΚΕΣ ΕΞΕΤΑΣΕΙΣ Δ ΤΑΞΗΣ ΕΣΠΕΡΙΝΟΥ ΓΕΝΙΚΟΥ ΛΥΚΕΙΟΥ ΔΕΥΤΕΡΑ 23 ΙΟΥΝΙΟΥ 2014 ΕΞΕΤΑΖΟΜΕΝΟ ΜΑΘΗΜΑ: ΒΙΟΛΟΓΙΑ ΚΑΤΕΥΘΥΝΣΗΣ ΑΠΑΝΤΗΣΕΙΣ 1 ΕΠΑΝΑΛΗΠΤΙΚΕΣ ΠΑΝΕΛΛΑΔΙΚΕΣ ΕΞΕΤΑΣΕΙΣ Δ ΤΑΞΗΣ ΕΣΠΕΡΙΝΟΥ ΓΕΝΙΚΟΥ ΛΥΚΕΙΟΥ ΔΕΥΤΕΡΑ 23 ΙΟΥΝΙΟΥ 2014 ΕΞΕΤΑΖΟΜΕΝΟ ΜΑΘΗΜΑ: ΒΙΟΛΟΓΙΑ ΚΑΤΕΥΘΥΝΣΗΣ ΘΕΜΑ Α Α1. γ Α2. β Α3. γ Α4. δ Α5. α ΑΠΑΝΤΗΣΕΙΣ ΘΕΜΑ Β Β1. Σχολικό

Διαβάστε περισσότερα

B4-Ασκήσεις για το Κεφάλαιο 4: Η τεχνολογία του ανασυνδυασμένου DNA

B4-Ασκήσεις για το Κεφάλαιο 4: Η τεχνολογία του ανασυνδυασμένου DNA A) Ερωτήσεις με πολλές πιθανές απαντήσεις Να βάλετε σε κύκλο το γράμμα ή τα γράμματα που αντιστοιχούν στη σωστή φράση ή στη φράση που συμπληρώνει σωστά την πρόταση, αν υπάρχει. 1. Οι περιοριστικές ενδονουκλεάσες

Διαβάστε περισσότερα

ΚεφάΠαιο 4 ΤεχνοΠογία ίου ανασυνουασμένου DNA

ΚεφάΠαιο 4 ΤεχνοΠογία ίου ανασυνουασμένου DNA ΚεφάΠαιο 4 ΤεχνοΠογία ίου ανασυνουασμένου DNA 1. Γιατί οι περιοριστικές ενδονουκλεάσες και οι φορείς κλωνοποίησης είναι απαραίτητα εργαλεία για τη Γενετική Μηχανική; Οι περιοριστικές ενδονουκλεάσες είναι

Διαβάστε περισσότερα

ΚΕΦΑΛΑΙΟ 4 ο... 2 I. Τεχνολογία του ανασυνδυασµένου DNA... 2

ΚΕΦΑΛΑΙΟ 4 ο... 2 I. Τεχνολογία του ανασυνδυασµένου DNA... 2 ΚΕΦΑΛΑΙΟ 4 ο ΚΕΦΑΛΑΙΟ 4 ο... 2 I. Τεχνολογία του ανασυνδυασµένου DN... 2 ΚΕΦΑΛΑΙΟ 4 ο I. Τεχνολογία του ανασυνδυασµένου DN Εκπαιδευτικοί στόχοι: Μετά την ολοκλήρωση της µελέτης αυτού του κεφαλαίου ο µαθητής

Διαβάστε περισσότερα

ΒΙΟΛΟΓΙΑ Γ ΛΥΚΕΙΟΥ, ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ

ΒΙΟΛΟΓΙΑ Γ ΛΥΚΕΙΟΥ, ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ ΕΙΚΟΝΑ 2.4 ΣΤΑΔΙΑ ΜΕΤΑΦΡΑΣΗΣ σ ε λ ί δ α 1 ΕΙΚΟΝΑ 4.2β ΕΡΩΤΗΣΕΙΣ 1. Να συμπληρώσετε τα κενά πλαίσια της εικόνας με την κατάλληλη λέξη ή φράση 2. Να γράψετε τον προσανατολισμό της μετακίνησης του ριβοσώματος

Διαβάστε περισσότερα

Φάσμα group προπαρασκευή για Α.Ε.Ι. & Τ.Ε.Ι.

Φάσμα group προπαρασκευή για Α.Ε.Ι. & Τ.Ε.Ι. σύγχρονο Φάσμα group προπαρασκευή για Α.Ε.Ι. & Τ.Ε.Ι. µαθητικό φροντιστήριο Γραβιάς 85 ΚΗΠΟΥΠΟΛΗ 50.51.557 50.56.296 25ης Μαρτίου 74 ΠΛ.ΠΕΤΡΟΥΠΟΛΗΣ 50.50.658 50.60.845 25ης Μαρτίου 111 ΠΕΤΡΟΥΠΟΛΗ 50.27.990

Διαβάστε περισσότερα

ΕΚΦΩΝΗΣΕΙΣ. ΘΕΜΑ Α Να επιλέξετε τη φράση που συμπληρώνει ορθά κάθε μία από τις ακόλουθες προτάσεις:

ΕΚΦΩΝΗΣΕΙΣ. ΘΕΜΑ Α Να επιλέξετε τη φράση που συμπληρώνει ορθά κάθε μία από τις ακόλουθες προτάσεις: ΑΡΧΗ 1ΗΣ ΣΕΛΙΔΑΣ Γ ΤΑΞΗ ΓΕΝΙΚΟΥ ΛΥΚΕΙΟΥ ΚΑΙ ΕΠΑΛ (ΟΜΑΔΑ Β ) ΠΑΡΑΣΚΕΥΗ 25/04/2014 - ΕΞΕΤΑΖΟΜΕΝΟ ΜΑΘΗΜΑ: ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ ΣΥΝΟΛΟ ΣΕΛΙΔΩΝ: ΕΠΤΑ (7) ΕΚΦΩΝΗΣΕΙΣ ΘΕΜΑ Α Να επιλέξετε τη φράση που

Διαβάστε περισσότερα

ΒΙΟΛΟΓΙΑ Ο.Π. ΘΕΣΙΚΩΝ ΠΟΤΔΩΝ

ΒΙΟΛΟΓΙΑ Ο.Π. ΘΕΣΙΚΩΝ ΠΟΤΔΩΝ ΜΑΘΗΜΑ / ΣΑΞΗ : ΕΙΡΑ: ΗΜΕΡΟΜΗΝΙΑ: ΕΠΙΜΕΛΕΙΑ ΔΙΑΓΩΝΙΜΑΣΟ: ΒΙΟΛΟΓΙΑ Ο.Π. ΘΕΣΙΚΩΝ ΠΟΤΔΩΝ ΘΕΜΑ 1 Ο 1. Η γενετική πληροφορία μεταφέρεται στα ριβοσώματα με α. RNA β. DNA γ. πρωτεΐνες δ. λιπίδια 2. Κατά την σύνθεση

Διαβάστε περισσότερα

ΑΡΧΗ 1ΗΣ ΣΕΛΙΔΑΣ Δ ΤΑΞΗΣ ΕΣΠΕΡΙΝΟΥ ΓΕΝΙΚΟΥ ΛΥΚΕΙΟΥ

ΑΡΧΗ 1ΗΣ ΣΕΛΙΔΑΣ Δ ΤΑΞΗΣ ΕΣΠΕΡΙΝΟΥ ΓΕΝΙΚΟΥ ΛΥΚΕΙΟΥ ΑΡΧΗ 1ΗΣ ΣΕΛΙΔΑΣ Δ ΤΑΞΗΣ ΕΣΠΕΡΙΝΟΥ ΓΕΝΙΚΟΥ ΛΥΚΕΙΟΥ ΕΠΑΝΑΛΗΠΤΙΚΕΣ ΠΑΝΕΛΛΑΔΙΚΕΣ ΕΞΕΤΑΣΕΙΣ Δ ΤΑΞΗΣ ΕΣΠΕΡΙΝΟΥ ΓΕΝΙΚΟΥ ΛΥΚΕΙΟΥ ΔΕΥΤΕΡΑ 23 ΙΟΥΝΙΟΥ 2014 ΕΞΕΤΑΖΟΜΕΝΟ ΜΑΘΗΜΑ: ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ ΣΥΝΟΛΟ

Διαβάστε περισσότερα

ΕΠΑΝΑΛΗΠΤΙΚΑ ΘΕΜΑΤΑ 2016 B ΦΑΣΗ. ΒΙΟΛΟΓΙΑ Ηµεροµηνία: Τετάρτη 4 Μαΐου 2016 ιάρκεια Εξέτασης: 3 ώρες ΕΚΦΩΝΗΣΕΙΣ ÏÅÖÅ

ΕΠΑΝΑΛΗΠΤΙΚΑ ΘΕΜΑΤΑ 2016 B ΦΑΣΗ. ΒΙΟΛΟΓΙΑ Ηµεροµηνία: Τετάρτη 4 Μαΐου 2016 ιάρκεια Εξέτασης: 3 ώρες ΕΚΦΩΝΗΣΕΙΣ ÏÅÖÅ ΤΑΞΗ: Γ ΓΕΝΙΚΟΥ ΛΥΚΕΙΟΥ ΠΡΟΣΑΝΑΤΟΛΙΣΜΟΣ: ΘΕΤΙΚΩΝ ΣΠΟΥ ΩΝ ΜΑΘΗΜΑ: ΒΙΟΛΟΓΙΑ Ηµεροµηνία: Τετάρτη 4 Μαΐου 2016 ιάρκεια Εξέτασης: 3 ώρες ΘΕΜΑ Α ΕΚΦΩΝΗΣΕΙΣ Να γράψετε στο τετράδιό σας τον αριθµό καθεµιάς από

Διαβάστε περισσότερα

ΘΕΜΑ Α Να επιλέξετε την φράση που συμπληρώνει ορθά κάθε μία από τις ακόλουθες προτάσεις:

ΘΕΜΑ Α Να επιλέξετε την φράση που συμπληρώνει ορθά κάθε μία από τις ακόλουθες προτάσεις: ΜΑΘΗΜΑ / ΤΑΞΗ : ΒΙΟΛΟΓΙΑ ΟΠ ΘΕΤΙΚΩΝ ΣΠΟΥΔΩΝ Γ ΛΥΚΕΙΟΥ ΣΕΙΡΑ: ΘΕΡΙΝΑ ΗΜΕΡΟΜΗΝΙΑ: 15/11/2015 ΘΕΜΑ Α Να επιλέξετε την φράση που συμπληρώνει ορθά κάθε μία από τις ακόλουθες προτάσεις: 1. Δεοξυριβονουκλεοτίδια

Διαβάστε περισσότερα

ΘΕΜΑΤΑ ΚΑΙ ΑΠΑΝΤΗΣΕΙΣ ΕΠΑΝΑΛΗΠΤΙΚΩΝ ΠΑΝΕΛΛΑ ΙΚΩΝ ΕΞΕΤΑΣΕΩΝ 2015 ΒΙΟΛΟΓΙΑ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ (ΘΕΤΙΚΗ ΚΑΤΕΥΘΥΝΣΗ)

ΘΕΜΑΤΑ ΚΑΙ ΑΠΑΝΤΗΣΕΙΣ ΕΠΑΝΑΛΗΠΤΙΚΩΝ ΠΑΝΕΛΛΑ ΙΚΩΝ ΕΞΕΤΑΣΕΩΝ 2015 ΒΙΟΛΟΓΙΑ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ (ΘΕΤΙΚΗ ΚΑΤΕΥΘΥΝΣΗ) ΒΙΟΛΟΓΙΑ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ (ΘΕΤΙΚΗ ΚΑΤΕΥΘΥΝΣΗ) ΘΕΜΑ Α Να γράψετε στο τετράδιό σας τον αριθµό καθεµιάς από τις παρακάτω ηµιτελείς προτάσεις Α1 έως Α5 και, δίπλα, το γράµµα που αντιστοιχεί στη λέξη ή

Διαβάστε περισσότερα

ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ

ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ ΘΕΜΑΤΑ ΘΕΜΑ Α Να γράψετε στο τετράδιό σας τον αριθμό κάθε μίας από τις παρακάτω ημιτελείς προτάσεις Α1 έως Α5 και δίπλα το γράμμα, που αντιστοιχεί στη λέξη ή στη φράση, η οποία

Διαβάστε περισσότερα

ΑΠΟΛΥΤΗΡΙΕΣ ΕΞΕΤΑΣΕΙΣ Γ ΤΑΞΗΣ ΕΝΙΑΙΟΥ ΛΥΚΕΙΟΥ ΠΕΜΠΤΗ 22 ΙΟΥΝΙΟΥ 2000 ΕΞΕΤΑΖΟΜΕΝΟ ΜΑΘΗΜΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ: ΒΙΟΛΟΓΙΑ

ΑΠΟΛΥΤΗΡΙΕΣ ΕΞΕΤΑΣΕΙΣ Γ ΤΑΞΗΣ ΕΝΙΑΙΟΥ ΛΥΚΕΙΟΥ ΠΕΜΠΤΗ 22 ΙΟΥΝΙΟΥ 2000 ΕΞΕΤΑΖΟΜΕΝΟ ΜΑΘΗΜΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ: ΒΙΟΛΟΓΙΑ ΑΠΟΛΥΤΗΡΙΕΣ ΕΞΕΤΑΣΕΙΣ Γ ΤΑΞΗΣ ΕΝΙΑΙΟΥ ΛΥΚΕΙΟΥ ΠΕΜΠΤΗ 22 ΙΟΥΝΙΟΥ 2000 ΕΞΕΤΑΖΟΜΕΝΟ ΜΑΘΗΜΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ: ΒΙΟΛΟΓΙΑ ΘΕΜΑ 1 ο Στις ερωτήσεις 1-5, να γράψετε στο τετράδιό σας τον αριθμό της ερώτησης και

Διαβάστε περισσότερα

ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ

ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ 11 Ιουνίου 2015 ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ Απαντήσεις Θεμάτων Επαναληπτικών Πανελληνίων Εξετάσεων Ημερησίων & Εσπερινών Γενικών Λυκείων ΘΕΜΑ Α Α1. β Α2. γ Α3. α Α4. γ Α5. δ ΘΕΜΑ B Β1. 1. Β 2. Γ 3. Α

Διαβάστε περισσότερα

ΘΕΜΑΤΑ ΚΑΙ ΑΠΑΝΤΗΣΕΙΣ ΠΑΝΕΛΛΑΔΙΚΩΝ ΕΞΕΤΑΣΕΩΝ 2013 ΒΙΟΛΟΓΙΑ ΚΑΤΕΥΘΥΝΣΗΣ

ΘΕΜΑΤΑ ΚΑΙ ΑΠΑΝΤΗΣΕΙΣ ΠΑΝΕΛΛΑΔΙΚΩΝ ΕΞΕΤΑΣΕΩΝ 2013 ΒΙΟΛΟΓΙΑ ΚΑΤΕΥΘΥΝΣΗΣ ΒΙΟΛΟΓΙΑ ΚΑΤΕΥΘΥΝΣΗΣ ΘΕΜΑ Α Να γράψετε στο τετράδιό σας τον αριθμό κάθε μίας από τις παρακάτω ημιτελείς προτάσεις Α1 έως Α5 και δίπλα το γράμμα, που αντιστοιχεί στη λέξη ή στη φράση, η οποία συμπληρώνει

Διαβάστε περισσότερα

Θέματα Πανελλαδικών 2000-2013

Θέματα Πανελλαδικών 2000-2013 Θέματα Πανελλαδικών 2000-2013 ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΗΜΕΡΗΣΙΩΝ ΛΥΚΕΙΩΝ ΕΣΠΕΡΙΝΩΝ ΛΥΚΕΙΩΝ ΕΠΑΝΑΛΗΠΤΙΚΕΣ Κεφάλαιο 2 ΚΕΦΑΛΑΙΟ 2 ΘΕΜΑ 1 ο Γράψτε τον αριθμό καθεμιάς από τις παρακάτω προτάσεις και δίπλα το γράμμα

Διαβάστε περισσότερα

ΑΡΧΗ 1ΗΣ ΣΕΛΙΔΑΣ Γ ΗΜΕΡΗΣΙΩΝ

ΑΡΧΗ 1ΗΣ ΣΕΛΙΔΑΣ Γ ΗΜΕΡΗΣΙΩΝ ΑΡΧΗ 1ΗΣ ΣΕΛΙΔΑΣ Γ ΗΜΕΡΗΣΙΩΝ ΕΠΑΝΑΛΗΠΤΙΚΕΣ ΠΑΝΕΛΛΑΔΙΚΕΣ ΕΞΕΤΑΣΕΙΣ Γ ΤΑΞΗΣ ΗΜΕΡΗΣΙΟΥ ΓΕΝΙΚΟΥ ΛΥΚΕΙΟΥ ΠΕΜΠΤΗ 11 ΙΟΥΝΙΟΥ 2015 ΕΞΕΤΑΖΟΜΕΝΟ ΜΑΘΗΜΑ: ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ ΣΥΝΟΛΟ ΣΕΛΙΔΩΝ: ΠΕΝΤΕ (5) ΘΕΜΑ

Διαβάστε περισσότερα

Με τον εμβολιασμό προστίθενται στο θρεπτικό υλικό μιας καλλιέργειας πρωτεΐνες πλασμίδια αντισώματα δ. μικροοργανισμοί

Με τον εμβολιασμό προστίθενται στο θρεπτικό υλικό μιας καλλιέργειας πρωτεΐνες πλασμίδια αντισώματα δ. μικροοργανισμοί ΠΑΝΕΛΛΑΔΙΚΕΣ ΕΞΕΤΑΣΕΙΣ Γ' ΤΑΞΗΣ ΗΜΕΡΗΣΙΟΥ ΓΕΝΙΚΟΥ ΛΥΚΕΙΟΥ ΚΑΙ ΕΠΑΛ (ΟΜΑΔΑ Β') ΠΑΡΑΣΚΕΥΗ 24 ΜΑΪΟΥ 2013 ΕΞΕΤΑΖΟΜΕΝΟ ΜΑΘΗΜΑ: ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ ΘΕΜΑ Α Να γράψετε στο τετράδιό σας τον αριθμό κάθε

Διαβάστε περισσότερα

Φάσμα group προπαρασκευή για Α.Ε.Ι. & Τ.Ε.Ι.

Φάσμα group προπαρασκευή για Α.Ε.Ι. & Τ.Ε.Ι. σύγχρονο Φάσμα group προπαρασκευή για Α.Ε.Ι. & Τ.Ε.Ι. µαθητικό φροντιστήριο Γραβιάς 85 ΚΗΠΟΥΠΟΛΗ 50.51.557 50.56.296 25ης Μαρτίου 74 ΠΛ.ΠΕΤΡΟΥΠΟΛΗΣ 50.50.658 50.60.845 25ης Μαρτίου 111 ΠΕΤΡΟΥΠΟΛΗ 50.27.990

Διαβάστε περισσότερα

ΑΡΧΗ 1ΗΣ ΣΕΛΙ ΑΣ Γ ΗΜΕΡΗΣΙΩΝ

ΑΡΧΗ 1ΗΣ ΣΕΛΙ ΑΣ Γ ΗΜΕΡΗΣΙΩΝ ΑΡΧΗ 1ΗΣ ΣΕΛΙ ΑΣ Γ ΗΜΕΡΗΣΙΩΝ ΠΑΝΕΛΛΑΔΙΚΕΣ ΕΞΕΤΑΣΕΙΣ Γ ΤΑΞΗΣ ΗΜΕΡΗΣΙΟΥ ΓΕΝΙΚΟΥ ΛΥΚΕΙΟΥ ΚΑΙ ΕΠΑΛ (ΟΜΑΔΑ Β ) ΠΑΡΑΣΚΕΥΗ 24 ΜΑΪΟΥ 2013 - ΕΞΕΤΑΖΟΜΕΝΟ ΜΑΘΗΜΑ: ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ ΣΥΝΟΛΟ ΣΕΛΙΔΩΝ: ΤΕΣΣΕΡΙΣ

Διαβάστε περισσότερα

Bιολογία προσανατολισμού

Bιολογία προσανατολισμού Bιολογία προσανατολισμού Α. 1. γ 2. β 3. γ 4. γ 5. β ΘΕΜΑ Α ΘΕΜΑ B B1. Περιγραφή του πολυσώματος όπως αυτό περιγράφεται στις σελίδες 41-42. B2. Σελίδες 37-38 Στους προκαρυωτικούς οργανισμούς... σχηματίζεται

Διαβάστε περισσότερα

ΘΕΜΑΤΑ ΠΑΝΕΛΛΗΝΙΩΝ ΕΞΕΤΑΣΕΩΝ ΣΤΗΝ ΑΝΤΙΓΡΑΦΗ, ΕΚΦΡΑΣΗ ΚΑΙ ΡΥΘΜΙΣΗ ΤΗΣ ΓΕΝΕΤΙΚΗΣ ΠΛΗΡΟΦΟΡΙΑΣ 2000 ΗΜΕΡΗΣΙΟ. Ζήτηµα 4ο

ΘΕΜΑΤΑ ΠΑΝΕΛΛΗΝΙΩΝ ΕΞΕΤΑΣΕΩΝ ΣΤΗΝ ΑΝΤΙΓΡΑΦΗ, ΕΚΦΡΑΣΗ ΚΑΙ ΡΥΘΜΙΣΗ ΤΗΣ ΓΕΝΕΤΙΚΗΣ ΠΛΗΡΟΦΟΡΙΑΣ 2000 ΗΜΕΡΗΣΙΟ. Ζήτηµα 4ο 1 ο ΓΕΝΙΚΟ ΛΥΚΕΙΟ ΗΡΑΚΛΕΙΟΥ ΘΕΜΑΤΑ ΠΑΝΕΛΛΗΝΙΩΝ ΕΞΕΤΑΣΕΩΝ ΣΤΗΝ ΑΝΤΙΓΡΑΦΗ, ΕΚΦΡΑΣΗ ΚΑΙ ΡΥΘΜΙΣΗ ΤΗΣ ΓΕΝΕΤΙΚΗΣ ΠΛΗΡΟΦΟΡΙΑΣ 2000 ΗΜΕΡΗΣΙΟ Ζήτηµα 2ο Α. Η διαδικασία της αντιγραφής του DΝΑ χαρακτηρίζεται από

Διαβάστε περισσότερα

Ημερομηνία: Κυριακή 29 Οκτωβρίου 2017 Διάρκεια Εξέτασης: 3 ώρες ΕΚΦΩΝΗΣΕΙΣ

Ημερομηνία: Κυριακή 29 Οκτωβρίου 2017 Διάρκεια Εξέτασης: 3 ώρες ΕΚΦΩΝΗΣΕΙΣ ΤΑΞΗ: ΜΑΘΗΜΑ: Γ ΓΕΝΙΚΟΥ ΛΥΚΕΙΟΥ ΒΙΟΛΟΓΙΑ ΠΡΟΣΑΝΑΤΟΛΙΣΜΟΥ Ημερομηνία: Κυριακή 29 Οκτωβρίου 2017 Διάρκεια Εξέτασης: 3 ώρες ΕΚΦΩΝΗΣΕΙΣ Στις ημιτελείς προτάσεις Α1 Α4 να γράψετε στο τετράδιό σας τον αριθμό

Διαβάστε περισσότερα

ΘΕΜΑ Α Να επιλέξετε τη φράση που συμπληρώνει ορθά κάθε μία από τις ακόλουθες προτάσεις:

ΘΕΜΑ Α Να επιλέξετε τη φράση που συμπληρώνει ορθά κάθε μία από τις ακόλουθες προτάσεις: ΜΑΘΗΜΑ / ΤΑΞΗ: ΒΙΟΛΟΓΙΑ ΟΠ Γ ΛΥΚΕΙΟΥ (ΘΕΡΙΝΑ) ΗΜΕΡΟΜΗΝΙΑ: 22/01/2017 ΕΠΙΜΕΛΕΙΑ ΔΙΑΓΩΝΙΣΜΑΤΟΣ: ΝΟΤΑ ΛΑΖΑΡΑΚΗ ΘΕΜΑ Α Να επιλέξετε τη φράση που συμπληρώνει ορθά κάθε μία από τις ακόλουθες προτάσεις: 1. Από

Διαβάστε περισσότερα

ΔΙΑΓΩΝΙΣΜΑ ΕΚΠ. ΕΤΟΥΣ

ΔΙΑΓΩΝΙΣΜΑ ΕΚΠ. ΕΤΟΥΣ ΜΑΘΗΜΑ / ΤΑΞΗ : ΑΠΑΝΤΗΣΕΙΣ ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΟΥ ΠΡΟΣΑΝΑΤΟΛΙΣΜΟΥ ΗΜΕΡΟΜΗΝΙΑ: 05/02/1017 ΘΕΜΑ 1 ο Α1. Τα βακτήρια του γένους Mycobacterium: α. είναι προκαρυωτικοί οργανισμοί. Α2. Η προσαρμογή των μικροοργανισμών

Διαβάστε περισσότερα

ΤΕΛΟΣ 1ΗΣ ΑΠΟ 5 ΣΕΛΙ ΕΣ

ΤΕΛΟΣ 1ΗΣ ΑΠΟ 5 ΣΕΛΙ ΕΣ ΑΡΧΗ 1ΗΣ ΣΕΛΙ ΑΣ ΝΕΟ & ΠΑΛΑΙΟ ΣΥΣΤΗΜΑ ΕΣΠΕΡΙΝΩΝ ΠΑΝΕΛΛΑΔΙΚΕΣ ΕΞΕΤΑΣΕΙΣ Δ ΤΑΞΗΣ ΕΣΠΕΡΙΝΟΥ ΓΕΝΙΚΟΥ ΛΥΚΕΙΟΥ ΚΑΙ ΕΠΑΛ (ΟΜΑΔΑ Β ) ΠΑΡΑΣΚΕΥΗ 27 ΜΑΪΟΥ 2016 - ΕΞΕΤΑΖΟΜΕΝΟ ΜΑΘΗΜΑ: ΒΙΟΛΟΓΙΑ ΠΡΟΣΑΝΑΤΟΛΙΣΜΟΥ (ΝΕΟ

Διαβάστε περισσότερα

Βιολογία. Θετικής Κατεύθυνσης

Βιολογία. Θετικής Κατεύθυνσης Βιολογία Θετικής Κατεύθυνσης Κεφάλαιο 4ο ΤΕΧΝΟΛΟΓΊΑ ΤΟΥ ΑΝΑΣΥΝΔΥΑΣΜΈΝΟΥ DNA Γενετική Μηχανική 3 Είναι ο κλάδος της Βιολογίας που περιλαμβάνει τις τεχνικές με τις οποίες ο άνθρωπος επεμβαίνει στο γενετικό

Διαβάστε περισσότερα

Βιολογία Προσανατολισμού Γ Λυκείου

Βιολογία Προσανατολισμού Γ Λυκείου Μάθημα/Τάξη: Κεφάλαιο: Βιολογία Προσανατολισμού Γ Λυκείου Το γενετικό υλικό (Κεφ.1), Αντιγραφή, έκφραση και ρύθμιση της γενετικής πληροφορίας (Κεφ.2), Τεχνολογία του Ανασυνδυασμένου DNA (Κεφ.4), Μενδελική

Διαβάστε περισσότερα

ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ

ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ ΘΕΜΑ 1ο Να γράψετε στο τετράδιό σας τον αριθμό καθεμιάς από τις παρακάτω ημιτελείς προτάσεις 1 έως 5 και δίπλα το γράμμα που αντιστοιχεί στη λέξη ή τη φράση, η οποία

Διαβάστε περισσότερα

γ ρ α π τ ή ε ξ έ τ α σ η σ τ ο μ ά θ η μ α

γ ρ α π τ ή ε ξ έ τ α σ η σ τ ο μ ά θ η μ α γ ρ α π τ ή ε ξ έ τ α σ η σ τ ο μ ά θ η μ α ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ Γ ' ΛΥΚΕΙΟΥ Τάξη: Γ Λυκείου Τμήμα: Βαθμός: Ονοματεπώνυμο: Καθηγητές: Θ Ε Μ Α Να επιλέξετε τη σωστή απάντηση: Α1. Στην τεχνολογία

Διαβάστε περισσότερα

ΑΣΚΗΣΕΙΣ στο 2 ο κεφάλαιο

ΑΣΚΗΣΕΙΣ στο 2 ο κεφάλαιο ΑΣΚΗΣΕΙΣ στο 2 ο κεφάλαιο 1. Ένας κλώνος ενός γονιδίου προκαρυωτικού κυττάρου έχει την παρακάτω αλληλουχία βάσεων: AAAATGTATACGGGCGCTGATACGGCAAACCCACTCATGTAA Βρείτε: Α) την αλληλουχία των βάσεων του mrna

Διαβάστε περισσότερα

ΑΠΑΝΤΗΣΕΙΣ. ΘΕΜΑ Α A1. β Α2. γ Α3. γ Α4. α Α5. δ

ΑΠΑΝΤΗΣΕΙΣ. ΘΕΜΑ Α A1. β Α2. γ Α3. γ Α4. α Α5. δ ΘΕΜΑ Α A1. β Α2. γ Α3. γ Α4. α Α5. δ ΕΠΑΝΑΛΗΠΤΙΚΕΣ ΠΑΝΕΛΛΑΔΙΚΕΣ ΕΞΕΤΑΣΕΙΣ Γ ΤΑΞΗΣ ΗΜΕΡΗΣΙΟΥ ΓΕΝΙΚΟΥ ΛΥΚΕΙΟΥ ΚΑΙ ΕΠΑΛ (ΟΜΑΔΑ Β ) ΤΕΤΑΡΤΗ 15 ΙΟΥΝΙΟΥ 2016 ΕΞΕΤΑΖΟΜΕΝΟ ΜΑΘΗΜΑ: ΒΙΟΛΟΓΙΑ ΠΡΟΣΑΝΑΤΟΛΙΣΜΟΥ (ΝΕΟ

Διαβάστε περισσότερα

ΑΠΑΝΤΗΣΕΙΣ ΣΤΗ ΒΙΟΛΟΓΙΑ ΚΑΤΕΥΘΥΝΣΗΣ 24 ΜΑΪΟΥ 2013

ΑΠΑΝΤΗΣΕΙΣ ΣΤΗ ΒΙΟΛΟΓΙΑ ΚΑΤΕΥΘΥΝΣΗΣ 24 ΜΑΪΟΥ 2013 ΑΠΑΝΤΗΣΕΙΣ ΣΤΗ ΒΙΟΛΟΓΙΑ ΚΑΤΕΥΘΥΝΣΗΣ 24 ΜΑΪΟΥ 2013 ΘΕΜΑ Α Α1. γ Α2. β Α3. α Α4. δ Α5. α ΘΕΜΑ Β Β1. Σελ. 123 124 σχολ. βιβλίου: «Η διαδικασία που ακολουθείται παράγουν το ένζυμο ADA». Β2. Σελ. 133 σχολ.

Διαβάστε περισσότερα

ΑΡΧΗ 1ΗΣ ΣΕΛΙ ΑΣ ΤΑΞΗ

ΑΡΧΗ 1ΗΣ ΣΕΛΙ ΑΣ ΤΑΞΗ ΑΡΧΗ 1ΗΣ ΣΕΛΙ ΑΣ ΑΠΟΛΥΤΗΡΙΕΣ ΕΞΕΤΑΣΕΙΣ Σ ΕΣΠΕΡΙΝΟΥ ΕΝΙΑΙΟΥ ΛΥΚΕΙΟΥ ΠΑΡΑΣΚΕΥΗ 10 ΙΟΥΝΙΟΥ 2005 ΕΞΕΤΑΖΟΜΕΝΟ ΜΑΘΗΜΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ: ΒΙΟΛΟΓΙΑ ΣΥΝΟΛΟ ΣΕΛΙ ΩΝ: ΠΕΝΤΕ (5) ΘΕΜΑ 1ο Α. Για τις ημιτελείς προτάσεις

Διαβάστε περισσότερα

γ ρ α π τ ή ε ξ έ τ α σ η σ τ ο μ ά θ η μ α ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ

γ ρ α π τ ή ε ξ έ τ α σ η σ τ ο μ ά θ η μ α ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ γ ρ α π τ ή ε ξ έ τ α σ η σ τ ο μ ά θ η μ α ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ Γ ' ΛΥΚΕΙΟΥ Τάξη: Γ Λυκείου Τμήμα: Βαθμός: Ονοματεπώνυμο: Καθηγητές: Θ Ε Μ Α A 1. Να επιλέξετε τη σωστή απάντηση: Α1. Το γονίδιο

Διαβάστε περισσότερα

ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ ΟΝΟΜΑΤΕΠΩΝΥΜΟ: ΤΜΗΜΑ: ΘΕΜΑ 1 Ο. 3. Το DNA των μιτοχονδρίων έχει μεγαλύτερο μήκος από αυτό των χλωροπλαστών.

ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ ΟΝΟΜΑΤΕΠΩΝΥΜΟ: ΤΜΗΜΑ: ΘΕΜΑ 1 Ο. 3. Το DNA των μιτοχονδρίων έχει μεγαλύτερο μήκος από αυτό των χλωροπλαστών. ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ ΟΝΟΜΑΤΕΠΩΝΥΜΟ: ΤΜΗΜΑ: ΘΕΜΑ 1 Ο Α. Να γράψετε τον αριθμό της καθεμιάς από τις παρακάτω προτάσεις 1-5 και δίπλα του τη λέξη Σωστό, αν η πρόταση είναι σωστή, ή Λάθος, αν η πρόταση

Διαβάστε περισσότερα

ΒΙΟΛΟΓΙΑ ΟΜΑΔΑΣ ΠΡΟΣΑΝΑΤΟΛΙΣΜΟΥ ΘΕΤΙΚΩΝ ΣΠΟΥΔΩΝ

ΒΙΟΛΟΓΙΑ ΟΜΑΔΑΣ ΠΡΟΣΑΝΑΤΟΛΙΣΜΟΥ ΘΕΤΙΚΩΝ ΣΠΟΥΔΩΝ 16 Ιουνίου 2017 ΒΙΟΛΟΓΙΑ ΟΜΑΔΑΣ ΠΡΟΣΑΝΑΤΟΛΙΣΜΟΥ ΘΕΤΙΚΩΝ ΣΠΟΥΔΩΝ Απαντήσεις Θεμάτων Πανελλαδικών Εξετάσεων Εσπερινών Λυκείων Γενικών ΘΕΜΑ Α Α.1 δ Α.2 δ Α.3 β Α.4 γ Α.5 α ΘΕΜΑ B B.1 I. A II. E III. ΣΤ IV.

Διαβάστε περισσότερα

Tρίτη, 3 Ιουνίου 2003 ΘΕΤΙΚΗ ΚΑΤΕΥΘΥΝΣΗ Γ ΛΥΚΕΙΟΥ ΒΙΟΛΟΓΙΑ

Tρίτη, 3 Ιουνίου 2003 ΘΕΤΙΚΗ ΚΑΤΕΥΘΥΝΣΗ Γ ΛΥΚΕΙΟΥ ΒΙΟΛΟΓΙΑ Tρίτη, 3 Ιουνίου 2003 ΘΕΤΙΚΗ ΚΑΤΕΥΘΥΝΣΗ Γ ΛΥΚΕΙΟΥ ΒΙΟΛΟΓΙΑ ΘΕΜΑ 1 1Α. Να γράψετε τον αριθµό της καθεµιάς από τις παρακάτω προτάσεις 1-5 και δίπλα του τη λέξη Σωστό, αν η πρόταση είναι σωστή, ή Λάθος, αν

Διαβάστε περισσότερα

ΕΞΕΤΑΖΟΜΕΝΟ ΜΑΘΗΜΑ ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ

ΕΞΕΤΑΖΟΜΕΝΟ ΜΑΘΗΜΑ ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ ΕΞΕΤΑΖΟΜΕΝΟ ΜΑΘΗΜΑ ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ ΘΕΜΑ Α Να γράψετε στο τετράδιό σας τον αριθμό καθεμιάς από τις παρακάτω ημιτελείς προτάσεις Α1 έως Α5 και δίπλα το γράμμα που αντιστοιχεί στη λέξη

Διαβάστε περισσότερα

ΠΑΝΕΛΛAΔΙΚΕΣ ΕΞΕΤΑΣΕΙΣ Γ ΤΑΞΗΣ ΗΜΕΡΗΣΙΟΥ ΓΕΝΙΚΟΥ ΛΥΚΕΙΟΥ ΒΙΟΛΟΓΙΑ ΠΡΟΣΑΝΑΤΟΛΙΣΜΟΥ ΑΠΑΝΤΗΣΕΙΣ

ΠΑΝΕΛΛAΔΙΚΕΣ ΕΞΕΤΑΣΕΙΣ Γ ΤΑΞΗΣ ΗΜΕΡΗΣΙΟΥ ΓΕΝΙΚΟΥ ΛΥΚΕΙΟΥ ΒΙΟΛΟΓΙΑ ΠΡΟΣΑΝΑΤΟΛΙΣΜΟΥ ΑΠΑΝΤΗΣΕΙΣ ΠΑΝΕΛΛAΔΙΚΕΣ ΕΞΕΤΑΣΕΙΣ Γ ΤΑΞΗΣ ΗΜΕΡΗΣΙΟΥ ΓΕΝΙΚΟΥ ΛΥΚΕΙΟΥ ΒΙΟΛΟΓΙΑ ΠΡΟΣΑΝΑΤΟΛΙΣΜΟΥ 16-06-2017 ΑΠΑΝΤΗΣΕΙΣ ΘΕΜΑ Α Α1. δ Α2. δ Α3. β Α4. γ Α5. α ΘΕΜΑ Β Β1. Α. φωσφορική ομάδα (Ι) E. υδροξύλιο (II) Β. mrna

Διαβάστε περισσότερα

ΟΡΟΛΟΓΙΑ 1 ΟΥ ΚΕΦΑΛΑΙΟΥ

ΟΡΟΛΟΓΙΑ 1 ΟΥ ΚΕΦΑΛΑΙΟΥ ΟΡΟΛΟΓΙΑ 1 ΟΥ ΚΕΦΑΛΑΙΟΥ 1. In vitro 2. In vivo 3. Αναστολείς μίτωσης 4. Απλοειδές κύτταρο 5. Απλοειδής οργανισμός 6. Αριθμός ή αλληλουχία βάσεων 7. Αυτοσωμικά χρωμοσώματα 8. Βήμα έλικας 9. Γονιδίωμα κυττάρου

Διαβάστε περισσότερα

Σημειώσεις Μοριακής Βιολογίας Βιολογία Γ Λυκείου Θετικής Κατεύθυνσης

Σημειώσεις Μοριακής Βιολογίας Βιολογία Γ Λυκείου Θετικής Κατεύθυνσης 1 Προαπαιτούμενες Γνώσεις για την κατανόηση της Κλωνοποίησης 1. Περιοριστικές ενδονουκλεάσες α. Είναι ένζυμα που σπάνε (υδρολύουν) 3-5 φωσφοδιεστερικούς δεσμούς ενδιάμεσα στο μόριο του DNA, και όχι στα

Διαβάστε περισσότερα

ΚΡΙΤΗΡΙΟ ΑΞΙΟΛΟΓΗΣΗΣ ΣΤΗ: ΒΙΟΛΟΓΙΑ ΠΡΟΣΑΝΑΤΟΛΙΣΜΟΥ ΕΞΕΤΑΣΤΕΑ ΥΛΗ: ΚΕΦΑΛΑΙΑ 1, 2, 4, 5

ΚΡΙΤΗΡΙΟ ΑΞΙΟΛΟΓΗΣΗΣ ΣΤΗ: ΒΙΟΛΟΓΙΑ ΠΡΟΣΑΝΑΤΟΛΙΣΜΟΥ ΕΞΕΤΑΣΤΕΑ ΥΛΗ: ΚΕΦΑΛΑΙΑ 1, 2, 4, 5 ΚΡΙΤΗΡΙΟ ΑΞΙΟΛΟΓΗΣΗΣ ΣΤΗ: ΒΙΟΛΟΓΙΑ ΠΡΟΣΑΝΑΤΟΛΙΣΜΟΥ ΕΞΕΤΑΣΤΕΑ ΥΛΗ: ΚΕΦΑΛΑΙΑ 1, 2, 4, 5 ΦΡΟΝΤΙΣΤΗΡΙΟ: ΚΟΡΥΦΑΙΟ ΗΜΕΡΟΜΗΝΙΑ: ΟΝΟΜΑΤΕΠΩΝΥΜΟ ΕΞΕΤΑΖΟΜΕΝΟΥ:. ΣΥΝΟΛΟ ΣΕΛΙΔΩΝ: ΠΕΝΤΕ (5) ΘΕΜΑ 1 ο Στις ερωτήσεις Α

Διαβάστε περισσότερα

Ποιες είναι οι ομοιότητες και οι διαφορές μεταξύ της αντιγραφής και της

Ποιες είναι οι ομοιότητες και οι διαφορές μεταξύ της αντιγραφής και της ΚΕΦ. 2 ο ΕΡΩΤΗΣΕΙΣ ΚΡΙΣΕΩΣ Ποιες είναι οι ομοιότητες και οι διαφορές μεταξύ της αντιγραφής και της μεταγραφής; Διαφορές Αντιγραφή Μεταγραφή 1. Διατηρείται και μεταβιβάζεται η 1. Μεταβιβάζεται η γενετική

Διαβάστε περισσότερα

ΤΕΛΟΣ 1ΗΣ ΑΠΟ 5 ΣΕΛΙ ΕΣ

ΤΕΛΟΣ 1ΗΣ ΑΠΟ 5 ΣΕΛΙ ΕΣ ΑΡΧΗ 1ΗΣ ΣΕΛΙ ΑΣ Γ ΗΜΕΡΗΣΙΩΝ ΠΑΝΕΛΛΗΝΙΕΣ ΕΞΕΤΑΣΕΙΣ Γ ΤΑΞΗΣ ΗΜΕΡΗΣΙΟΥ ΓΕΝΙΚΟΥ ΛΥΚΕΙΟΥ ΚΑΙ ΕΠΑΛ (ΟΜΑ Α Β ) ΤΕΤΑΡΤΗ 30 ΜΑΪΟΥ 2012 ΕΞΕΤΑΖΟΜΕΝΟ ΜΑΘΗΜΑ: ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ ΣΥΝΟΛΟ ΣΕΛΙ ΩΝ: ΠΕΝΤΕ (5)

Διαβάστε περισσότερα

ΤΕΛΟΣ 1ΗΣ ΑΠΟ 5 ΣΕΛΙΔΕΣ

ΤΕΛΟΣ 1ΗΣ ΑΠΟ 5 ΣΕΛΙΔΕΣ ΑΡΧΗ 1ΗΣ ΣΕΛΙΔΑΣ Δ ΕΣΠΕΡΙΝΩΝ ΠΑΝΕΛΛΑΔΙΚΕΣ ΕΞΕΤΑΣΕΙΣ Δ ΤΑΞΗΣ ΕΣΠΕΡΙΝΟΥ ΓΕΝΙΚΟΥ ΛΥΚΕΙΟΥ ΠΑΡΑΣΚΕΥΗ 16 IOYNIOΥ 2017 ΕΞΕΤΑΖΟΜΕΝΟ ΜΑΘΗΜΑ: ΒΙΟΛΟΓΙΑ ΠΡΟΣΑΝΑΤΟΛΙΣΜΟΥ ΣΥΝΟΛΟ ΣΕΛΙΔΩΝ: ΠΕΝΤΕ (5) ΘΕΜΑ Α Να γράψετε

Διαβάστε περισσότερα

ÍÅÏ ÄÕÍÁÌÉÊÏ ÓÔÁÕÑÏÕÐÏËÇ

ÍÅÏ ÄÕÍÁÌÉÊÏ ÓÔÁÕÑÏÕÐÏËÇ 1 ΘΕΜΑ 1 o Γ' ΛΥΚΕΙΟΥ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ ΕΚΦΩΝΗΣΕΙΣ ΒΙΟΛΟΓΙΑ Α. Για τις ερωτήσεις 1 5 να γράψετε στο τετράδιό σας τον αριθµό της ερώτησης και δίπλα του το γράµµα, που αντιστοιχεί στη σωστή απάντηση. 1.

Διαβάστε περισσότερα

ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ Θέµα 1 ο

ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ Θέµα 1 ο ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ Θέµα 1 ο Α. Να σηµειώσετε τη σωστή απάντηση: 1. Ο γονότυπος των φυσιολογικών γονιών ενός ατόµου που έχει σύνδροµο Kleinefelter και πάσχει από αιµορροφιλία είναι :

Διαβάστε περισσότερα

Φάσμα. προπαρασκευή για Α.Ε.Ι. & Τ.Ε.Ι.

Φάσμα. προπαρασκευή για Α.Ε.Ι. & Τ.Ε.Ι. σύγχρονο Φάσμα προπαρασκευή για Α.Ε.Ι. & Τ.Ε.Ι. μαθητικό φροντιστήριο 25ης Μαρτίου 111 - ΠΕΤΡΟΥΠΟΛΗ - 210 50 20 990-210 50 27 990 25ης Μαρτίου 74 - ΠΕΤΡΟΥΠΟΛΗ - 210 50 50 658-210 50 60 845 Γραβιάς 85 -

Διαβάστε περισσότερα

Περικλέους Σταύρου 31 34100 Χαλκίδα Τ: 2221-300524 & 6937016375 F: 2221-300524 @: chalkida@diakrotima.gr W: www.diakrotima.gr

Περικλέους Σταύρου 31 34100 Χαλκίδα Τ: 2221-300524 & 6937016375 F: 2221-300524 @: chalkida@diakrotima.gr W: www.diakrotima.gr Τ: 2221-300524 & 6937016375 Προς: Μαθητές Α, Β & Γ Λυκείου / Κάθε ενδιαφερόμενο Αγαπητοί Φίλοι Όπως σίγουρα γνωρίζετε, από τον Ιούνιο του 2010 ένα νέο «ΔΙΑΚΡΟΤΗΜΑ» λειτουργεί και στη Χαλκίδα. Στο Φροντιστήριό

Διαβάστε περισσότερα

Ασκήσεις 1 ου ΚΕΦΑΛΑΙΟΥ

Ασκήσεις 1 ου ΚΕΦΑΛΑΙΟΥ Ασκήσεις 1 ου ΚΕΦΑΛΑΙΟΥ 1. Η ανάλυση δειγμάτων DNA από δύο βακτηριακές καλλιέργειες έδωσε τα εξής αποτελέσματα: στην πρώτη καλλιέργεια βρέθηκε ποσοστό αδενίνης (Α) 28% και στη δεύτερη καλλιέργεια βρέθηκε

Διαβάστε περισσότερα

ΔΙΑΓΩΝΙΣΜΑ ΠΡΟΣΟΜΟΙΩΣΗΣ Β ΚΥΚΛΟΥ

ΔΙΑΓΩΝΙΣΜΑ ΠΡΟΣΟΜΟΙΩΣΗΣ Β ΚΥΚΛΟΥ ΔΙΑΓΩΝΙΣΜΑ ΠΡΟΣΟΜΟΙΩΣΗΣ Β ΚΥΚΛΟΥ ΜΑΘΗΜΑ ΒΙΟΛΟΓΙΑ ΠΡΟΣΑΝΑΤΟΛΙΣΜΟΥ ΤΑΞΗ Γ ΛΥΚΕΙΟΥ ΗΜΕΡΟΜΗΝΙΑ 25/4/2016 ΘΕΜΑ Α Α1. Μέσω του καρυότυπου δεν μπορούν να ανιχνευτούν : α. οι δομικές χρωμοσωμικές ανωμαλίες β.

Διαβάστε περισσότερα

1 Ο ΓΕΝΙΚΟ ΛΥΚΕΙΟ ΗΡΑΚΛΕΙΟΥ - ΚΑΠΕΤΑΝΑΚΕΙΟ ΘΕΜΑΤΑ ΠΑΝΕΛΛΗΝΙΩΝ ΕΞΕΤΑΣΕΩΝ ΣΤΟ 2 Ο ΚΕΦΑΛΑΙΟ (ΑΝΤΙΓΡΑΦΗ, ΕΚΦΡΑΣΗ ΚΑΙ ΡΥΘΜΙΣΗ ΤΗΣ ΓΕΝΕΤΙΚΗΣ ΠΛΗΡΟΦΟΡΙΑΣ)

1 Ο ΓΕΝΙΚΟ ΛΥΚΕΙΟ ΗΡΑΚΛΕΙΟΥ - ΚΑΠΕΤΑΝΑΚΕΙΟ ΘΕΜΑΤΑ ΠΑΝΕΛΛΗΝΙΩΝ ΕΞΕΤΑΣΕΩΝ ΣΤΟ 2 Ο ΚΕΦΑΛΑΙΟ (ΑΝΤΙΓΡΑΦΗ, ΕΚΦΡΑΣΗ ΚΑΙ ΡΥΘΜΙΣΗ ΤΗΣ ΓΕΝΕΤΙΚΗΣ ΠΛΗΡΟΦΟΡΙΑΣ) 1 Ο ΓΕΝΙΚΟ ΛΥΚΕΙΟ ΗΡΑΚΛΕΙΟΥ - ΚΑΠΕΤΑΝΑΚΕΙΟ ΘΕΜΑΤΑ ΠΑΝΕΛΛΗΝΙΩΝ ΕΞΕΤΑΣΕΩΝ ΣΤΟ 2 Ο ΚΕΦΑΛΑΙΟ (ΑΝΤΙΓΡΑΦΗ, ΕΚΦΡΑΣΗ ΚΑΙ ΡΥΘΜΙΣΗ ΤΗΣ ΓΕΝΕΤΙΚΗΣ ΠΛΗΡΟΦΟΡΙΑΣ) 2000 ΗΜΕΡΗΣΙΟ Ζήτηµα 2ο Α. Η διαδικασία της αντιγραφής

Διαβάστε περισσότερα

ΒΙΟΛΟΓΙΑ Γ' ΛΥΚΕΙΟΥ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ 2005 ΕΚΦΩΝΗΣΕΙΣ

ΒΙΟΛΟΓΙΑ Γ' ΛΥΚΕΙΟΥ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ 2005 ΕΚΦΩΝΗΣΕΙΣ ΘΕΜΑ 1ο ΒΙΟΛΟΓΙΑ Γ' ΛΥΚΕΙΟΥ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ 2005 ΕΚΦΩΝΗΣΕΙΣ Να γράψετε στο τετράδιό σας τον αριθµό καθεµιάς από τις παρακάτω ηµιτελείς προτάσεις 1 έως 5 και δίπλα το γράµµα που αντιστοιχεί στη λέξη

Διαβάστε περισσότερα

2. Οι περιοριστικές ενδονουκλεάσες παράγονται από ευκαρυωτικά κύτταρα. Μονάδες 2

2. Οι περιοριστικές ενδονουκλεάσες παράγονται από ευκαρυωτικά κύτταρα. Μονάδες 2 ΑΡΧΗ 1ΗΣ ΣΕΛΙ ΑΣ Γ ΤΑΞΗ ΘΕΜΑ 1ο ΑΠΟΛΥΤΗΡΙΕΣ ΕΞΕΤΑΣΕΙΣ Γ ΤΑΞΗΣ ΗΜΕΡΗΣΙΟΥ ΕΝΙΑΙΟΥ ΛΥΚΕΙΟΥ ΤΡΙΤΗ 3 ΙΟΥΝΙΟΥ 2003 ΕΞΕΤΑΖΟΜΕΝΟ ΜΑΘΗΜΑ: ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ ΣΥΝΟΛΟ ΣΕΛΙ ΩΝ: ΤΕΣΣΕΡΙΣ (4) Α. Να γράψετε

Διαβάστε περισσότερα

ΤΕΛΟΣ 1ΗΣ ΑΠΟ 5 ΣΕΛΙ ΕΣ

ΤΕΛΟΣ 1ΗΣ ΑΠΟ 5 ΣΕΛΙ ΕΣ ΑΡΧΗ 1ΗΣ ΣΕΛΙ ΑΣ ΝΕΟ & ΠΑΛΑΙΟ ΣΥΣΤΗΜΑ Γ ΗΜΕΡΗΣΙΩΝ ΠΑΝΕΛΛΑΔΙΚΕΣ ΕΞΕΤΑΣΕΙΣ Γ ΤΑΞΗΣ ΗΜΕΡΗΣΙΟΥ ΓΕΝΙΚΟΥ ΛΥΚΕΙΟΥ ΚΑΙ ΕΠΑΛ (ΟΜΑΔΑ Β ) ΠΑΡΑΣΚΕΥΗ 27 ΜΑΪΟΥ 2016 - ΕΞΕΤΑΖΟΜΕΝΟ ΜΑΘΗΜΑ: ΒΙΟΛΟΓΙΑ ΠΡΟΣΑΝΑΤΟΛΙΣΜΟΥ (ΝΕΟ

Διαβάστε περισσότερα

ΑΡΧΗ 1ΗΣ ΣΕΛΙΔΑΣ Γ ΗΜΕΡΗΣΙΩΝ

ΑΡΧΗ 1ΗΣ ΣΕΛΙΔΑΣ Γ ΗΜΕΡΗΣΙΩΝ ΑΡΧΗ 1ΗΣ ΣΕΛΙΔΑΣ Γ ΗΜΕΡΗΣΙΩΝ ΕΠΑΝΑΛΗΠΤΙΚΕΣ ΠΑΝΕΛΛΑΔΙΚΕΣ ΕΞΕΤΑΣΕΙΣ Γ ΤΑΞΗΣ ΗΜΕΡΗΣΙΟΥ ΓΕΝΙΚΟΥ ΛΥΚΕΙΟΥ ΔΕΥΤΕΡΑ 23 ΙΟΥΝΙΟΥ 2014 ΕΞΕΤΑΖΟΜΕΝΟ ΜΑΘΗΜΑ: ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ ΣΥΝΟΛΟ ΣΕΛΙΔΩΝ: ΠΕΝΤΕ (5) ΘΕΜΑ

Διαβάστε περισσότερα

ΑΝΤΙΓΡΑΦΗ, ΕΚΦΡΑΣΗ ΚΑΙ ΡΥΘΜΙΣΗ ΤΗΣ ΓΕΝΕΤΙΚΗΣ ΠΛΗΡΟΦΟΡΙΑΣ. Πώς από το DNA φτάνουμε στις πρωτεΐνες

ΑΝΤΙΓΡΑΦΗ, ΕΚΦΡΑΣΗ ΚΑΙ ΡΥΘΜΙΣΗ ΤΗΣ ΓΕΝΕΤΙΚΗΣ ΠΛΗΡΟΦΟΡΙΑΣ. Πώς από το DNA φτάνουμε στις πρωτεΐνες ΑΝΤΙΓΡΑΦΗ, ΕΚΦΡΑΣΗ ΚΑΙ ΡΥΘΜΙΣΗ ΤΗΣ ΓΕΝΕΤΙΚΗΣ ΠΛΗΡΟΦΟΡΙΑΣ Πώς από το DNA φτάνουμε στις πρωτεΐνες Αντιγραφή του DNA o Ο μηχανισμός αντιγραφής του DNA ονομάζεται ημισυντηρητικός διότι κατά την αντιγραφή του

Διαβάστε περισσότερα

ΤΕΤΡΑΚΤΥΣ ΦΡΟΝΤΙΣΤΗΡΙΟ ΜΕΣΗΣ ΕΚΠΑΙ ΕΥΣΗΣ

ΤΕΤΡΑΚΤΥΣ ΦΡΟΝΤΙΣΤΗΡΙΟ ΜΕΣΗΣ ΕΚΠΑΙ ΕΥΣΗΣ ΤΕΤΡΑΚΤΥΣ ΦΡΟΝΤΙΣΤΗΡΙΟ ΜΕΣΗΣ ΕΚΠΑΙ ΕΥΣΗΣ Αµυραδάκη 20, Νίκαια (210-4903576) ΤΑΞΗ... Γ ΛΥΚΕΙΟΥ... ΜΑΘΗΜΑ...ΒΙΟΛΟΓΙΑ ΚΑΤ/ΣΗΣ... ΝΟΕΜΒΡΙΟΣ 2011 ΑΞΙΟΛΟΓΗΣΗ ΚΕΦΑΛΑΙΑ 1 ο -2 ο ΘΕΜΑ 1ο Α. Να γράψετε στο τετράδιό

Διαβάστε περισσότερα

8. Σε στέλεχος του βακτηρίου E.coli δε λειτουργεί το γονίδιο που παράγει τον καταστολέα του οπερόνιου της λακτόζης. Ποιο είναι το αποτέλεσμα σε σχέση

8. Σε στέλεχος του βακτηρίου E.coli δε λειτουργεί το γονίδιο που παράγει τον καταστολέα του οπερόνιου της λακτόζης. Ποιο είναι το αποτέλεσμα σε σχέση Γονιδιακή ρύθμιοη 1. Εντοπίστε δύο διαφορές στον έλεγχο της γονιδιακής έκφρασης ανάμεσα στους προκαρυωτικούς και στους ευκαρυωτικούς οργανισμούς. Α. Η ρύθμιση της γσνιδιακής έκφρασης στους προκαρυωτικούς

Διαβάστε περισσότερα

ΟΜΟΣΠΟΝ ΙΑ ΕΚΠΑΙ ΕΥΤΙΚΩΝ ΦΡΟΝΤΙΣΤΩΝ ΕΛΛΑ ΟΣ (Ο.Ε.Φ.Ε.) ΕΠΑΝΑΛΗΠΤΙΚΑ ΘΕΜΑΤΑ ΕΠΑΝΑΛΗΠΤΙΚΑ ΘΕΜΑΤΑ 2017 Α ΦΑΣΗ

ΟΜΟΣΠΟΝ ΙΑ ΕΚΠΑΙ ΕΥΤΙΚΩΝ ΦΡΟΝΤΙΣΤΩΝ ΕΛΛΑ ΟΣ (Ο.Ε.Φ.Ε.) ΕΠΑΝΑΛΗΠΤΙΚΑ ΘΕΜΑΤΑ ΕΠΑΝΑΛΗΠΤΙΚΑ ΘΕΜΑΤΑ 2017 Α ΦΑΣΗ ΤΑΞΗ: Γ ΓΕΝΙΚΟΥ ΛΥΚΕΙΟΥ ΠΡΟΣΑΝΑΤΟΛΙΣΜΟΣ: ΘΕΤΙΚΩΝ ΣΠΟΥ ΩΝ ΜΑΘΗΜΑ: ΒΙΟΛΟΓΙΑ Ηµεροµηνία: Σάββατο 7 Ιανουαρίου 2017 ιάρκεια Εξέτασης: 3 ώρες ΘΕΜΑ Α Α1 δ, Α2 γ, Α3 β, Α4 δ, Α5 α ΘΕΜΑ Β ΑΠΑΝΤΗΣΕΙΣ Β1. Για τη

Διαβάστε περισσότερα

ΑΠΑΝΤΗΣΕΙΣ. ΘΕΜΑ Α A1. β Α2. γ Α3. γ Α4. α Α5. δ

ΑΠΑΝΤΗΣΕΙΣ. ΘΕΜΑ Α A1. β Α2. γ Α3. γ Α4. α Α5. δ ΘΕΜΑ Α A1. β Α2. γ Α3. γ Α4. α Α5. δ ΕΠΑΝΑΛΗΠΤΙΚΕΣ ΠΑΝΕΛΛΑΔΙΚΕΣ ΕΞΕΤΑΣΕΙΣ Δ ΤΑΞΗΣ ΕΣΠΕΡΙΝΟΥ ΓΕΝΙΚΟΥ ΛΥΚΕΙΟΥ ΚΑΙ ΕΠΑΛ (ΟΜΑΔΑ Β ) ΤΕΤΑΡΤΗ 15 ΙΟΥΝΙΟΥ 2016 ΕΞΕΤΑΖΟΜΕΝΟ ΜΑΘΗΜΑ: ΒΙΟΛΟΓΙΑ ΠΡΟΣΑΝΑΤΟΛΙΣΜΟΥ (ΝΕΟ

Διαβάστε περισσότερα

Φάσμα& Group προπαρασκευή για Α.Ε.Ι. & Τ.Ε.Ι.

Φάσμα& Group προπαρασκευή για Α.Ε.Ι. & Τ.Ε.Ι. σύγχρονο Φάσμα& Group προπαρασκευή για Α.Ε.Ι. & Τ.Ε.Ι. μαθητικό φροντιστήριο 1. 25ης Μαρτίου 111 ΠΕΤΡΟΥΠΟΛΗ 50.27.990 50.20.990 2. 25ης Μαρτίου 74 Π. ΠΕΤΡΟΥΠΟΛΗΣ 50.50.658 50.60.845 3. Γραβιάς 85 ΚΗΠΟΥΠΟΛΗ

Διαβάστε περισσότερα

ΠΑΝΕΛΛΗΝΙΕΣ ΕΞΕΤΑΣΕΙΣ Γ' ΤΑΞΗΣ ΗΜΕΡΗΣΙΟΥ ΓΕΝΙΚΟΥ ΛΥΚΕΙΟΥ ΚΑΙ ΕΠΑΛ (ΟΜΑΛΑ Β ) ΠΑΡΑΣΚΕΥΗ 27 ΜΑΙΟΥ 2016 ΕΞΕΤΑΖΟΜΕΝΟ ΜΑΘΗΜΑ: ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΩΝ ΣΠΟΥ ΩΝ ΘΕΜΑ Α Να γράψετε στο τετράδιό σας τον αριθμό καθεμιάς

Διαβάστε περισσότερα

Θέματα Πανελλαδικών

Θέματα Πανελλαδικών Θέματα Πανελλαδικών 2000-2015 ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΗΜΕΡΗΣΙΩΝ ΛΥΚΕΙΩΝ ΕΣΠΕΡΙΝΩΝ ΛΥΚΕΙΩΝ ΕΠΑΝΑΛΗΠΤΙΚΕΣ ΟΜΟΓΕΝΩΝ Κεφάλαιο 2 Περιεχόμενα Περιεχόμενα 1 Κεφάλαιο 1 ο Το γενετικό υλικό Θέμα 1 ο 2 Θέμα 2 ο 8 Θέμα

Διαβάστε περισσότερα

ΒΙΟΛΟΓΙΑ ΠΡΟΣΑΝΑΤΟΛΙΣΜΟΥ ΘΕΤΙΚΩΝ ΣΠΟΥ ΩΝ 2017 ΑΠΑΝΤΗΣΕΙΣ ËÁÌÉÁ

ΒΙΟΛΟΓΙΑ ΠΡΟΣΑΝΑΤΟΛΙΣΜΟΥ ΘΕΤΙΚΩΝ ΣΠΟΥ ΩΝ 2017 ΑΠΑΝΤΗΣΕΙΣ ËÁÌÉÁ ΘΕΜΑ Α Α1: δ Α2: δ Α3: β Α4: γ Α5: α ΘΕΜΑ Β ΒΙΟΛΟΓΙΑ ΠΡΟΣΑΝΑΤΟΛΙΣΜΟΥ ΘΕΤΙΚΩΝ ΣΠΟΥ ΩΝ 2017 ΑΠΑΝΤΗΣΕΙΣ Β1. Ι Α, ΙΙ Ε, ΙΙΙ ΣΤ, ΙV Β, V Ζ, VII Γ, VII - Β2. Η εικόνα 1 αντιστοιχεί σε προκαρυωτικό κύτταρο. Αυτό

Διαβάστε περισσότερα

ΤΕΛΟΣ 1ΗΣ ΑΠΟ 5 ΣΕΛΙΔΕΣ

ΤΕΛΟΣ 1ΗΣ ΑΠΟ 5 ΣΕΛΙΔΕΣ ΑΡΧΗ 1ΗΣ ΣΕΛΙΔΑΣ Γ ΗΜΕΡΗΣΙΩΝ ΠΑΝΕΛΛΑΔΙΚΕΣ ΕΞΕΤΑΣΕΙΣ Γ ΤΑΞΗΣ ΗΜΕΡΗΣΙΟΥ ΓΕΝΙΚΟΥ ΛΥΚΕΙΟΥ ΠΑΡΑΣΚΕΥΗ 16 IOYNIOΥ 2017 ΕΞΕΤΑΖΟΜΕΝΟ ΜΑΘΗΜΑ: ΒΙΟΛΟΓΙΑ ΠΡΟΣΑΝΑΤΟΛΙΣΜΟΥ ΣΥΝΟΛΟ ΣΕΛΙΔΩΝ: ΠΕΝΤΕ (5) ΘΕΜΑ Α Να γράψετε

Διαβάστε περισσότερα

Βιολογία. Γ ΚΥΚΛΟΣ ΠΡΟΣΟΜΟΙΩΤΙΚΩΝ ΔΙΑΓΩΝΙΣΜΑΤΩΝ ΣΥΓΧΡΟΝΟ Προτεινόμενα Θέματα Γ ΓΕΛ. Ιανουάριος προσανατολισμού ΘΕΜΑ Α

Βιολογία. Γ ΚΥΚΛΟΣ ΠΡΟΣΟΜΟΙΩΤΙΚΩΝ ΔΙΑΓΩΝΙΣΜΑΤΩΝ ΣΥΓΧΡΟΝΟ Προτεινόμενα Θέματα Γ ΓΕΛ. Ιανουάριος προσανατολισμού ΘΕΜΑ Α Βιολογία προσανατολισμού ΘΕΜΑ Α Να επιλέξετε τη σωστή απάντηση. Α1. Αν μια ασθένεια καθορίζεται από επικρατές φυλοσύνδετο γονίδιο θα εμφανίζεται: α. Σε όλους τους απογόνους εφόσον ο ένας γονέας έχει την

Διαβάστε περισσότερα

Α2. Οι ιστόνες είναι α. DNA β. RNA γ. πρωτεΐνες δ. υδατάνθρακες. Μονάδες 5

Α2. Οι ιστόνες είναι α. DNA β. RNA γ. πρωτεΐνες δ. υδατάνθρακες. Μονάδες 5 ΑΡΧΗ 1ΗΣ ΣΕΛΙ ΑΣ - ΕΣΠΕΡΙΝΩΝ ΠΑΝΕΛΛΗΝΙΕΣ ΕΞΕΤΑΣΕΙΣ ΤΑΞΗΣ ΕΣΠΕΡΙΝΟΥ ΓΕΝΙΚΟΥ ΛΥΚΕΙΟΥ ΚΑΙ ΕΠΑΛ (ΟΜΑ Α Β ) ΤΕΤΑΡΤΗ 3 ΜΑΪΟΥ 212 ΕΞΕΤΑΖΟΜΕΝΟ ΜΑΘΗΜΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ: ΒΙΟΛΟΓΙΑ ΣΥΝΟΛΟ ΣΕΛΙ ΩΝ: ΠΕΝΤΕ (5) ΘΕΜΑ

Διαβάστε περισσότερα

ΕΡΩΤΗΣΕΙΣ Π Ο Λ Λ Α Π Λ Η Σ Ε Π Ι Λ Ο Γ Η Σ ΝΑ ΣΗΜΕΙΩΣΕΙΣ ΤΗ ΣΩΣΤΗ ΑΠΑΝΤΗΣΗ

ΕΡΩΤΗΣΕΙΣ Π Ο Λ Λ Α Π Λ Η Σ Ε Π Ι Λ Ο Γ Η Σ ΝΑ ΣΗΜΕΙΩΣΕΙΣ ΤΗ ΣΩΣΤΗ ΑΠΑΝΤΗΣΗ ΕΡΩΤΗΣΕΙΣ Π Ο Λ Λ Α Π Λ Η Σ Ε Π Ι Λ Ο Γ Η Σ ΝΑ ΣΗΜΕΙΩΣΕΙΣ ΤΗ ΣΩΣΤΗ ΑΠΑΝΤΗΣΗ 1. Η ποσότητα του DNΑ α. είναι ίδια σε όλους τους απλοειδείς οργανισµούς β. είναι σταθερή σε όλους τους διπλοειδείς οργανισµούς

Διαβάστε περισσότερα

Γ' ΛΥΚΕΙΟΥ ΘΕΤΙΚΗ ΚΑΤΕΥΘΥΝΣΗ ΒΙΟΛΟΓΙΑ ΑΠΑΝΤΗΣΕΙΣ ÏÅÖÅ

Γ' ΛΥΚΕΙΟΥ ΘΕΤΙΚΗ ΚΑΤΕΥΘΥΝΣΗ ΒΙΟΛΟΓΙΑ ΑΠΑΝΤΗΣΕΙΣ ÏÅÖÅ 1 Γ' ΛΥΚΕΙΟΥ ΘΕΤΙΚΗ ΚΑΤΕΥΘΥΝΣΗ ΒΙΟΛΟΓΙΑ ΘΕΜΑ 1 ο 1 γ 2 δ 3 β 4 α 5 γ ΘΕΜΑ 2 ο ΑΠΑΝΤΗΣΕΙΣ Μονάδες 25 (5Χ5) Α. ιαγονιδιακά ζώα ονοµάζονται εκείνα στα οποία το γενετικό τους υλικό έχει τροποποιηθεί µε την

Διαβάστε περισσότερα