Save this PDF as:

Μέγεθος: px
Εμφάνιση ξεκινά από τη σελίδα:




2 Οι ιστοί που περιέχουν κερατίνες Είναι συνήθως ισχυροί και αδιάλυτοι - πρέπει να έχουν παίξει σημαντικό ρόλο στη εξέλιξη των σπονδυλωτών -Χωρίζονται σε μαλακές και σκληρές κερατίνες -Μαλακές: επιδερμίδα, κάλοι -Σκληρές: μαλλιά, νύχια, οπλές -Δομική μονάδα και στα δύο είδη: Το σπειροειδές σπείραμα Αλφα-ελίκων (coiled-coil)

3 Δομικά χαρακτηριστικά : Επαναλήψιμες αλληλουχίες κάθε 7 αμινοξέα (heptad repeat, a g) Όπου a, d υδρόφοβα αμινοξέα (συνήθως λευκίνη) e, g φορτισμένα αμινοξέα Το σπειροειδές σπείραμα Αλφα-ελίκων (coiled-coil)

4 Δομικά χαρακτηριστικά : -Οι δύο έλικες περιελίσσονται -Είναι ελαφρά στρεβλωμένες (3, 5 αμινοξέα / στροφή) περιοδικότητα 7 αμινοξέων -Υδρόφοβες αλληλεπιδράσεις Δια μέσου των αμινοξέων a,d -ιοντικές αλληλεπιδράσεις Δια μέσου των αμινοξέων e, g

5 Οι δύο έλικες περιελίσσονται Αποτέλεσμα: Ηυπερέλικατούσπειροειδούςσπειράματος Αλφα-ελίκων (coiled-coil)

6 Τα σπειροειδή σπειράματα αυτο-οργανώνονται ιεραρχικά και σχηματίζουν τα ενδιάμεσα ινίδια Του κυτταρικού σκελετού

7 Κυτταροσκελετός: Δίκτυο πρωτεϊνικών ινιδίων που εκτείνεται Σε όλο το κυτταρόπλασμα

8 Κυτταροσκελετός: Τρία είδη ινιδίων Τα ενδιάμεσα ινίδια είναι τα σκληρώτερα και ανθεκτικώτερα

9 Σπουδαιότερη λειτουργία των ενδιάμεσων ινιδίων: Εξασφάλιση της αντοχής των κυττάρων στην μηχανική πίεση Τέντωμα των ινιδίων κατανομή των δυνάμεων πού Εφαρμόζονται εξωτερικά προστασία από την ρήξη αναλογία με τα σύνθετα υλικά, (εγκλεισμός ινών σε πολυμερική μήτρα, fiber-embedded composite)

10 Κερατίνες: ανήκουν στην οικογένεια τωνενδιάμεσωνινιδίων Ινώδες συστατικό των μαλλιών, νυχιών, κεράτων Στα θηλαστικά Διατομή ανθρώπινης τρίχας μαλλιών: Ίνες κερατίνης μέσα σε μήτρα από μη ινώδεις πρωτείνες και λιπίδια

11 Διατομή ανθρώπινης τρίχας μαλλιών: Μακρο ινίδια μικρο ινίδια www. hair-science.com

12 Διατομή ανθρώπινης τρίχας μαλλιών: πρωτο- ινίδια (καλώδιο 4 ελίκων κερατίνης)

13 Χημική σύσταση ανθρώπινης τρίχας μαλλιών: Ίνες κερατίνης μέσα σε μήτρα από μη ινώδεις πρωτείνες Και λιπίδια Σημαντικό χαρακτηριστικο: μεγάλη περιεκτικότητα σε κυστεϊνη που είναι οξειδωμένη υπό μορφή δισουλφιδικών δεσμών (διακρίνει τις κερατίνες από άλλες δομικές ίνες) Οι ίνες κερατίνης έχουν χαμηλή περιεκτικότητα σε κυστεϊνη Οι μη ινώδεις πρωτείνες έχουν υψηλή περιεκτικότητα σε κυστεϊνη Δισουλφιδικοί δεσμοί ανάμεσα στις ίνες κερατίνης Καθορίζουν το σχήμα των μαλλιών Οσο περισσότεροι δισουλφιδικοί δεσμοί, Τόσο πιο σγουρά είναι τα μαλλιά Ποιες είναι οι πρακτικές εφαρμογές?

14 Οσο περισσότεροι δισουλφιδικοί δεσμοί, Τόσο πιο σγουρά είναι τα μαλλιά Ποιες είναι οι πρακτικές εφαρμογές?

15 Μηχανικές ιδιότητες μαλλιού (πρόβατο) Υλικο Μέτρο ελαστικότητας (GPa) Μαλλι 0.5 Συνθετικο καουτσουκ Ναυλον 5 Kevlar 130 Ατσάλι υψηλής αντοχής 200

16 Μηχανικές ιδιότητες μαλλιού (πρόβατο) Υλικο αντοχή, σ max (GPa) Μαλλι 0.2 Συνθετικο καουτσουκ 0.05 Ναυλον 0.95 Kevlar 3.6 Ατσάλι υψηλής αντοχής 1.5

17 Μηχανικές ιδιότητες μαλλιού (πρόβατο) Υλικο εκτατικότητα, ε max Μαλλι 0.5 Συνθετικο καουτσουκ 8.5 Ναυλον 0.18 Kevlar Ατσάλι υψηλής αντοχής 0.008

18 Μηχανικές ιδιότητες μαλλιού (πρόβατο) Υλικο ανθεκτικότητα (MJ/m 3 ) Μαλλι 60 Συνθετικο καουτσουκ 100 Ναυλον 80 Kevlar 50 Ατσάλι υψηλής αντοχής 6

19 Μηχανικές ιδιότητες ανθρώπινης τρίχας μαλλιών Τι μας λένε οι καμπύλες τάσης- παραμόρφωσης?

20 Μηχανικές ιδιότητες ανθρώπινης τρίχας μαλλιών Τι μας λένε οι καμπύλες τάσης- παραμόρφωσης? 1) Συμπεριφορά σύνθετου υλικού (επιμήκυνση αρχικά των ελίκων της ινώδους φάσης, με κατόπιν σπάσιμο των δεσμών υδρογόνου και αποδίπλωση) Με αποτέλεσμα: Δημιουργία εκτεταμένων βήτα-πτυχωτών επιφανειών και Μετάπτωση από δομή α-έλικας σε Δομή β-πτυχωτών φύλλων

21 Μετάπτωση από δομή α-έλικας σε Δομή β-πτυχωτών φύλλων

22 Μηχανικές ιδιότητες ανθρώπινης τρίχας μαλλιών Τι μας λένε οι καμπύλες τάσης- παραμόρφωσης? 2) Υλικό με μεγάλη υστέρηση (i.e. ενέργεια χάνεται στην επαναφορά αντί να είναι διαθέσιμη για θραύση) Φαίνεται ότι οι δισουλφιδικοί δεσμοί Μεταξύ των αλφα-ελίκων συνεισφέρουν Στις δυνάμεις επαναφοράς

23 Μηχανικές ιδιότητες τρίχας ουράς αλόγου (χρησιμοποιείται στα δοξάρια των βιολιών)

24 Αρχιτεκτονική οπλών και κεράτων

25 Μηχανικές ιδιότητες κεράτων ρινόκερου Τι μας λένε οι καμπύλες τάσης- παραμόρφωσης?

26 Ιστορικά, οι κερατίνες είναι μιά πολύ μελετημένη οικογένεια πρωτεϊνών λόγω Της μεγάλης οικονομικής τους σπουδαιότητας : -ζωϊκές ίνες υφασμάτων (μαλλί) -συνθετικήπαραγωγήμαλλιού? -ανάπτυξη συνθετικών υποκαταστάτων μαλλιών και επιδερμίδας

27 CSIRO (Australian Commonwealth Scientific and Research Organization) OPTIM TM FIBERS


29 Kερατίνες των πτηνών και ερπετών (Φτερά πτηνών, ποδαράκια του gecko )

30 Οι κερατίνες των πτηνών και ερπετών Έχουν δομή βητα- πτυχωτών φύλλων, π.χ, Φτερά πτηνών, ποδαράκια του gecko

31 Δομικά χαρακτηριστικά κερατίνης φτερών κότας Βασική επαναλαμβανόμενη μονάδα: αντιπαράλληλη στραμμένη πτυχωτή επιφάνεια 4 πτυχώσεων Σχηματίζεται έλικα με 4 μονάδες/στροφή Δύο έλικες περιελίσσονται σε υπερέλικα

32 Δομικά χαρακτηριστικά υπερέλικας: Βημα 95 Å, πάχος περιπου 25 Å


ΒΙΟΛΟΓΙΚΕΣ ΙΝΕΣ ΜΕΤΑΞΙ ΙΣΤΟΙ ΑΡΑΧΝΩΝ ΒΙΟΛΟΓΙΚΕΣ ΙΝΕΣ ΜΕΤΑΞΙ ΙΣΤΟΙ ΑΡΑΧΝΩΝ Βιοσυνθεση του μεταξιου (πρωτεινη) -δυο κυριες πρωτεινες > φιβροινη+σερισινη Κατά την διαρκεια του περασματος από τον αδενα του μεταξοσκωληκα, οι πολυπεπτιδικες αλυσιδες

Διαβάστε περισσότερα

Οι πρωτεΐνες μπορεί να είναι σφαιρικές (συμπαγείς) ή ινώδεις

Οι πρωτεΐνες μπορεί να είναι σφαιρικές (συμπαγείς) ή ινώδεις Οι πρωτεΐνες μπορεί να είναι σφαιρικές (συμπαγείς) ή ινώδεις Β-1 Οι συμπαγείς, σφαιροειδείς πρωτεΐνες Είναι ευδιάλυτες στο νερό Έχουν σφαιρικό σχήμα Έχουν τα περισσότερα πολικά αμινοξέα στην εξωτερική

Διαβάστε περισσότερα


ΠΡΩΤΕΪΝΕΣ ΤΟΥ ΣΥΝΔΕΤΙΚΟΥ ΙΣΤΟΥ ΠΡΩΤΕΪΝΕΣ ΤΟΥ ΣΥΝΔΕΤΙΚΟΥ ΙΣΤΟΥ ΚΟΛΛΑΓΟΝΟ -ινώδης πρωτεϊνη -σχηματίζει αδιάλυτες ίνες με μεγάλη αντοχή στον εφελκυσμό -η πιο άφθονη πρωτεϊνη των θηλαστικών, αποτελεί το ¼ της συνολικής πρωτείνης του οργανισμού

Διαβάστε περισσότερα



Διαβάστε περισσότερα

Δομικές κατηγορίες πρωτεϊνών

Δομικές κατηγορίες πρωτεϊνών 3-1 Κεφάλαι ο Δομικές κατηγορίες πρωτεϊνών 3.1. α-δομές πρωτεϊνών Οι α-έλικες είναι δομικά στοιχεία που μπορούν να σχηματίσουν πολλές κατηγορίες στερεοδομών και με πολλές διαφορετικές λειτουργίες. Εκτός

Διαβάστε περισσότερα

πρωτεΐνες πολυμερείς ουσίες δομούν λειτουργούν λευκώματα 1.Απλές πρωτεΐνες 2.Σύνθετες πρωτεΐνες πρωτεΐδια μη πρωτεϊνικό μεταλλοπρωτεΐνες

πρωτεΐνες πολυμερείς ουσίες δομούν λειτουργούν λευκώματα 1.Απλές πρωτεΐνες 2.Σύνθετες πρωτεΐνες πρωτεΐδια μη πρωτεϊνικό μεταλλοπρωτεΐνες ΠΡΩΤΕΙΝΕΣ Οι πρωτεΐνες είναι πολυμερείς ουσίες με κυρίαρχο και πρωταρχικό ρόλο στη ζωή. Πρωτεΐνες είναι οι ουσίες που κυρίως δομούν και λειτουργούν τους οργανισμούς. Λέγονται και λευκώματα λόγω του λευκού

Διαβάστε περισσότερα

Οι πρωτεΐνες συμμετέχουν σε όλες τις κυτταρικές λειτουργίες

Οι πρωτεΐνες συμμετέχουν σε όλες τις κυτταρικές λειτουργίες Οι πρωτεΐνες συμμετέχουν σε όλες τις κυτταρικές λειτουργίες Γένωμα vs Πρωτέωμα Όλη η αλληλουχία βάσεων στο DNA Τι είναι δυνατόν Συγκεκριμένο Στατικό Οι πρωτεΐνες που κωδικοποιούνται από το γένωμα Τι είναι

Διαβάστε περισσότερα



Διαβάστε περισσότερα

Διαλέξεις Χημείας Αγγελική Μαγκλάρα, PhD Εργαστήριο Κλινικής Χημείας Ιατρική Σχολή Πανεπιστημίου Ιωαννίνων

Διαλέξεις Χημείας Αγγελική Μαγκλάρα, PhD Εργαστήριο Κλινικής Χημείας Ιατρική Σχολή Πανεπιστημίου Ιωαννίνων Διαλέξεις Χημείας -2014 Αγγελική Μαγκλάρα, PhD Εργαστήριο Κλινικής Χημείας Ιατρική Σχολή Πανεπιστημίου Ιωαννίνων 1. Κατάταξη 2. Λειτουργίες 1. Πεπτιδικές ορμόνες 3. Πεπτιδικός δεσμός 1. Χαρακτηριστικά

Διαβάστε περισσότερα



Διαβάστε περισσότερα

Υπερδευτεροταγής Δομή Πρωτεϊνών

Υπερδευτεροταγής Δομή Πρωτεϊνών Υπερδευτεροταγής Δομή Πρωτεϊνών Δομικά μοτίβα Τα μοτίβα ακολουθιών (sequence motifs) είναι τοπικά διατηρημένες ακολουθίες που σχετίζονται (ή όχι) με μια συγκεκριμένη λειτουργία (βλ. τη βάση δεδομένων PROSITE)

Διαβάστε περισσότερα

Εκτροφή μηρυκαστικών ζώων

Εκτροφή μηρυκαστικών ζώων Εκτροφή μηρυκαστικών ζώων Εργαστήριο Γενικής και Ειδικής Ζωοτεχνίας Θεματική ενότητα 2: Εκτίμηση ερίου 1 Τμήμα: Επιστήμης Ζωικής Παραγωγής & Υδατοκαλλιεργειών Διδάσκοντες: Παναγιώτα Κουτσούλη Αντικειμενικοί

Διαβάστε περισσότερα

ΒΙΟΛΟΓΙΑ. Παραδόσεις του μαθήματος γενικής παιδείας (Β λυκείου) Επιμέλεια: ΑΡΓΥΡΗΣ ΙΩΑΝΝΗΣ Βιολόγος M.Sc. Καθηγητής 3 ου λυκ.

ΒΙΟΛΟΓΙΑ. Παραδόσεις του μαθήματος γενικής παιδείας (Β λυκείου) Επιμέλεια: ΑΡΓΥΡΗΣ ΙΩΑΝΝΗΣ Βιολόγος M.Sc. Καθηγητής 3 ου λυκ. ΒΙΟΛΟΓΙΑ Παραδόσεις του μαθήματος γενικής παιδείας (Β λυκείου) Επιμέλεια: ΑΡΓΥΡΗΣ ΙΩΑΝΝΗΣ Βιολόγος M.Sc. Καθηγητής 3 ου λυκ. Ηλιούπολης Κεφάλαιο 1ο ΒΙΟΛΟΓΙΚΑ ΜΑΚΡΟΜΟΡΙΑ Η ΙΕΡΑΡΧΙΑ ΤΩΝ ΒΙΟΜΟΡΙΩΝ ΠΡΟΔΡΟΜΕΣ

Διαβάστε περισσότερα

Δομές (Διαμορφώσεις) Πρωτεινικών μορίων

Δομές (Διαμορφώσεις) Πρωτεινικών μορίων Δομές (Διαμορφώσεις) Πρωτεινικών μορίων Πρωτοταγής δομή (αλληλουχία αμινοξέων) Δευτεροταγής δομή Η διάταξη της πεπτιδικής αλυσίδας στον χωρο αυτής καθ αυτής (χωρίς να ληφθούν υπ όψη οι ομάδες R) Τριτοταγής

Διαβάστε περισσότερα

Osteogenesis Imperfecta (Ατελής Οστεογένεση ) Ομάδα: Πατρασκάκη Μυρτώ Τσιτσικλή Μαγδαληνή

Osteogenesis Imperfecta (Ατελής Οστεογένεση ) Ομάδα: Πατρασκάκη Μυρτώ Τσιτσικλή Μαγδαληνή Osteogenesis Imperfecta (Ατελής Οστεογένεση ) Ομάδα: Πατρασκάκη Μυρτώ Τσιτσικλή Μαγδαληνή Osteogenesis imperfecta Μενδελικό Νόσημα Συχνότητα στον πληθυσμό: 1:20.000 80-95% αυτοσωμικό επικρατές 10-15% αυτοσωμικό

Διαβάστε περισσότερα

Αρχιτεκτονική της τρισδιάστατης δομής πρωτεϊνών

Αρχιτεκτονική της τρισδιάστατης δομής πρωτεϊνών Αρχιτεκτονική της τρισδιάστατης δομής πρωτεϊνών Βασίλης Προμπονάς, PhD Ερευνητικό Εργαστήριο Βιοπληροφορικής Τμήμα Βιολογικών Επιστημών Νέα Παν/πολη, Γραφείο B161 Πανεπιστήμιο Κύπρου Ταχ.Κιβ. 20537 1678,

Διαβάστε περισσότερα

Ποια κύτταρα έχουν κυτταροσκελετό; Όλα τα ευκαρυωτικά!

Ποια κύτταρα έχουν κυτταροσκελετό; Όλα τα ευκαρυωτικά! Ποια κύτταρα έχουν κυτταροσκελετό; Όλα τα ευκαρυωτικά! Αρχικά πιστευόταν ότι τα µικροϊνίδια είναι χαρακτηριστικό µόνο των γραµµωτών µυών. Το ΗΜ υπερ-υψηλής τάσης συνέβαλε (άθελά του) στην ανακάλυψη του

Διαβάστε περισσότερα

Εργαστήριο Συνθέτων Υλικών

Εργαστήριο Συνθέτων Υλικών Εργαστήριο Συνθέτων Υλικών Εργαστηριακή Άσκηση 04 ΥΛΙΚΑ ΕΝΙΣΧΥΣΗΣ Διδάσκων Δρ Κατσιρόπουλος Χρήστος Τμήμα Μηχανολογίας ΑΤΕΙ Πατρών 2014-15 1 Ταξινόμηση ΣΥ 2 Διάφοροι Τύποι ινών 3 Ίνες Άνθρακα -υψηλές ειδικές

Διαβάστε περισσότερα



Διαβάστε περισσότερα

Δομή πρωτεϊνών: Τριτοταγής διαμόρφωση της δομής

Δομή πρωτεϊνών: Τριτοταγής διαμόρφωση της δομής Δομή πρωτεϊνών: Τριτοταγής διαμόρφωση της δομής - Αναφέρεται στην αναδίπλωση της πολυπεπτιδικής αλυσίδας πάνω στον εαυτό της και στο τελικό σχήμα που θα πάρει στο χώρο -Σ αυτή τη διαμόρφωση σημαντικό ρόλο

Διαβάστε περισσότερα

Μεταγωγή σήματος και βιολογικές μεμβράνες

Μεταγωγή σήματος και βιολογικές μεμβράνες Μεταγωγή σήματος και βιολογικές μεμβράνες ΜΕΜΒΡΑΝΙΚΕΣ ΠΡΩΤΕΪΝΕΣ ΠΡΩΤΕΪΝΕΣ ΒΙΟΛΟΓΙΚΩΝ ΜΕΜΒΡΑΝΩΝ Ορισμός / Μονάδες Δομές (πρωτοταγής κλπ) Ταξινόμηση με βάση τις λειτουργίες Απεικόνιση - Μοντέλα (συρμάτων

Διαβάστε περισσότερα

οµή και Αναδίπλωση πρωτεϊνών

οµή και Αναδίπλωση πρωτεϊνών οµή και Αναδίπλωση πρωτεϊνών Νηφόρου Κατερίνα Μεταδιδακτορική Ερευνήτρια, Οµάδα Μοριακής Καρκινογένεσης, Εργ/ριο Ιστολογίας-Εµβρυολογίας, Ιατρική Σχολή Αθηνών Σηµασία των πρωτεϊνών Ενζυµική κατάλυση Μεταφορά

Διαβάστε περισσότερα

Καλλιεργούνται πολλές ποικιλίες σιταριών, οι οποίες χωρίζονται σε δύο κατηγορίες: α) σε σκληρά σιτάρια τα οποία έχουν υψηλότερο ποσοστό σε πρωτεΐνη

Καλλιεργούνται πολλές ποικιλίες σιταριών, οι οποίες χωρίζονται σε δύο κατηγορίες: α) σε σκληρά σιτάρια τα οποία έχουν υψηλότερο ποσοστό σε πρωτεΐνη Δημητριακά Δημητριακά ή σιτηρά είναι αποξηραμένοι ώριμοι καρποί φυτών. Τα πιο σημαντικά δημητριακά είναι το σιτάρι ή σίτος, το ρύζι, το καλαμπόκι ή αραβόσιτος, το κριθάρι, η σίκαλη και η βρώμη. Ο κόκκος

Διαβάστε περισσότερα



Διαβάστε περισσότερα

Κεφάλαιο 3. Δομές τάξης α

Κεφάλαιο 3. Δομές τάξης α Κεφάλαιο 3 Δομές τάξης α Κεφάλαιο 3 Δομές Τάξης α: Σπειρωμένα Σπειράματα Εικόνα 3.1 Σχηματικό διάγραμμα της δομής ενός σπειρωμένου σπειράματος α-ελίκων. Δύο α-έλικες συμπλέκονται και σταδιακά τυλίγονται

Διαβάστε περισσότερα

Τα χημικά στοιχεία που είναι επικρατέστερα στους οργανισμούς είναι: i..

Τα χημικά στοιχεία που είναι επικρατέστερα στους οργανισμούς είναι: i.. ΦΥΛΛΟ ΕΡΓΑΣΙΑΣ ΣΤΟ 1 ο ΚΕΦΑΛΑΙΟ «XHMIKH ΣΥΣΤΑΣΗ ΤΟΥ ΚΥΤΤΑΡΟΥ» ΕΙΣΑΓΩΓΗ ΚΑΙ Η ΧΗΜΕΙΑ ΤΗΣ ΖΩΗΣ Α. ΔΡΑΣΤΗΡΙΟΤΗΤΕΣ ΜΕΣΑ ΣΤΗΝ ΤΑΞΗ 1. Όταν αναφερόμαστε στον όρο «Χημική Σύσταση του Κυττάρου», τί νομίζετε ότι

Διαβάστε περισσότερα



Διαβάστε περισσότερα

Οργανική Χημεία. Κεφάλαιο 27: Βιομόρια, αμινοξέα, πεπτίδια και πρωτεΐνες

Οργανική Χημεία. Κεφάλαιο 27: Βιομόρια, αμινοξέα, πεπτίδια και πρωτεΐνες Οργανική Χημεία Κεφάλαιο 27: Βιομόρια, αμινοξέα, πεπτίδια και πρωτεΐνες 1. Γενικά Πρωτεΐνες: μεγάλα βιομόρια που απαντούν σε όλους τους ζωντανούς οργανισμούς Διαφορετικά είδη πρωτεϊνών με ποικίλη βιολογική

Διαβάστε περισσότερα

οµή και λειτουργία των µεγάλων βιολογικών µορίων

οµή και λειτουργία των µεγάλων βιολογικών µορίων οµή και λειτουργία των µεγάλων βιολογικών µορίων οµή και λειτουργία των µεγάλων βιολογικών µορίων κατηγορίες υδατάνθρακες πρωτεΐνες νουκλεϊνικά οξέα λιπίδια Οι πρωτεΐνες, υδατάνθρακες, νουκλεϊνικά οξέα

Διαβάστε περισσότερα

Βιολογικές Μεμβράνες και Μεταγωγή Σήματος

Βιολογικές Μεμβράνες και Μεταγωγή Σήματος ΠΑΝΕΠΙΣΤΗΜΙΟ ΙΩΑΝΝΙΝΩΝ ΑΝΟΙΚΤΑ ΑΚΑΔΗΜΑΪΚΑ ΜΑΘΗΜΑΤΑ Βιολογικές Μεμβράνες και Μεταγωγή Σήματος Πρωτεΐνες Διδάσκουσα: Καθ. Μαρία - Ελένη Ε. Λέκκα Άδειες Χρήσης Το παρόν εκπαιδευτικό υλικό υπόκειται σε άδειες

Διαβάστε περισσότερα

«ΕΙΣΑΓΩΓΗ ΣΤΗ ΔΟΜΗ ΞΥΛΟΥ» ΧΗΜΙΚΗ ΣΥΣΤΑΣΗ ΤΟΥ ΞΥΛΟΥ. Δρ. Γεώργιος Μαντάνης Εργαστήριο Τεχνολογίας Ξύλου Τμήμα Σχεδιασμού & Τεχνολογίας Ξύλου & Επίπλου

«ΕΙΣΑΓΩΓΗ ΣΤΗ ΔΟΜΗ ΞΥΛΟΥ» ΧΗΜΙΚΗ ΣΥΣΤΑΣΗ ΤΟΥ ΞΥΛΟΥ. Δρ. Γεώργιος Μαντάνης Εργαστήριο Τεχνολογίας Ξύλου Τμήμα Σχεδιασμού & Τεχνολογίας Ξύλου & Επίπλου «ΕΙΣΑΓΩΓΗ ΣΤΗ ΔΟΜΗ ΞΥΛΟΥ» ΧΗΜΙΚΗ ΣΥΣΤΑΣΗ ΤΟΥ ΞΥΛΟΥ Δρ. Γεώργιος Μαντάνης Εργαστήριο Τεχνολογίας Ξύλου Τμήμα Σχεδιασμού & Τεχνολογίας Ξύλου & Επίπλου ΧΗΜΙΚΗ ΣΥΣΤΑΣΗ ΤΟΥ ΞΥΛΟΥ ΣΥΣΤΑΣΗ ΞΥΛΟΥ ΣΕ ΔΟΜΙΚΑ ΣΥΣΤΑΤΙΚΑ

Διαβάστε περισσότερα


ΟΛΛΙΝΤΖΑ ΠΑΝΕΠΙΣΤΗΜΙΑΚΑ ΦΡΟΝΤΙΣΤΗΡΙΑ Κ Kάνιγγος ΠΑΝΕΠΙΣΤΗΜΙΑΚΑ ΦΡΟΝΤΙΣΤΗΡΙΑ ΟΛΛΙΝΤΖΑ 10, (5ος όροφ. Τηλ: 210-3300296-7. www.kollintzas.gr 1. Χημική σύσταση του κυττάρου. 2. Δομή και λειτουργία του κυττάρου. 3. Μεταβολισμός: βασικές αρχές,

Διαβάστε περισσότερα

Δοµή και ιδιότητες του DNA. 09/04/2014 1 Μοριακή Βιολογία Κεφ. 1 Καθηγητής Δρ. Κ. Ε. Βοργιάς

Δοµή και ιδιότητες του DNA. 09/04/2014 1 Μοριακή Βιολογία Κεφ. 1 Καθηγητής Δρ. Κ. Ε. Βοργιάς Δοµή και ιδιότητες του DNA 09/04/2014 1 Ορίζεται η γραµµική αλληλουχία των 4 βάσεων damp, dcmp, dgmp, dtmp που είναι συνδεδεµένες µε 3-5 φωσφοδιεστερικό δεσµό. AGCTCGCGTCGCTCACTCTCTGCAT! TCGAGCGCAGCGAGTGAGAGACGTA!

Διαβάστε περισσότερα

Ποια η χρησιμότητα των πρωτεϊνών;

Ποια η χρησιμότητα των πρωτεϊνών; ΠΡΩΤΕΪΝΕΣ Τι είναι οι πρωτεϊνες; Η ονομασία πρωτεϊνες προέρχεται από το ρήμα πρωτεύω και σημαίνει την εξαιρετική σημασία που έχουν οι πρωτεϊνες για την υγεία του ανθρώπινου σώματος. Από την εποχή των Ολυμπιακών

Διαβάστε περισσότερα

ΤΑ ΜΟΡΙΑ ΤΗΣ ΖΩΗΣ. Τι γνωρίζετε για τους υδατάνθρακες;

ΤΑ ΜΟΡΙΑ ΤΗΣ ΖΩΗΣ. Τι γνωρίζετε για τους υδατάνθρακες; 1 ΤΑ ΜΟΡΙΑ ΤΗΣ ΖΩΗΣ Το κύτταρο αποτελείται από χηµικές ενώσεις, στις οποίες περιλαµβάνονται τα µικρά βιολογικά µόρια και τα βιολογικά µακροµόρια. Στα µικρά βιολογικά µόρια ανήκουν, τα ανόργανα στοιχεία

Διαβάστε περισσότερα

Kυτταρική Bιολογία ΔΟΜΗ ΚΑΙ ΛΕΙΤΟΥΡΓΙΕΣ ΤΩΝ ΠΡΩΤΕΪΝΩΝ ΔIAΛEΞΗ 3 (7/3/2012) Δρ. Xρήστος Παναγιωτίδης, Τμήμα Φαρμακευτικής Α.Π.Θ.

Kυτταρική Bιολογία ΔΟΜΗ ΚΑΙ ΛΕΙΤΟΥΡΓΙΕΣ ΤΩΝ ΠΡΩΤΕΪΝΩΝ ΔIAΛEΞΗ 3 (7/3/2012) Δρ. Xρήστος Παναγιωτίδης, Τμήμα Φαρμακευτικής Α.Π.Θ. Kυτταρική Bιολογία ΔIAΛEΞΗ 3 (7/3/2012) ΔΟΜΗ ΚΑΙ ΛΕΙΤΟΥΡΓΙΕΣ ΤΩΝ ΠΡΩΤΕΪΝΩΝ AΣ ΘYMHΘOYME Στην προηγούμενη διάλεξη μιλήσαμε για τη χημική σύσταση των κυττάρων και για τα βιολογικά πολυμερή που αποτελούν

Διαβάστε περισσότερα

ρ Έλενα Κουλλαπή 2014

ρ Έλενα Κουλλαπή 2014 ρ Έλενα Κουλλαπή 2014 Το µεγαλύτερο όργανο του σώµατο Μέση επιφάνεια περίπου 2 m2 Το βάρο του δέρµατο (χωρί το υποδόριο λίπο ) είναι κατά µέσο όρο 4,85 Kgr στον ενήλικο άνδρα και 3,18 Kgr στην ενήλικη

Διαβάστε περισσότερα

Οι δευτερογενείς µεταβολίτες

Οι δευτερογενείς µεταβολίτες Οι δευτερογενείς µεταβολίτες Είναιταπροϊόνταδευτερογενούςµεταβολισµού. Μερικοί γνωστοί δευτερογενείς µεταβολίτες είναι η µορφίνη, ήκαφεΐνη, το καουτσούκ κ.ά. Ο ρόλος τους φαίνεται να είναι οικολογικής

Διαβάστε περισσότερα

Στοιχεία Φυσικοχηµείας και Βιοφυσικής

Στοιχεία Φυσικοχηµείας και Βιοφυσικής Στοιχεία Φυσικοχηµείας και Βιοφυσικής Β. Φαδούλογλου 2008 Στοιχεία Φυσικοχηµείας και Βιοφυσικής Εργαστήρια Βιβλίο Εξετάσεις Ύλη Στοιχεία Φυσικοχηµείας και Βιοφυσικής Εργαστήρια Βιβλίο Εξετάσεις Ύλη Στοιχεία

Διαβάστε περισσότερα

KΕΦΑΛΑΙΟ 1ο Χημική σύσταση του κυττάρου. Να απαντήσετε σε καθεμιά από τις παρακάτω ερωτήσεις με μια πρόταση:

KΕΦΑΛΑΙΟ 1ο Χημική σύσταση του κυττάρου. Να απαντήσετε σε καθεμιά από τις παρακάτω ερωτήσεις με μια πρόταση: KΕΦΑΛΑΙΟ 1ο Χημική σύσταση του κυττάρου Ενότητα 1.1: Χημεία της ζωής Ενότητα 2.1: Μακρομόρια Να απαντήσετε σε καθεμιά από τις παρακάτω ερωτήσεις με μια πρόταση: 1. Για ποιο λόγο θεωρείται αναγκαία η σταθερότητα

Διαβάστε περισσότερα

Στηρικτικά Κύτταρα και Εξωκυττάρια Ουσία. Κοτσίνας Αθανάσιος Επικ. Καθηγητής Εργ. Ιστολογίας-Εμβρυολογίας Ιατρική Σχολή - ΕΚΠΑ

Στηρικτικά Κύτταρα και Εξωκυττάρια Ουσία. Κοτσίνας Αθανάσιος Επικ. Καθηγητής Εργ. Ιστολογίας-Εμβρυολογίας Ιατρική Σχολή - ΕΚΠΑ Στηρικτικά Κύτταρα και Εξωκυττάρια Ουσία Κοτσίνας Αθανάσιος Επικ. Καθηγητής Εργ. Ιστολογίας-Εμβρυολογίας Ιατρική Σχολή - ΕΚΠΑ Συνδετικός Ιστός - Ορισμός Παρέχει το: Υποστηρικτικό και Συνδετικό πλαίσιο

Διαβάστε περισσότερα

Κεφάλαιο 22 Πρωτεΐνες

Κεφάλαιο 22 Πρωτεΐνες Κεφάλαιο 22 Πρωτεΐνες Σύνοψη Οι πρωτεΐνες είναι μακρομόρια που προκύπτουν από την ένωση α-αμινοξέων. Τα α-αμινοξέα είναι οργανικές ενώσεις που έχουν μία αμινομάδα (ΝΗ 2 ) και καρβοξύλιο (COOH) συνδεδεμένα

Διαβάστε περισσότερα

Βιολογία Γενικής Παιδείας Β Λυκείου

Βιολογία Γενικής Παιδείας Β Λυκείου Απρίλιος Μάιος 12 Βιολογία Γενικής Παιδείας Β Λυκείου Βιολογία Γενικής Παιδείας Β Λυκείου (Ερωτήσεις που παρουσιάζουν ενδιαφέρον) 1. Τι είναι τα βιομόρια και ποια είναι τα βασικά χαρακτηριστικά τους; Βιομόρια

Διαβάστε περισσότερα


Η ΑΠΑΝΤΗΣΗ ΤΗΣ PIDIELLE ΣΤΗΝ ΠΑΓΚΟΣΜΙΑ ΤΑΣΗ LINK-D LINK-D Η ΑΠΑΝΤΗΣΗ ΤΗΣ PIDIELLE ΣΤΗΝ ΠΑΓΚΟΣΜΙΑ ΤΑΣΗ LINK-D Η ΦΙΛΟΣΟΦΙΑ ΤΟΥ ΠΡΟΪΟΝΤΟΣ Τεχνικά προϊόντα που προστίθενται στο μείγμα της βαφής, του αποχρωματιστικού (ντεκαπάς), της περμανάντ ή της ισιωτικής

Διαβάστε περισσότερα

Εργαστήριο Ιατρικής Φυσικής. Φυσική του Σκελετού

Εργαστήριο Ιατρικής Φυσικής. Φυσική του Σκελετού Εργαστήριο Ιατρικής Φυσικής Φυσική του Σκελετού Τα οστά πραγματοποιούν τουλάχιστον έξι λειτουργίες στο ανθρώπινο σώμα: 1. Υποστήριξη 2. Κίνηση 3. Προστασία διαφόρων οργάνων 4. Αποθήκευση χημικών ουσιών

Διαβάστε περισσότερα

Μικρά αμινοξέα. Βιοχημεία Ι Β-3

Μικρά αμινοξέα. Βιοχημεία Ι Β-3 Βιοχημεία Ι Β-2 Μικρά αμινοξέα Βιοχημεία Ι Β-3 Aλειφατικά αμινοξέα Βιοχημεία Ι Β-4 Ιμινοξύ Βιοχημεία Ι Β-5 Αρωματικά αμινοξέα Βιοχημεία Ι Β-6 Βιοχημεία Ι Β-7 Η Tyr και η Trp απορροφούν στα 280nm-έτσι μετράται

Διαβάστε περισσότερα


«ΠΡΩΤΕΪΝΕΣ: ΧΗΜΙΚΗ ΔΟΜΗ ΚΑΙ ΒΙΟΛΟΓΙΚΟΣ ΡΟΛΟΣ» «ΠΡΩΤΕΪΝΕΣ: ΧΗΜΙΚΗ ΔΟΜΗ ΚΑΙ ΒΙΟΛΟΓΙΚΟΣ ΡΟΛΟΣ» Τι είναι οι πρωτεΐνες; Από τι αποτελούνται; Ποιος είναι ο βιολογικός του ρόλος; Ας ρίξουμε μία ματιά σε όλα αυτά τα ερωτήματα που μας απασχολούν ΚΕΦΑΛΑΙΟ 1:

Διαβάστε περισσότερα



Διαβάστε περισσότερα

Είναι σημαντικές επειδή: Αποτελούν βασικά δοµικά συστατικά του σώµατος Εξυπηρετούν ενεργειακές ανάγκες Ασκούν έλεγχο σε όλες τις βιοχηµικές διεργασίες

Είναι σημαντικές επειδή: Αποτελούν βασικά δοµικά συστατικά του σώµατος Εξυπηρετούν ενεργειακές ανάγκες Ασκούν έλεγχο σε όλες τις βιοχηµικές διεργασίες ΕΞΕΤΑΣΤΕΑ ΥΛΗ ΕΝΟΤΗΤΑ 2: Η ΧΗΜΕΙΑ ΤΗΣ ΖΩΗΣ 2.1 ΒΑΣΙΚΕΣ ΧΗΜΙΚΕΣ ΕΝΝΟΙΕΣ, 5 9 (απλή αναφορά) 2.2 ΤΟ ΝΕΡΟ ΚΑΙ Η ΒΙΟΛΟΓΙΚΗ ΤΟΥ ΣΗΜΑΣΙΑ, 9 14 (απλή αναφορά), 2.4 ΟΡΓΑΝΙΚΕΣ ΟΥΣΙΕΣ, σελ. 20 36 Οργανικές Ουσίες

Διαβάστε περισσότερα


ΠΕΡΙΒΑΛΛΟΝΤΙΚΗ ΜΙΚΡΟΒΙΟΛΟΓΙΑ ΠΕΡΙΒΑΛΛΟΝΤΙΚΗ ΜΙΚΡΟΒΙΟΛΟΓΙΑ Γιώργος Τσιάµης Επίκουρος Καθηγητής Περιβαλλοντικής Μικροβιολογίας Η Περιβαλλοντική Μικροβιολογία επηρεάζει σε µεγάλο βαθµό τις περιβαλλοντικές επιστήµες γιατί συµβάλλει στην!

Διαβάστε περισσότερα


Kυτταρική Bιολογία ΒΙΟΛΟΓΙΚΕΣ ΜΕΜΒΡΑΝΕΣ, ΜΕΜΒΡΑΝΙΚΑ ΔΙΑΜΕΡΙΣΜΑΤΑ & ΔΙΑΛΟΓΗ ΠΡΩΤΕΪΝΩΝ ΔIAΛEΞΗ 4 (6/3/2013) Kυτταρική Bιολογία ΔIAΛEΞΗ 4 (6/3/2013) ΒΙΟΛΟΓΙΚΕΣ ΜΕΜΒΡΑΝΕΣ, ΜΕΜΒΡΑΝΙΚΑ ΔΙΑΜΕΡΙΣΜΑΤΑ & ΔΙΑΛΟΓΗ ΠΡΩΤΕΪΝΩΝ Οι λιπιδικές διπλοστιβάδες ως φραγμοί Νερό Υδρόφιλες φωσφολιπιδικές κεφαλές Φωσφολιπιδική μεμβράνη

Διαβάστε περισσότερα

Πρωτεινική αναδίπλωση

Πρωτεινική αναδίπλωση Πρωτεινική αναδίπλωση Η αμινοξική αλληλουχία καθορίζει την τριτοταγή δομή - Οι πληροφορίες για τη βιολογικά δραστική στερεοδιάταξη είναι κωδικοποιημένες στην αμινοξική αλληλουχία Ριβονουκλεάση- Anfinsen,

Διαβάστε περισσότερα

Η ΧΗΜΕΙΑ ΤΗΣ ΖΩΗΣ. Καρβουντζή Ηλιάνα Βιολόγος

Η ΧΗΜΕΙΑ ΤΗΣ ΖΩΗΣ. Καρβουντζή Ηλιάνα Βιολόγος Η ΧΗΜΕΙΑ ΤΗΣ ΖΩΗΣ Χημικά στοιχεία που συνθέτουν τους οργανισμούς Ο C, το H 2, το O 2 και το N 2 είναι τα επικρατέστερα στους οργανισμούς σε ποσοστό 96% κ.β. Γιατί; Συμμετέχουν σε σημαντικό βαθμό στη σύνθεση

Διαβάστε περισσότερα

ΟΡΓΑΝΙΚΕΣ ΟΥΣΙΕΣ. 1. (α) Ποιο μόριο απεικονίζεται στο σχεδιάγραμμα; (β) Ποια είναι η απλούστερη μορφή του R;

ΟΡΓΑΝΙΚΕΣ ΟΥΣΙΕΣ. 1. (α) Ποιο μόριο απεικονίζεται στο σχεδιάγραμμα; (β) Ποια είναι η απλούστερη μορφή του R; ΟΡΓΑΝΙΚΕΣ ΟΥΣΙΕΣ 1. (α) Ποιο μόριο απεικονίζεται στο σχεδιάγραμμα; (β) Ποια είναι η απλούστερη μορφή του R; (γ) Ποιο μέρος του μορίου προσδίδει σε αυτό όξινες ιδιότητες; (δ) Ποιο μέρος του μορίου προσδίδει

Διαβάστε περισσότερα


Η ΔΟΜΗ ΚΑΙ Η ΛΕΙΤΟΥΡΓΙΑ ΤΟΥ ΚΥΤΤΑΡΟΣΚΕΛΕΤΟΥ ΚΥΡΙΑΚΗ ΒΑΣΙΛΙΚΟΥ Γ1 Η ΔΟΜΗ ΚΑΙ Η ΛΕΙΤΟΥΡΓΙΑ ΤΟΥ ΚΥΤΤΑΡΟΣΚΕΛΕΤΟΥ ΚΥΡΙΑΚΗ ΒΑΣΙΛΙΚΟΥ Γ1 ΚΥΤΤΑΡΟΣΚΕΛΕΤΟΣ Τρισδιάστατο δίκτυο που αποτελείται από μικροσωληνίσκους, μικροϊνίδια και ενδιάμεσα ινίδια. Οι νηματοειδείς πρωτεΐνες του

Διαβάστε περισσότερα

Μέθοδοι μέτρησης μηχανικών ιδιοτήτων κυττάρων και μοντέλα κυτταρικής μηχανικής συμπεριφοράς

Μέθοδοι μέτρησης μηχανικών ιδιοτήτων κυττάρων και μοντέλα κυτταρικής μηχανικής συμπεριφοράς ΕΜΒΙΟΜΗΧΑΝΙΚΗ ΒΙΟΪΑΤΡΙΚΗ ΤΕΧΝΟΛΟΓΙΑ Μέθοδοι μέτρησης μηχανικών ιδιοτήτων κυττάρων και μοντέλα κυτταρικής μηχανικής συμπεριφοράς Πετρόπουλος Ηλίας Σωτηρόπουλος Εμμανουήλ Μέθοδοι μέτρησης των μηχανικών ιδιοτήτων

Διαβάστε περισσότερα

Κεφάλαιο 2. Μοτίβα πρωτεϊνικής δομής

Κεφάλαιο 2. Μοτίβα πρωτεϊνικής δομής Κεφάλαιο 2 Μοτίβα πρωτεϊνικής δομής Εικόνα 2.1 Το μοντέλο του Kendrew για τη δομή χαμηλής διακριτικότητας της μυοσφαιρίνης όπως φαίνεται από τρεις διαφορετικές οπτικές γωνίες. Οι επιμήκεις περιοχές αντιπροσωπεύουν

Διαβάστε περισσότερα

ΑΡΧΗ 2ΗΣ ΣΕΛΙ ΑΣ. 1.4 Να μεταφέρετε στο τετράδιό σας τις παρακάτω χημικές εξισώσεις σωστά συμπληρωμένες: καταλύτες


Διαβάστε περισσότερα

ΘΕΜΑ Α Α1. γ Α2. γ Α3. α Α4. β Α5. β ΘΕΜΑ B B1. B2.

ΘΕΜΑ Α Α1. γ Α2. γ Α3. α Α4. β Α5. β ΘΕΜΑ B B1. B2. ΘΕΜΑ Α Α1. γ (το πριμόσωμα) Α2. γ (οι υποκινητές και οι μεταγραφικοί παράγοντες κάθε γονιδίου) Α3. α (μεταφέρει ένα συγκεκριμένο αμινοξύ στο ριβόσωμα) Α4. β (αποδιάταξη των δύο συμπληρωματικών αλυσίδων)

Διαβάστε περισσότερα


Τρίτη, 27 Μαΐου 2008 Γ ΛΥΚΕΙΟΥ ΚΑΤΕΥΘΥΝΣΗΣ ΧΗΜΕΙΑ - ΒΙΟΧΗΜΕΙΑ Τρίτη, 7 Μαΐου 008 Γ ΛΥΚΕΙΟΥ ΚΑΤΕΥΘΥΝΣΗΣ ΧΗΜΕΙΑ - ΒΙΟΧΗΜΕΙΑ ΘΕΜΑ ο Για τις ερωτήσεις. -. να γράψετε στο τετράδιό σας τον αριθµό της ερώτησης και δίπλα το γράµµα που αντιστοιχεί στη σωστή απάντηση... Ποιο

Διαβάστε περισσότερα

Θέματα πριν τις εξετάσεις. Καλό διάβασμα Καλή επιτυχία

Θέματα πριν τις εξετάσεις. Καλό διάβασμα Καλή επιτυχία Θέματα πριν τις εξετάσεις Καλό διάβασμα Καλή επιτυχία 2013-2014 Θέματα πολλαπλής επιλογής Μετουσίωση είναι το φαινόμενο α. κατά το οποίο συνδέονται δύο αμινοξέα για τον σχηματισμό μιας πρωτεΐνης β. κατά

Διαβάστε περισσότερα

ΑΠΑΝΤΗΣΕΙΣ. ΘΕΜΑ Α Α1. β Α2. γ Α3. δ Α4. γ Α5. β


Διαβάστε περισσότερα

ΑΙΜΟΣΦΑΙΡΙΝΗ (ΑΜΦ) ΑΙΜΟΣΦΑΙΡΙΝΗ: Hb, είναι τετραμερής πρωτείνη. ΜΕΤΑΠΤΩΣΗ ΑΠΟ Τ <=> R

ΑΙΜΟΣΦΑΙΡΙΝΗ (ΑΜΦ) ΑΙΜΟΣΦΑΙΡΙΝΗ: Hb, είναι τετραμερής πρωτείνη. ΜΕΤΑΠΤΩΣΗ ΑΠΟ Τ <=> R ΑΙΜΟΣΦΑΙΡΙΝΗ (ΑΜΦ) ΑΙΜΟΣΦΑΙΡΙΝΗ: Hb, είναι τετραμερής πρωτείνη. ΜΕΤΑΠΤΩΣΗ ΑΠΟ Τ R ΔΕΟΞΥΑΙΜΟΣΦΑΙΡΙΝΗ ΟΞΥΑΙΜΟΣΦΑΙΡΙΝΗ (Σταθερότητα, χαμηλή συγγένεια για Ο2Εύκαμπτη, υψηλή συγγένεια για Ο2) Λόγο των

Διαβάστε περισσότερα

Λ.Χ. Μαργαρίτης ΦΡΟΝΤΙΣΤΗΡΙΟ ΗΛΕΚΤΡΟΝΙΚΗΣ ΜΙΚΡΟΣΚΟΠΙΑΣ, ΜΕΡΟΣ A. http://kyttariki.biol.uoa.gr. Τμήμα Βιολογίας Μάθημα: ΒΙΟΛΟΓΙΑ ΚΥΤΤΑΡΟΥ Γ εξάμηνο.

Λ.Χ. Μαργαρίτης ΦΡΟΝΤΙΣΤΗΡΙΟ ΗΛΕΚΤΡΟΝΙΚΗΣ ΜΙΚΡΟΣΚΟΠΙΑΣ, ΜΕΡΟΣ A. http://kyttariki.biol.uoa.gr. Τμήμα Βιολογίας Μάθημα: ΒΙΟΛΟΓΙΑ ΚΥΤΤΑΡΟΥ Γ εξάμηνο. Τμήμα Βιολογίας Μάθημα: ΒΙΟΛΟΓΙΑ ΚΥΤΤΑΡΟΥ Γ εξάμηνο. ΦΡΟΝΤΙΣΤΗΡΙΟ ΗΛΕΚΤΡΟΝΙΚΗΣ ΜΙΚΡΟΣΚΟΠΙΑΣ, ΜΕΡΟΣ A Λ.Χ. Μαργαρίτης...για περισσότερα... http://kyttariki.biol.uoa.gr Ηλεκτρονική μικροσκοπία Φροντιστήριο

Διαβάστε περισσότερα

(Μέρος 1 ο ) Εισηγητής: Ν. Πουλακάκης

(Μέρος 1 ο ) Εισηγητής: Ν. Πουλακάκης Ταξινομικοί χαρακτήρες και Φυλογενετική ανασύσταση. Σχολές ταξινόμησης. Θεωρίες για την Ταξινομική. Φυλογενετική ανάλυση: Μοριακή συστηματική. Οι κύριες διαιρέσεις της Ζωής. (Μέρος 1 ο ) Εισηγητής: Ν.

Διαβάστε περισσότερα

Ανατομία και μορφολογία πτηνού

Ανατομία και μορφολογία πτηνού Ανατομία και μορφολογία πτηνού Τα πτηνά είναι ομοιόθερμα σπονδυλωτά που φυλογενετικά σχετίζονται με τους Δεινοσαύρους Τα αρτίγονα πουλιά (Νεόρνιθες) διαιρούνται σε δύο ομάδες: (1) Παλαιόγναθα (κίβι, έμου,

Διαβάστε περισσότερα


ΑΠΑΝΤΗΣΕΙΣ ΤΩΝ ΕΡΩΤΗΣΕΩΝ.-ΑΣΚΗΣΕΩΝ ΚΑΙ ΠΡΟΒΛΗΜΑΤΩΝ ΤΟΥ ΒΙΒΛΙΟΥ ΤΟΥ ΜΑΘΗΤΗ ΑΠΑΝΤΗΣΕΙΣ ΤΩΝ ΕΡΩΤΗΣΕΩΝ.-ΑΣΚΗΣΕΩΝ ΚΑΙ ΠΡΟΒΛΗΜΑΤΩΝ ΤΟΥ ΒΙΒΛΙΟΥ ΤΟΥ ΜΑΘΗΤΗ 1. Τοποθετείστε στο διάγραμμα που ακολουθεί, τους όρους: σύνθεση, υδρόλυση, μακρομόριο, μονομερή. Ερμηνεύστε το διάγραμμα. Η -Q-

Διαβάστε περισσότερα

Η Εξωκυττάρια Μήτρα: Δομή & Λειτουργία

Η Εξωκυττάρια Μήτρα: Δομή & Λειτουργία Η Εξωκυττάρια Μήτρα: Δομή & Λειτουργία Δημήτριος Τζεράνης, Ph.D. Εμβιομηχανική και Βιοϊατρική Τεχνολογία Τμήμα Μηχανολόγων Μηχανικών Ε.Μ.Π. Χειμερινό Εξάμηνο 2015 Περιεχόμενα Σύσταση των Ιστών Κύτταρα

Διαβάστε περισσότερα

Βιολογία Γ Γενικού Λυκείου Θετικής κατεύθυνσης. Κεφάλαιο 1α Το Γενετικό Υλικό

Βιολογία Γ Γενικού Λυκείου Θετικής κατεύθυνσης. Κεφάλαιο 1α Το Γενετικό Υλικό Βιολογία Γ Γενικού Λυκείου Θετικής κατεύθυνσης Κεφάλαιο 1α Το Γενετικό Υλικό Το DNA είναι το γενετικό υλικό Αρχικά οι επιστήμονες θεωρούσαν ότι οι πρωτεΐνες αποτελούσαν το γενετικό υλικό των οργανισμών.

Διαβάστε περισσότερα

οµικά στοιχεία βιοµορίων

οµικά στοιχεία βιοµορίων 2-1 Κεφάλαιο 2 οµικά στοιχεία βιοµορίων 2.1. ιαστάσεις των Βιοµορίων Οι διαστάσεις των βιοµορίων κυµαίνονται από µερικά Ångströms (10-10 m) έως µερικές εκατοντάδες Ångströms (10-8 m). (εικόνα 2.1, 2.2)

Διαβάστε περισσότερα

Τμήμα Βιολογίας Μάθημα: ΒΙΟΛΟΓΙΑ ΚΥΤΤΑΡΟΥ Γ εξάμηνο 2014-2015 Διαλέξεις κάθε Τρίτη 13-15 μ.μ. και Παρασκευή 11-13

Τμήμα Βιολογίας Μάθημα: ΒΙΟΛΟΓΙΑ ΚΥΤΤΑΡΟΥ Γ εξάμηνο 2014-2015 Διαλέξεις κάθε Τρίτη 13-15 μ.μ. και Παρασκευή 11-13 Τμήμα Βιολογίας Μάθημα: ΒΙΟΛΟΓΙΑ ΚΥΤΤΑΡΟΥ Γ εξάμηνο 2014-2015 Διαλέξεις κάθε Τρίτη 13-15 μ.μ. και Παρασκευή 11-13 Ισιδώρα Παπασιδέρη, Καθηγήτρια...για περισσότερα... http://kyttariki.biol.uoa.gr, ttp://multimedia.biol.uoa.gr

Διαβάστε περισσότερα

Χαλκός Cu. Στοιχείο µετάπτωσης, µέταλλο. Στο κυτταρικό περιβάλλον βρίσκεται σε δύο µορφές οξείδωσης. Cu + ανηγµένος χαλκός. Cu 2+ οξειδωµένος χαλκός

Χαλκός Cu. Στοιχείο µετάπτωσης, µέταλλο. Στο κυτταρικό περιβάλλον βρίσκεται σε δύο µορφές οξείδωσης. Cu + ανηγµένος χαλκός. Cu 2+ οξειδωµένος χαλκός Χαλκός Cu Στοιχείο µετάπτωσης, µέταλλο Στο κυτταρικό περιβάλλον βρίσκεται σε δύο µορφές οξείδωσης Cu + ανηγµένος χαλκός Cu 2+ οξειδωµένος χαλκός Είναι µαλακό οξύ προτιµά να προσαρτάται σε µαλακούς υποκαταστάτες

Διαβάστε περισσότερα

Χημική σύσταση του κυττάρου

Χημική σύσταση του κυττάρου 1 Χημική σύσταση του κυττάρου Τα χημικά στοιχεία, που συμμετέχουν στη δομή των βιολογικών μορίων, συγκαταλέγονται στα στοιχεία που συνθέτουν τον φλοιό της γης. Όλοι οι οργανισμοί από τον πιο απλό μέχρι

Διαβάστε περισσότερα

Το ένζυμο Καρβοξυπεπτιδάση Α έχει τα εξής χαρακτηριστικά

Το ένζυμο Καρβοξυπεπτιδάση Α έχει τα εξής χαρακτηριστικά Το ένζυμο Καρβοξυπεπτιδάση Α έχει τα εξής χαρακτηριστικά Είναι απλή πολυπεπτιδική αλυσίδα 307 αμινοξέων Είναι συμπαγής και έχει σχήμα ελλειψοειδές διαστάσεων 50 x 42 x 38 A Περιέχει περιοχές α-έλικος 38%

Διαβάστε περισσότερα

Μοριακή Αναγνώριση. 5.1. Εισαγωγή. 5.2. Σταθερές σύνδεσης και αποχωρισµού. [A][B] k d = ----------- [AB] [ΑΒ] k i = ---------- [Α][Β] Κεφάλαιο

Μοριακή Αναγνώριση. 5.1. Εισαγωγή. 5.2. Σταθερές σύνδεσης και αποχωρισµού. [A][B] k d = ----------- [AB] [ΑΒ] k i = ---------- [Α][Β] Κεφάλαιο Κεφάλαιο 5-1 5 Μοριακή Αναγνώριση 5.1. Εισαγωγή Ένα από τα σηµαντικότερα χαρακτηριστικά των ζωντανών οργανισµών είναι ότι τα µακροµόρια που περιέχουν κάνουν πολύ εξειδικευµένες αλληλεπιδράσεις µε άλλα

Διαβάστε περισσότερα

Κυτταρική Βιολογία. Ενότητα 08 : Βιολογικές μεμβράνες, μεμβρανικά διαμερίσματα, μεταφορά πρωτεϊνών Παναγιωτίδης Χρήστος Τμήμα Φαρμακευτικής ΑΠΘ

Κυτταρική Βιολογία. Ενότητα 08 : Βιολογικές μεμβράνες, μεμβρανικά διαμερίσματα, μεταφορά πρωτεϊνών Παναγιωτίδης Χρήστος Τμήμα Φαρμακευτικής ΑΠΘ ΑΡΙΣΤΟΤΕΛΕΙΟ ΠΑΝΕΠΙΣΤΗΜΙΟ ΘΕΣΣΑΛΟΝΙΚΗΣ ΑΝΟΙΚΤΑ ΑΚΑΔΗΜΑΙΚΑ ΜΑΘΗΜΑΤΑ Κυτταρική Βιολογία Ενότητα 08 : Βιολογικές μεμβράνες, μεμβρανικά διαμερίσματα, μεταφορά πρωτεϊνών Παναγιωτίδης Χρήστος Φαρμακευτικής ΑΠΘ

Διαβάστε περισσότερα

Κ Ε Φ Α Λ Α Ι Ο 22 : Η ενεργοποίηση της µεταγραφής

Κ Ε Φ Α Λ Α Ι Ο 22 : Η ενεργοποίηση της µεταγραφής Κ Ε Φ Α Λ Α Ι Ο 22 : Η ενεργοποίηση της µεταγραφής Εικόνα 22.1 Η γονιδιακή έκφραση ελέγχεται κυρίως κατά την έναρξη της µεταγραφής και σπάνια στα επόµενα στάδια της γονιδιακής έκφρασης, παρόλο που ο έλεγχος

Διαβάστε περισσότερα

Οι πρωτεΐνες δομούνται από ένα σύνολο αμινοξέων. 1/10/2015 Δ.Δ. Λεωνίδας

Οι πρωτεΐνες δομούνται από ένα σύνολο αμινοξέων. 1/10/2015 Δ.Δ. Λεωνίδας αμινοξέα Οι πρωτεΐνες δομούνται από ένα σύνολο αμινοξέων Λυσίνη CORN Ισομερές L Ισομερές D R = πλευρική αλυσίδα (side chain) Τα περισσότερα αμινοξέα είναι ασύμμετρα Όλα τα αμινοξέα που βρίσκονται στις

Διαβάστε περισσότερα

Χαρακτηριστικά της δομής της Μυοσφαιρίνης

Χαρακτηριστικά της δομής της Μυοσφαιρίνης Χαρακτηριστικά της δομής της Μυοσφαιρίνης Η μυοσφαιρίνη είναι ενα εξαιρετικά συμπαγές μόριο.οι διαστάσεις είναι 45Χ35Χ25 Α και υπαρχει πολύ λίγος αδειος χώρος στο εσωτερικό τού μορίου Γυρω στα 75% της

Διαβάστε περισσότερα

ΚΥΤΤΑΡΙΚΗ ΑΝΑΠΝΟΗ. Καρβουντζή Ηλιάνα Βιολόγος

ΚΥΤΤΑΡΙΚΗ ΑΝΑΠΝΟΗ. Καρβουντζή Ηλιάνα Βιολόγος ΚΥΤΤΑΡΙΚΗ ΑΝΑΠΝΟΗ Η τροφή αποτελείται και από ουσίες μεγάλου μοριακού βάρους (πρωτεΐνες, υδατάνθρακες, λιπίδια, νουκλεϊνικά οξέα). Οι ουσίες αυτές διασπώνται (πέψη) σε απλούστερες (αμινοξέα, απλά σάκχαρα,

Διαβάστε περισσότερα

Nanocellulose / Νανοκυτταρίνη

Nanocellulose / Νανοκυτταρίνη Nanocellulose / Νανοκυτταρίνη Παρουσίαση ενός καινοτομικού προϊόντος με εξαιρετικές έως απίστευτες μελλοντικές προοπτικές τον 21 ο αιώνα! του Γεωργίου Μαντάνη, Καθηγητή ΤΕΙ/Θ Courtesy: Prof. Arthur Ragauskas,

Διαβάστε περισσότερα

Κεφάλαιο 1. Οι δομικοί λίθοι

Κεφάλαιο 1. Οι δομικοί λίθοι Κεφάλαιο 1 Οι δομικοί λίθοι Κεφάλαιο 1 Οι Δομικοί Λίθοι των Πρωτεϊνών Εικόνα 1.1 Η αμινοξική αλληλουχία μιας πρωτεϊνικής πολυπεπτιδικής αλυσίδας ονομάζεται πρωτοταγής δομή. Διαφορετικές περιοχές της αλληλουχίας

Διαβάστε περισσότερα

Κεφάλαιο 5 Δομές β: Τρεις Κατηγορίες

Κεφάλαιο 5 Δομές β: Τρεις Κατηγορίες Κεφάλαιο 5 β-δομές Κεφάλαιο 5 Δομές β: Τρεις Κατηγορίες Οι β-επικράτειες είναι οι δομές οι οποίες αποτελούν την δεύτερη μεγάλη ομάδα πρωτεϊνικών επικρατειών. Η ομάδα αυτή παρουσιάζει τη μεγαλύτερη ποικιλομορφία

Διαβάστε περισσότερα

Aναδίπλωση και επεξεργασία των πρωτεϊνών

Aναδίπλωση και επεξεργασία των πρωτεϊνών Aναδίπλωση και επεξεργασία των πρωτεϊνών Aναδίπλωση και επεξεργασία των πρωτεϊνών Πρωτεϊνοσύνθεση: τελευταίο στάδιο της ροής της γενετικής πληροφορίας * Αλληλουχία νουκλεοτιδίων DNA Μεταγραφή - Μετάφραση

Διαβάστε περισσότερα

ΚΕΦΑΛΑΙΟ 5. Διατήρηση και συνέχεια της ζωής

ΚΕΦΑΛΑΙΟ 5. Διατήρηση και συνέχεια της ζωής ΚΕΑΛΑΙΟ 5 ιατήρηση και συνέχεια της ζωής 5.2 H ροή της γενετικής πληροφορίας 3 Πώς βρέθηκε η δομή του DNA στο χώρο; Η ανακάλυψη της δομής του DNA πραγματοποιήθηκε το 1953 από τους Watson και Crick. Από

Διαβάστε περισσότερα


BC BONACURE FIBRE FORCE BC BONACURE FIBRE FORCE start BC Fibre Force Κάντε κλικ για περισσότερες πληροφορίες για τα προϊόντα: Οφέλη Shampoo Spray Conditioner Rinse Out Conditioner Fortifier Treatment Keratin Infusion Η ASK Education

Διαβάστε περισσότερα

Kυτταρική Bιολογία ΧΗΜΙΚΗ ΣΥΣΤΑΣΗ ΤΩΝ ΚΥΤΤΑΡΩΝ ΔIAΛEΞΗ 2 (22/2/2016) Χημικοί δεσμοί - Το νερό & ο ρόλος του. Τα μόρια του κυττάρου.

Kυτταρική Bιολογία ΧΗΜΙΚΗ ΣΥΣΤΑΣΗ ΤΩΝ ΚΥΤΤΑΡΩΝ ΔIAΛEΞΗ 2 (22/2/2016) Χημικοί δεσμοί - Το νερό & ο ρόλος του. Τα μόρια του κυττάρου. Kυτταρική Bιολογία ΔIAΛEΞΗ 2 (22/2/2016) ΧΗΜΙΚΗ ΣΥΣΤΑΣΗ ΤΩΝ ΚΥΤΤΑΡΩΝ Χημικοί δεσμοί - Το νερό & ο ρόλος του Τα μόρια του κυττάρου. Ενεργοποιημένα μόρια-φορείς ενέργειας AΣ ΘYMHΘOYME Tι είπαμε στην προηγούμενη

Διαβάστε περισσότερα


ΙΑΓΩΝΙΣΜΑ ΒΙΟΛΟΓΙΑΣ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ ΙΑΓΩΝΙΣΜΑ ΒΙΟΛΟΓΙΑΣ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ ΚΕΦΑΛΑΙΟ 1: Το γενετικό υλικό ΘΕΜΑ: 1 ο (Μονάδες 25 ) Να επιλέξετε τη σωστή απάντηση στις παρακάτω ερωτήσεις. 1. Το πείραµα των Hershey και Chase ήταν:

Διαβάστε περισσότερα

Δεξαμενές GRP (Glassfibre Reinforced Polyester), κατάλληλες για χρήση σε compact συστήματα. επεξεργασίας αστικών & βιομηχανικών λυμάτων

Δεξαμενές GRP (Glassfibre Reinforced Polyester), κατάλληλες για χρήση σε compact συστήματα. επεξεργασίας αστικών & βιομηχανικών λυμάτων Δεξαμενές GRP (Glassfibre Reinforced Polyester), κατάλληλες για χρήση σε compact συστήματα επεξεργασίας αστικών & βιομηχανικών λυμάτων ΔΕΞΑΜΕΝΕΣ GRP ΒΑΣΙΚΗ ΤΕΧΝΙΚΗ ΠΕΡΙΓΡΑΦΗ ΠΕΔΙΟ ΕΦΑΡΜΟΓΗΣ ΟΡΙΣΜΟΙ Η παρούσα

Διαβάστε περισσότερα


ΔΙΑΓΩΝΙΣΜΑ ΠΡΟΣΟΜΟΙΩΣΗΣ Β ΚΥΚΛΟΥ ΔΙΑΓΩΝΙΣΜΑ ΠΡΟΣΟΜΟΙΩΣΗΣ Β ΚΥΚΛΟΥ ΜΑΘΗΜΑ ΒΙΟΛΟΓΙΑ ΠΡΟΣΑΝΑΤΟΛΙΣΜΟΥ ΤΑΞΗ Γ ΛΥΚΕΙΟΥ ΗΜΕΡΟΜΗΝΙΑ 25/4/2016 ΘΕΜΑ Α Α1. Μέσω του καρυότυπου δεν μπορούν να ανιχνευτούν : α. οι δομικές χρωμοσωμικές ανωμαλίες β.

Διαβάστε περισσότερα

Σήμερα θα μελετήσουμε το δέρμα. Τα μέρη του. Χρησιμότητά του. Διαπερατότητα του. Την αλληλεπίδραση με τα καλλυντικά.

Σήμερα θα μελετήσουμε το δέρμα. Τα μέρη του. Χρησιμότητά του. Διαπερατότητα του. Την αλληλεπίδραση με τα καλλυντικά. Ανασκόπιση Έχουμε πει τί είναι μόρια και άτομα. Έχουμε αναγνωρίσει ποια μόρια διαλύονται στο νερό και ποια όχι βάση των πολικών θέσεων που έχουν. Έχουμε συναντήσει μόρια πολύ μεγάλου μεγέθους (πολυμερή)

Διαβάστε περισσότερα

(αδρές αποικίες) Θέρμανση (λείες αποικίες) ζωντανά ποντίκια ζωντανά ποντίκια νεκρά ποντίκια

(αδρές αποικίες) Θέρμανση (λείες αποικίες) ζωντανά ποντίκια ζωντανά ποντίκια νεκρά ποντίκια Το DNA είναι το γενετικό υλικό 1. Πείραμα Griffith (1928) Βακτήριο πνευμονιόκοκκου (Diplococcus pneumoniae) Χωρίς κάλυμμα Με κάλυμμα (αδρές αποικίες) Θέρμανση (λείες αποικίες) ζωντανά ποντίκια ζωντανά

Διαβάστε περισσότερα

Χηµεία-Βιοχηµεία Τεχνολογικής Κατεύθυνσης Γ Λυκείου 2001

Χηµεία-Βιοχηµεία Τεχνολογικής Κατεύθυνσης Γ Λυκείου 2001 Χηµεία-Βιοχηµεία Τεχνολογικής Κατεύθυνσης Γ Λυκείου 2001 ΕΚΦΩΝΗΣΕΙΣ Ζήτηµα 1ο 1. Να γράψετε στο τετράδιό σας το γράµµα που αντιστοιχεί στη σωστή απάντηση: Η σταθερά Κ w στους 25 ο C έχει τιµή 10-14 : α.

Διαβάστε περισσότερα

ΑΜΙΝΟΞΕΑ-ΠΡΩΤΕΪΝΕΣ. Γνωστικό αντικείμενο: Βιολογία. Δημιουργός: ΠΑΝΑΓΙΩΤΗΣ ΚΩΣΤΑΡΙΔΗΣ


Διαβάστε περισσότερα

Kυτταρική$Bιολογία$ Πολυκυτταρική+οργάνωση+και+ καρκίνος+ ΔIAΛEΞΕΙΣ*19*&*20! (21!&!28/5/2014)! Δρ.$Xρήστος$Παναγιωτίδης,$Τμήμα$Φαρμακευτικής$Α.Π.Θ.

Kυτταρική$Bιολογία$ Πολυκυτταρική+οργάνωση+και+ καρκίνος+ ΔIAΛEΞΕΙΣ*19*&*20! (21!&!28/5/2014)! Δρ.$Xρήστος$Παναγιωτίδης,$Τμήμα$Φαρμακευτικής$Α.Π.Θ. Kυτταρική$Bιολογία$ ΔIAΛEΞΕΙΣ*19*&*20! (21!&!28/5/2014)! Πολυκυτταρική+οργάνωση+και+ καρκίνος+ Ας+ξαναθυμηθούμε+για+λίγο+ τη+κυτταρική+θεωρία+ Η*κυτταρική*θεωρία*! OΛOI!OI!ZΩNTANOI!OPΓANIΣMOI! AΠOTEΛOYNTAI!AΠO!KYTTAPA!H!AΠO!

Διαβάστε περισσότερα

Όνομα φοιτητή/φοιτήτριας:

Όνομα φοιτητή/φοιτήτριας: ΠΡΟΟΔΟΣ 2: Δυναμικό Ενεργείας-Ηλεκτροφυσιολογικές Καταγραφές -Ηλεκτρομυογράφημα (ΗΜΓ) ΟΔΗΓΙΕΣ: Οι ερωτήσεις είναι του τύπου "σωστό ή λάθος". Κωδικοποιήστε τις απαντήσεις σας ως εξής: "1"= Σωστό, "0"=Λάθος

Διαβάστε περισσότερα

Kυτταρική$Bιολογία$ Πολυκυτταρική+οργάνωση+και+ καρκίνος+ ΔIAΛEΞΕΙΣ*15*&*16! (18!&!21/5/2012)! Δρ.$Xρήστος$Παναγιωτίδης,$Τμήμα$Φαρμακευτικής$Α.Π.Θ.

Kυτταρική$Bιολογία$ Πολυκυτταρική+οργάνωση+και+ καρκίνος+ ΔIAΛEΞΕΙΣ*15*&*16! (18!&!21/5/2012)! Δρ.$Xρήστος$Παναγιωτίδης,$Τμήμα$Φαρμακευτικής$Α.Π.Θ. Kυτταρική$Bιολογία$ ΔIAΛEΞΕΙΣ*15*&*16! (18!&!21/5/2012)! Πολυκυτταρική+οργάνωση+και+ καρκίνος+ Ας+ξαναθυμηθούμε+για+λίγο+ τη+κυτταρική+θεωρία+ Η*κυτταρική*θεωρία*! OΛOI!OI!ZΩNTANOI!OPΓANIΣMOI! AΠOTEΛOYNTAI!AΠO!KYTTAPA!H!AΠO!

Διαβάστε περισσότερα

1.1. Να γράψετε στο τετράδιό σας το γράµµα που αντιστοιχεί στη σωστή απάντηση:

1.1. Να γράψετε στο τετράδιό σας το γράµµα που αντιστοιχεί στη σωστή απάντηση: ΘΕΜΑ 1o 1.1. Να γράψετε στο τετράδιό σας το γράµµα που αντιστοιχεί στη σωστή απάντηση: Η σταθερά Κ w στους 25 ο C έχει τιµή 10-14 : α. µόνο στο καθαρό νερό β. σε οποιοδήποτε υδατικό διάλυµα γ. µόνο σε

Διαβάστε περισσότερα



Διαβάστε περισσότερα

Χηµεία-Βιοχηµεία Τεχνολογικής Κατεύθυνσης Γ Λυκείου 2001

Χηµεία-Βιοχηµεία Τεχνολογικής Κατεύθυνσης Γ Λυκείου 2001 Ζήτηµα 1ο Χηµεία-Βιοχηµεία Τεχνολογικής Κατεύθυνσης Γ Λυκείου 2001 1. Να γράψετε στο τετράδιό σας το γράµµα που αντιστοιχεί στη σωστή απάντηση: Η σταθερά Κ w στους 25 ο C έχει τιµή 10-14 : α. µόνο στο

Διαβάστε περισσότερα