ΚΕΡΑΤΙΝΕΣ (ΕΝΔΙΑΜΕΣΑ ΙΝΙΔΙΑ) - ΜΑΛΛΙΩΝ, ΝΥΧΙΩΝ, ΟΠΛΩΝ (ΘΗΛΑΣΤΙΚΑ)

Μέγεθος: px
Εμφάνιση ξεκινά από τη σελίδα:

Download "ΚΕΡΑΤΙΝΕΣ (ΕΝΔΙΑΜΕΣΑ ΙΝΙΔΙΑ) - ΜΑΛΛΙΩΝ, ΝΥΧΙΩΝ, ΟΠΛΩΝ (ΘΗΛΑΣΤΙΚΑ)"

Transcript

1 ΚΕΡΑΤΙΝΕΣ (ΕΝΔΙΑΜΕΣΑ ΙΝΙΔΙΑ) ΣΥΣΤΑΤΙΚΑ ΥΛΙΚΑ: -ΚΥΤΤΑΡΟΣΚΕΛΕΤΟΥ - ΜΑΛΛΙΩΝ, ΝΥΧΙΩΝ, ΟΠΛΩΝ (ΘΗΛΑΣΤΙΚΑ) - ΦΤΕΡΩΝ (ΠΤΗΝΑ) - ΔΕΡΜΑΤΟΣ ΕΡΠΕΤΩΝ

2 Οι ιστοί που περιέχουν κερατίνες Είναι συνήθως ισχυροί και αδιάλυτοι - πρέπει να έχουν παίξει σημαντικό ρόλο στη εξέλιξη των σπονδυλωτών -Χωρίζονται σε μαλακές και σκληρές κερατίνες -Μαλακές: επιδερμίδα, κάλοι -Σκληρές: μαλλιά, νύχια, οπλές -Δομική μονάδα και στα δύο είδη: Το σπειροειδές σπείραμα Αλφα-ελίκων (coiled-coil)

3 Δομικά χαρακτηριστικά : Επαναλήψιμες αλληλουχίες κάθε 7 αμινοξέα (heptad repeat, a g) Όπου a, d υδρόφοβα αμινοξέα (συνήθως λευκίνη) e, g φορτισμένα αμινοξέα Το σπειροειδές σπείραμα Αλφα-ελίκων (coiled-coil)

4 Δομικά χαρακτηριστικά : -Οι δύο έλικες περιελίσσονται -Είναι ελαφρά στρεβλωμένες (3, 5 αμινοξέα / στροφή) περιοδικότητα 7 αμινοξέων -Υδρόφοβες αλληλεπιδράσεις Δια μέσου των αμινοξέων a,d -ιοντικές αλληλεπιδράσεις Δια μέσου των αμινοξέων e, g

5 Οι δύο έλικες περιελίσσονται Αποτέλεσμα: Ηυπερέλικατούσπειροειδούςσπειράματος Αλφα-ελίκων (coiled-coil)

6 Τα σπειροειδή σπειράματα αυτο-οργανώνονται ιεραρχικά και σχηματίζουν τα ενδιάμεσα ινίδια Του κυτταρικού σκελετού

7 Κυτταροσκελετός: Δίκτυο πρωτεϊνικών ινιδίων που εκτείνεται Σε όλο το κυτταρόπλασμα

8 Κυτταροσκελετός: Τρία είδη ινιδίων Τα ενδιάμεσα ινίδια είναι τα σκληρώτερα και ανθεκτικώτερα

9 Σπουδαιότερη λειτουργία των ενδιάμεσων ινιδίων: Εξασφάλιση της αντοχής των κυττάρων στην μηχανική πίεση Τέντωμα των ινιδίων κατανομή των δυνάμεων πού Εφαρμόζονται εξωτερικά προστασία από την ρήξη αναλογία με τα σύνθετα υλικά, (εγκλεισμός ινών σε πολυμερική μήτρα, fiber-embedded composite)

10 Κερατίνες: ανήκουν στην οικογένεια τωνενδιάμεσωνινιδίων Ινώδες συστατικό των μαλλιών, νυχιών, κεράτων Στα θηλαστικά Διατομή ανθρώπινης τρίχας μαλλιών: Ίνες κερατίνης μέσα σε μήτρα από μη ινώδεις πρωτείνες και λιπίδια

11 Διατομή ανθρώπινης τρίχας μαλλιών: Μακρο ινίδια μικρο ινίδια www. hair-science.com

12 Διατομή ανθρώπινης τρίχας μαλλιών: πρωτο- ινίδια (καλώδιο 4 ελίκων κερατίνης)

13 Χημική σύσταση ανθρώπινης τρίχας μαλλιών: Ίνες κερατίνης μέσα σε μήτρα από μη ινώδεις πρωτείνες Και λιπίδια Σημαντικό χαρακτηριστικο: μεγάλη περιεκτικότητα σε κυστεϊνη που είναι οξειδωμένη υπό μορφή δισουλφιδικών δεσμών (διακρίνει τις κερατίνες από άλλες δομικές ίνες) Οι ίνες κερατίνης έχουν χαμηλή περιεκτικότητα σε κυστεϊνη Οι μη ινώδεις πρωτείνες έχουν υψηλή περιεκτικότητα σε κυστεϊνη Δισουλφιδικοί δεσμοί ανάμεσα στις ίνες κερατίνης Καθορίζουν το σχήμα των μαλλιών Οσο περισσότεροι δισουλφιδικοί δεσμοί, Τόσο πιο σγουρά είναι τα μαλλιά Ποιες είναι οι πρακτικές εφαρμογές?

14 Οσο περισσότεροι δισουλφιδικοί δεσμοί, Τόσο πιο σγουρά είναι τα μαλλιά Ποιες είναι οι πρακτικές εφαρμογές?

15 Μηχανικές ιδιότητες μαλλιού (πρόβατο) Υλικο Μέτρο ελαστικότητας (GPa) Μαλλι 0.5 Συνθετικο καουτσουκ Ναυλον 5 Kevlar 130 Ατσάλι υψηλής αντοχής 200

16 Μηχανικές ιδιότητες μαλλιού (πρόβατο) Υλικο αντοχή, σ max (GPa) Μαλλι 0.2 Συνθετικο καουτσουκ 0.05 Ναυλον 0.95 Kevlar 3.6 Ατσάλι υψηλής αντοχής 1.5

17 Μηχανικές ιδιότητες μαλλιού (πρόβατο) Υλικο εκτατικότητα, ε max Μαλλι 0.5 Συνθετικο καουτσουκ 8.5 Ναυλον 0.18 Kevlar Ατσάλι υψηλής αντοχής 0.008

18 Μηχανικές ιδιότητες μαλλιού (πρόβατο) Υλικο ανθεκτικότητα (MJ/m 3 ) Μαλλι 60 Συνθετικο καουτσουκ 100 Ναυλον 80 Kevlar 50 Ατσάλι υψηλής αντοχής 6

19 Μηχανικές ιδιότητες ανθρώπινης τρίχας μαλλιών Τι μας λένε οι καμπύλες τάσης- παραμόρφωσης?

20 Μηχανικές ιδιότητες ανθρώπινης τρίχας μαλλιών Τι μας λένε οι καμπύλες τάσης- παραμόρφωσης? 1) Συμπεριφορά σύνθετου υλικού (επιμήκυνση αρχικά των ελίκων της ινώδους φάσης, με κατόπιν σπάσιμο των δεσμών υδρογόνου και αποδίπλωση) Με αποτέλεσμα: Δημιουργία εκτεταμένων βήτα-πτυχωτών επιφανειών και Μετάπτωση από δομή α-έλικας σε Δομή β-πτυχωτών φύλλων

21 Μετάπτωση από δομή α-έλικας σε Δομή β-πτυχωτών φύλλων

22 Μηχανικές ιδιότητες ανθρώπινης τρίχας μαλλιών Τι μας λένε οι καμπύλες τάσης- παραμόρφωσης? 2) Υλικό με μεγάλη υστέρηση (i.e. ενέργεια χάνεται στην επαναφορά αντί να είναι διαθέσιμη για θραύση) Φαίνεται ότι οι δισουλφιδικοί δεσμοί Μεταξύ των αλφα-ελίκων συνεισφέρουν Στις δυνάμεις επαναφοράς

23 Μηχανικές ιδιότητες τρίχας ουράς αλόγου (χρησιμοποιείται στα δοξάρια των βιολιών)

24 Αρχιτεκτονική οπλών και κεράτων

25 Μηχανικές ιδιότητες κεράτων ρινόκερου Τι μας λένε οι καμπύλες τάσης- παραμόρφωσης?

26 Ιστορικά, οι κερατίνες είναι μιά πολύ μελετημένη οικογένεια πρωτεϊνών λόγω Της μεγάλης οικονομικής τους σπουδαιότητας : -ζωϊκές ίνες υφασμάτων (μαλλί) -συνθετικήπαραγωγήμαλλιού? -ανάπτυξη συνθετικών υποκαταστάτων μαλλιών και επιδερμίδας

27 CSIRO (Australian Commonwealth Scientific and Research Organization) OPTIM TM FIBERS

28 WRONZ (WOOL RESEARCH ORGANIZATION OF NEW ZEALAND) KERATEC TM

29 Kερατίνες των πτηνών και ερπετών (Φτερά πτηνών, ποδαράκια του gecko )

30 Οι κερατίνες των πτηνών και ερπετών Έχουν δομή βητα- πτυχωτών φύλλων, π.χ, Φτερά πτηνών, ποδαράκια του gecko

31 Δομικά χαρακτηριστικά κερατίνης φτερών κότας Βασική επαναλαμβανόμενη μονάδα: αντιπαράλληλη στραμμένη πτυχωτή επιφάνεια 4 πτυχώσεων Σχηματίζεται έλικα με 4 μονάδες/στροφή Δύο έλικες περιελίσσονται σε υπερέλικα

32 Δομικά χαρακτηριστικά υπερέλικας: Βημα 95 Å, πάχος περιπου 25 Å

ΒΙΟΛΟΓΙΚΕΣ ΙΝΕΣ ΜΕΤΑΞΙ ΙΣΤΟΙ ΑΡΑΧΝΩΝ

ΒΙΟΛΟΓΙΚΕΣ ΙΝΕΣ ΜΕΤΑΞΙ ΙΣΤΟΙ ΑΡΑΧΝΩΝ ΒΙΟΛΟΓΙΚΕΣ ΙΝΕΣ ΜΕΤΑΞΙ ΙΣΤΟΙ ΑΡΑΧΝΩΝ Βιοσυνθεση του μεταξιου (πρωτεινη) -δυο κυριες πρωτεινες > φιβροινη+σερισινη Κατά την διαρκεια του περασματος από τον αδενα του μεταξοσκωληκα, οι πολυπεπτιδικες αλυσιδες

Διαβάστε περισσότερα

ΠΡΩΤΕΪΝΕΣ ΤΟΥ ΣΥΝΔΕΤΙΚΟΥ ΙΣΤΟΥ

ΠΡΩΤΕΪΝΕΣ ΤΟΥ ΣΥΝΔΕΤΙΚΟΥ ΙΣΤΟΥ ΠΡΩΤΕΪΝΕΣ ΤΟΥ ΣΥΝΔΕΤΙΚΟΥ ΙΣΤΟΥ ΚΟΛΛΑΓΟΝΟ -ινώδης πρωτεϊνη -σχηματίζει αδιάλυτες ίνες με μεγάλη αντοχή στον εφελκυσμό -η πιο άφθονη πρωτεϊνη των θηλαστικών, αποτελεί το ¼ της συνολικής πρωτείνης του οργανισμού

Διαβάστε περισσότερα

ΣΥΝΘΕΤΑ ΒΙΟΛΟΓΙΚΑ ΥΛΙΚΑ (BIOMINERALS, BIOLOGICAL CERAMICS) -NACRE (μαργαρο, σεντεφι) -ΦΕΡΡΙΤΙΝΗ ΚΑΙ ΜΑΓΝΗΤΟΣΩΜΑΤΑ

ΣΥΝΘΕΤΑ ΒΙΟΛΟΓΙΚΑ ΥΛΙΚΑ (BIOMINERALS, BIOLOGICAL CERAMICS) -NACRE (μαργαρο, σεντεφι) -ΦΕΡΡΙΤΙΝΗ ΚΑΙ ΜΑΓΝΗΤΟΣΩΜΑΤΑ ΣΥΝΘΕΤΑ ΒΙΟΛΟΓΙΚΑ ΥΛΙΚΑ (BIOMINERALS, BIOLOGICAL CERAMICS) -NACRE (μαργαρο, σεντεφι) -OΣΤΑ -ΔΟΝΤΙΑ -ΒΙΟΛΟΓΙΚΕΣ ΙΝΕΣ ΠΥΡΙΤΙΟΥ -ΦΕΡΡΙΤΙΝΗ ΚΑΙ ΜΑΓΝΗΤΟΣΩΜΑΤΑ Nacre (μαργαρο, σεντεφι) 95% Ανοργανη φαση=ανθρακικο

Διαβάστε περισσότερα

Δομικές κατηγορίες πρωτεϊνών

Δομικές κατηγορίες πρωτεϊνών 3-1 Κεφάλαι ο Δομικές κατηγορίες πρωτεϊνών 3.1. α-δομές πρωτεϊνών Οι α-έλικες είναι δομικά στοιχεία που μπορούν να σχηματίσουν πολλές κατηγορίες στερεοδομών και με πολλές διαφορετικές λειτουργίες. Εκτός

Διαβάστε περισσότερα

ΓΩΝΙΕΣ φ, ψ ΚΑΙ ΕΠΙΤΡΕΠΤΕΣ ΔΙΑΜΟΡΦΩΣΕΙΣ ΤΗΣ ΠΟΛΥΠΕΠΤΙΔΙΚΗΣ ΑΛΥΣΙΔΑΣ

ΓΩΝΙΕΣ φ, ψ ΚΑΙ ΕΠΙΤΡΕΠΤΕΣ ΔΙΑΜΟΡΦΩΣΕΙΣ ΤΗΣ ΠΟΛΥΠΕΠΤΙΔΙΚΗΣ ΑΛΥΣΙΔΑΣ ΓΩΝΙΕΣ φ, ψ ΚΑΙ ΕΠΙΤΡΕΠΤΕΣ ΔΙΑΜΟΡΦΩΣΕΙΣ ΤΗΣ ΠΟΛΥΠΕΠΤΙΔΙΚΗΣ ΑΛΥΣΙΔΑΣ ΜΕΤΡΗΣΗ ΤΗΣ ΓΩΝΙΑΣ φ φ Ccarbonyl n Ccarbonyl n N Cα n Ccarbonyl n-1 Cα n N φ Ccarbonyl n-1 ΜΕΤΡΗΣΗ ΤΗΣ ΓΩΝΙΑΣ ψ φ ψ Ccarbonyl n N (Ca

Διαβάστε περισσότερα

ΕΠΙΣΤΗΜΗ ΦΥΣΙΚΩΝ ΒΙΟΥΛΙΚΩΝ ΕΤΥ- 391

ΕΠΙΣΤΗΜΗ ΦΥΣΙΚΩΝ ΒΙΟΥΛΙΚΩΝ ΕΤΥ- 391 ΕΠΙΣΤΗΜΗ ΦΥΣΙΚΩΝ ΒΙΟΥΛΙΚΩΝ ΕΤΥ- 391 ΕΙΣΑΓΩΓΙΚΕΣ ΕΝΝΟΙΕΣ ΚΑΙ ΔΙΑΡΘΡΩΣΗ ΥΛΗΣ ΑΝΝΑ ΜΗΤΡΑΚΗ mitraki@materials.uoc.gr 2011-2012 ΓΙΑΤΙ ΤΑ ΦΥΣΙΚΑ ΒΙΟΥΛΙΚΑ? Γλυπτό της Louise Bourgeois, μουσείο Guggenheim, Bilbao,

Διαβάστε περισσότερα

Osteogenesis Imperfecta (Ατελής Οστεογένεση ) Ομάδα: Πατρασκάκη Μυρτώ Τσιτσικλή Μαγδαληνή

Osteogenesis Imperfecta (Ατελής Οστεογένεση ) Ομάδα: Πατρασκάκη Μυρτώ Τσιτσικλή Μαγδαληνή Osteogenesis Imperfecta (Ατελής Οστεογένεση ) Ομάδα: Πατρασκάκη Μυρτώ Τσιτσικλή Μαγδαληνή Osteogenesis imperfecta Μενδελικό Νόσημα Συχνότητα στον πληθυσμό: 1:20.000 80-95% αυτοσωμικό επικρατές 10-15% αυτοσωμικό

Διαβάστε περισσότερα

Αρχιτεκτονική της τρισδιάστατης δομής πρωτεϊνών

Αρχιτεκτονική της τρισδιάστατης δομής πρωτεϊνών Αρχιτεκτονική της τρισδιάστατης δομής πρωτεϊνών Βασίλης Προμπονάς, PhD Ερευνητικό Εργαστήριο Βιοπληροφορικής Τμήμα Βιολογικών Επιστημών Νέα Παν/πολη, Γραφείο B161 Πανεπιστήμιο Κύπρου Ταχ.Κιβ. 20537 1678,

Διαβάστε περισσότερα

Εργαστήριο Συνθέτων Υλικών

Εργαστήριο Συνθέτων Υλικών Εργαστήριο Συνθέτων Υλικών Εργαστηριακή Άσκηση 04 ΥΛΙΚΑ ΕΝΙΣΧΥΣΗΣ Διδάσκων Δρ Κατσιρόπουλος Χρήστος Τμήμα Μηχανολογίας ΑΤΕΙ Πατρών 2014-15 1 Ταξινόμηση ΣΥ 2 Διάφοροι Τύποι ινών 3 Ίνες Άνθρακα -υψηλές ειδικές

Διαβάστε περισσότερα

ΕΡΓΑΣΤΗΡΙΑΚΟ ΚΕΝΤΡΟ ΦΥΣΙΚΩΝ ΕΠΙΣΤΗΜΩΝ Ν. ΜΑΓΝΗΣΙΑΣ ( Ε.Κ.Φ.Ε ) ΕΡΓΑΣΤΗΡΙΟ ΒΙΟΛΟΓΙΑΣ

ΕΡΓΑΣΤΗΡΙΑΚΟ ΚΕΝΤΡΟ ΦΥΣΙΚΩΝ ΕΠΙΣΤΗΜΩΝ Ν. ΜΑΓΝΗΣΙΑΣ ( Ε.Κ.Φ.Ε ) ΕΡΓΑΣΤΗΡΙΟ ΒΙΟΛΟΓΙΑΣ ΕΡΓΑΣΤΗΡΙΑΚΟ ΚΕΝΤΡΟ ΦΥΣΙΚΩΝ ΕΠΙΣΤΗΜΩΝ Ν. ΜΑΓΝΗΣΙΑΣ ( Ε.Κ.Φ.Ε ) ΕΡΓΑΣΤΗΡΙΟ ΒΙΟΛΟΓΙΑΣ Θέμα: ΜΕΤΟΥΣΙΩΣΗ ΠΡΩΤΕΪΝΩΝ (άσκηση 7 του εργαστηριακού οδηγού) Μέσος χρόνος πειράματος: 45 λεπτά Α. ΑΝΑΛΩΣΙΜΑ Εργαλεία

Διαβάστε περισσότερα

οµή και Αναδίπλωση πρωτεϊνών

οµή και Αναδίπλωση πρωτεϊνών οµή και Αναδίπλωση πρωτεϊνών Νηφόρου Κατερίνα Μεταδιδακτορική Ερευνήτρια, Οµάδα Μοριακής Καρκινογένεσης, Εργ/ριο Ιστολογίας-Εµβρυολογίας, Ιατρική Σχολή Αθηνών Σηµασία των πρωτεϊνών Ενζυµική κατάλυση Μεταφορά

Διαβάστε περισσότερα

Καλλιεργούνται πολλές ποικιλίες σιταριών, οι οποίες χωρίζονται σε δύο κατηγορίες: α) σε σκληρά σιτάρια τα οποία έχουν υψηλότερο ποσοστό σε πρωτεΐνη

Καλλιεργούνται πολλές ποικιλίες σιταριών, οι οποίες χωρίζονται σε δύο κατηγορίες: α) σε σκληρά σιτάρια τα οποία έχουν υψηλότερο ποσοστό σε πρωτεΐνη Δημητριακά Δημητριακά ή σιτηρά είναι αποξηραμένοι ώριμοι καρποί φυτών. Τα πιο σημαντικά δημητριακά είναι το σιτάρι ή σίτος, το ρύζι, το καλαμπόκι ή αραβόσιτος, το κριθάρι, η σίκαλη και η βρώμη. Ο κόκκος

Διαβάστε περισσότερα

ΧΗΜΕΙΑ - ΒΙΟΧΗΜΕΙΑ ΤΕΧΝΟΛΟΓΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ (ΚΥΚΛΟΣ ΤΕΧΝΟΛΟΓΙΑΣ ΚΑΙ ΠΑΡΑΓΩΓΗΣ) 2008 ΕΚΦΩΝΗΣΕΙΣ

ΧΗΜΕΙΑ - ΒΙΟΧΗΜΕΙΑ ΤΕΧΝΟΛΟΓΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ (ΚΥΚΛΟΣ ΤΕΧΝΟΛΟΓΙΑΣ ΚΑΙ ΠΑΡΑΓΩΓΗΣ) 2008 ΕΚΦΩΝΗΣΕΙΣ ΧΗΜΕΙΑ - ΒΙΟΧΗΜΕΙΑ ΤΕΧΝΟΛΟΓΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ (ΚΥΚΛΟΣ ΤΕΧΝΟΛΟΓΙΑΣ ΚΑΙ ΠΑΡΑΓΩΓΗΣ) 2008 ΕΚΦΩΝΗΣΕΙΣ ΘΕΜΑ 1ο Για τις ερωτήσεις 1.1 και 1.2 να γράψετε στο τετράδιό σας τον αριθµό της ερώτησης και δίπλα το γράµµα

Διαβάστε περισσότερα

«ΕΙΣΑΓΩΓΗ ΣΤΗ ΔΟΜΗ ΞΥΛΟΥ» ΧΗΜΙΚΗ ΣΥΣΤΑΣΗ ΤΟΥ ΞΥΛΟΥ. Δρ. Γεώργιος Μαντάνης Εργαστήριο Τεχνολογίας Ξύλου Τμήμα Σχεδιασμού & Τεχνολογίας Ξύλου & Επίπλου

«ΕΙΣΑΓΩΓΗ ΣΤΗ ΔΟΜΗ ΞΥΛΟΥ» ΧΗΜΙΚΗ ΣΥΣΤΑΣΗ ΤΟΥ ΞΥΛΟΥ. Δρ. Γεώργιος Μαντάνης Εργαστήριο Τεχνολογίας Ξύλου Τμήμα Σχεδιασμού & Τεχνολογίας Ξύλου & Επίπλου «ΕΙΣΑΓΩΓΗ ΣΤΗ ΔΟΜΗ ΞΥΛΟΥ» ΧΗΜΙΚΗ ΣΥΣΤΑΣΗ ΤΟΥ ΞΥΛΟΥ Δρ. Γεώργιος Μαντάνης Εργαστήριο Τεχνολογίας Ξύλου Τμήμα Σχεδιασμού & Τεχνολογίας Ξύλου & Επίπλου ΧΗΜΙΚΗ ΣΥΣΤΑΣΗ ΤΟΥ ΞΥΛΟΥ ΣΥΣΤΑΣΗ ΞΥΛΟΥ ΣΕ ΔΟΜΙΚΑ ΣΥΣΤΑΤΙΚΑ

Διαβάστε περισσότερα

οµή και λειτουργία των µεγάλων βιολογικών µορίων

οµή και λειτουργία των µεγάλων βιολογικών µορίων οµή και λειτουργία των µεγάλων βιολογικών µορίων οµή και λειτουργία των µεγάλων βιολογικών µορίων κατηγορίες υδατάνθρακες πρωτεΐνες νουκλεϊνικά οξέα λιπίδια Οι πρωτεΐνες, υδατάνθρακες, νουκλεϊνικά οξέα

Διαβάστε περισσότερα

Ποια η χρησιμότητα των πρωτεϊνών;

Ποια η χρησιμότητα των πρωτεϊνών; ΠΡΩΤΕΪΝΕΣ Τι είναι οι πρωτεϊνες; Η ονομασία πρωτεϊνες προέρχεται από το ρήμα πρωτεύω και σημαίνει την εξαιρετική σημασία που έχουν οι πρωτεϊνες για την υγεία του ανθρώπινου σώματος. Από την εποχή των Ολυμπιακών

Διαβάστε περισσότερα

ΟΛΛΙΝΤΖΑ ΠΑΝΕΠΙΣΤΗΜΙΑΚΑ ΦΡΟΝΤΙΣΤΗΡΙΑ

ΟΛΛΙΝΤΖΑ ΠΑΝΕΠΙΣΤΗΜΙΑΚΑ ΦΡΟΝΤΙΣΤΗΡΙΑ Κ Kάνιγγος ΠΑΝΕΠΙΣΤΗΜΙΑΚΑ ΦΡΟΝΤΙΣΤΗΡΙΑ ΟΛΛΙΝΤΖΑ 10, (5ος όροφ. Τηλ: 210-3300296-7. www.kollintzas.gr 1. Χημική σύσταση του κυττάρου. 2. Δομή και λειτουργία του κυττάρου. 3. Μεταβολισμός: βασικές αρχές,

Διαβάστε περισσότερα

Δοµή και ιδιότητες του DNA. 09/04/2014 1 Μοριακή Βιολογία Κεφ. 1 Καθηγητής Δρ. Κ. Ε. Βοργιάς

Δοµή και ιδιότητες του DNA. 09/04/2014 1 Μοριακή Βιολογία Κεφ. 1 Καθηγητής Δρ. Κ. Ε. Βοργιάς Δοµή και ιδιότητες του DNA 09/04/2014 1 Ορίζεται η γραµµική αλληλουχία των 4 βάσεων damp, dcmp, dgmp, dtmp που είναι συνδεδεµένες µε 3-5 φωσφοδιεστερικό δεσµό. AGCTCGCGTCGCTCACTCTCTGCAT! TCGAGCGCAGCGAGTGAGAGACGTA!

Διαβάστε περισσότερα

Οργανική Χημεία. Κεφάλαιο 27: Βιομόρια, αμινοξέα, πεπτίδια και πρωτεΐνες

Οργανική Χημεία. Κεφάλαιο 27: Βιομόρια, αμινοξέα, πεπτίδια και πρωτεΐνες Οργανική Χημεία Κεφάλαιο 27: Βιομόρια, αμινοξέα, πεπτίδια και πρωτεΐνες 1. Γενικά Πρωτεΐνες: μεγάλα βιομόρια που απαντούν σε όλους τους ζωντανούς οργανισμούς Διαφορετικά είδη πρωτεϊνών με ποικίλη βιολογική

Διαβάστε περισσότερα

Kυτταρική Bιολογία ΔΟΜΗ ΚΑΙ ΛΕΙΤΟΥΡΓΙΕΣ ΤΩΝ ΠΡΩΤΕΪΝΩΝ ΔIAΛEΞΗ 3 (7/3/2012) Δρ. Xρήστος Παναγιωτίδης, Τμήμα Φαρμακευτικής Α.Π.Θ.

Kυτταρική Bιολογία ΔΟΜΗ ΚΑΙ ΛΕΙΤΟΥΡΓΙΕΣ ΤΩΝ ΠΡΩΤΕΪΝΩΝ ΔIAΛEΞΗ 3 (7/3/2012) Δρ. Xρήστος Παναγιωτίδης, Τμήμα Φαρμακευτικής Α.Π.Θ. Kυτταρική Bιολογία ΔIAΛEΞΗ 3 (7/3/2012) ΔΟΜΗ ΚΑΙ ΛΕΙΤΟΥΡΓΙΕΣ ΤΩΝ ΠΡΩΤΕΪΝΩΝ AΣ ΘYMHΘOYME Στην προηγούμενη διάλεξη μιλήσαμε για τη χημική σύσταση των κυττάρων και για τα βιολογικά πολυμερή που αποτελούν

Διαβάστε περισσότερα

ρ Έλενα Κουλλαπή 2014

ρ Έλενα Κουλλαπή 2014 ρ Έλενα Κουλλαπή 2014 Το µεγαλύτερο όργανο του σώµατο Μέση επιφάνεια περίπου 2 m2 Το βάρο του δέρµατο (χωρί το υποδόριο λίπο ) είναι κατά µέσο όρο 4,85 Kgr στον ενήλικο άνδρα και 3,18 Kgr στην ενήλικη

Διαβάστε περισσότερα

ΤΑ ΜΟΡΙΑ ΤΗΣ ΖΩΗΣ. Τι γνωρίζετε για τους υδατάνθρακες;

ΤΑ ΜΟΡΙΑ ΤΗΣ ΖΩΗΣ. Τι γνωρίζετε για τους υδατάνθρακες; 1 ΤΑ ΜΟΡΙΑ ΤΗΣ ΖΩΗΣ Το κύτταρο αποτελείται από χηµικές ενώσεις, στις οποίες περιλαµβάνονται τα µικρά βιολογικά µόρια και τα βιολογικά µακροµόρια. Στα µικρά βιολογικά µόρια ανήκουν, τα ανόργανα στοιχεία

Διαβάστε περισσότερα

Οι δευτερογενείς µεταβολίτες

Οι δευτερογενείς µεταβολίτες Οι δευτερογενείς µεταβολίτες Είναιταπροϊόνταδευτερογενούςµεταβολισµού. Μερικοί γνωστοί δευτερογενείς µεταβολίτες είναι η µορφίνη, ήκαφεΐνη, το καουτσούκ κ.ά. Ο ρόλος τους φαίνεται να είναι οικολογικής

Διαβάστε περισσότερα

Χημική σύσταση του κυττάρου

Χημική σύσταση του κυττάρου 1 Χημική σύσταση του κυττάρου Τα χημικά στοιχεία, που συμμετέχουν στη δομή των βιολογικών μορίων, συγκαταλέγονται στα στοιχεία που συνθέτουν τον φλοιό της γης. Όλοι οι οργανισμοί από τον πιο απλό μέχρι

Διαβάστε περισσότερα

Στηρικτικά Κύτταρα και Εξωκυττάρια Ουσία. Κοτσίνας Αθανάσιος Επικ. Καθηγητής Εργ. Ιστολογίας-Εμβρυολογίας Ιατρική Σχολή - ΕΚΠΑ

Στηρικτικά Κύτταρα και Εξωκυττάρια Ουσία. Κοτσίνας Αθανάσιος Επικ. Καθηγητής Εργ. Ιστολογίας-Εμβρυολογίας Ιατρική Σχολή - ΕΚΠΑ Στηρικτικά Κύτταρα και Εξωκυττάρια Ουσία Κοτσίνας Αθανάσιος Επικ. Καθηγητής Εργ. Ιστολογίας-Εμβρυολογίας Ιατρική Σχολή - ΕΚΠΑ Συνδετικός Ιστός - Ορισμός Παρέχει το: Υποστηρικτικό και Συνδετικό πλαίσιο

Διαβάστε περισσότερα

Εργαστήριο Ιατρικής Φυσικής. Φυσική του Σκελετού

Εργαστήριο Ιατρικής Φυσικής. Φυσική του Σκελετού Εργαστήριο Ιατρικής Φυσικής Φυσική του Σκελετού Τα οστά πραγματοποιούν τουλάχιστον έξι λειτουργίες στο ανθρώπινο σώμα: 1. Υποστήριξη 2. Κίνηση 3. Προστασία διαφόρων οργάνων 4. Αποθήκευση χημικών ουσιών

Διαβάστε περισσότερα

Είναι σημαντικές επειδή: Αποτελούν βασικά δοµικά συστατικά του σώµατος Εξυπηρετούν ενεργειακές ανάγκες Ασκούν έλεγχο σε όλες τις βιοχηµικές διεργασίες

Είναι σημαντικές επειδή: Αποτελούν βασικά δοµικά συστατικά του σώµατος Εξυπηρετούν ενεργειακές ανάγκες Ασκούν έλεγχο σε όλες τις βιοχηµικές διεργασίες ΕΞΕΤΑΣΤΕΑ ΥΛΗ ΕΝΟΤΗΤΑ 2: Η ΧΗΜΕΙΑ ΤΗΣ ΖΩΗΣ 2.1 ΒΑΣΙΚΕΣ ΧΗΜΙΚΕΣ ΕΝΝΟΙΕΣ, 5 9 (απλή αναφορά) 2.2 ΤΟ ΝΕΡΟ ΚΑΙ Η ΒΙΟΛΟΓΙΚΗ ΤΟΥ ΣΗΜΑΣΙΑ, 9 14 (απλή αναφορά), 2.4 ΟΡΓΑΝΙΚΕΣ ΟΥΣΙΕΣ, σελ. 20 36 Οργανικές Ουσίες

Διαβάστε περισσότερα

ΙΑΤΡΙΚΗ ΠΑΝΕΠΙΣΤΗΜΙΟΥ ΑΘΗΝΩΝ (ΕΚΠΑ) ΚΑΤΑΤΑΚΤΗΡΙΕΣ ΕΞΕΤΑΣΕΙΣ ΑΚ.ΕΤΟΥΣ 2014-2015 ΕΞΕΤΑΖΟΜΕΝΟ ΜΑΘΗΜΑ: ΧΗΜΕΙΑ

ΙΑΤΡΙΚΗ ΠΑΝΕΠΙΣΤΗΜΙΟΥ ΑΘΗΝΩΝ (ΕΚΠΑ) ΚΑΤΑΤΑΚΤΗΡΙΕΣ ΕΞΕΤΑΣΕΙΣ ΑΚ.ΕΤΟΥΣ 2014-2015 ΕΞΕΤΑΖΟΜΕΝΟ ΜΑΘΗΜΑ: ΧΗΜΕΙΑ ΙΑΤΡΙΚΗ ΠΑΝΕΠΙΣΤΗΜΙΟΥ ΑΘΗΝΩΝ (ΕΚΠΑ) ΚΑΤΑΤΑΚΤΗΡΙΕΣ ΕΞΕΤΑΣΕΙΣ ΑΚ.ΕΤΟΥΣ 2014-2015 ΕΞΕΤΑΖΟΜΕΝΟ ΜΑΘΗΜΑ: ΧΗΜΕΙΑ ΘΕΜΑΤΑ 1.Πώς οι κινητικές παράμετροι Κ m και K cat χρησιμεύουν για να συγκριθεί η ανακύκλωση διαφορετικών

Διαβάστε περισσότερα

ΑΠΑΝΤΗΣΕΙΣ. ΘΕΜΑ Α Α1. β Α2. γ Α3. δ Α4. γ Α5. β

ΑΠΑΝΤΗΣΕΙΣ. ΘΕΜΑ Α Α1. β Α2. γ Α3. δ Α4. γ Α5. β ΘΕΜΑ Α Α1. β Α2. γ Α3. δ Α4. γ Α5. β 1 ΕΙΣΑΓΩΓΙΚΕΣ ΕΞΕΤΑΣΕΙΣ ΤΕΚΝΩΝ ΕΛΛΗΝΩΝ ΤΟΥ ΕΞΩΤΕΡΙΚΟΥ ΚΑΙ ΤΕΚΝΩΝ ΕΛΛΗΝΩΝ ΥΠΑΛΛΗΛΩΝ ΣΤΟ ΕΞΩΤΕΡΙΚΟ ΤΕΤΑΡΤΗ 10 ΣΕΠΤΕΜΒΡΙΟΥ 2014 ΕΞΕΤΑΖΟΜΕΝΟ ΜΑΘΗΜΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ:

Διαβάστε περισσότερα

Kυτταρική Bιολογία ΒΙΟΛΟΓΙΚΕΣ ΜΕΜΒΡΑΝΕΣ, ΜΕΜΒΡΑΝΙΚΑ ΔΙΑΜΕΡΙΣΜΑΤΑ & ΔΙΑΛΟΓΗ ΠΡΩΤΕΪΝΩΝ ΔIAΛEΞΗ 4 (6/3/2013)

Kυτταρική Bιολογία ΒΙΟΛΟΓΙΚΕΣ ΜΕΜΒΡΑΝΕΣ, ΜΕΜΒΡΑΝΙΚΑ ΔΙΑΜΕΡΙΣΜΑΤΑ & ΔΙΑΛΟΓΗ ΠΡΩΤΕΪΝΩΝ ΔIAΛEΞΗ 4 (6/3/2013) Kυτταρική Bιολογία ΔIAΛEΞΗ 4 (6/3/2013) ΒΙΟΛΟΓΙΚΕΣ ΜΕΜΒΡΑΝΕΣ, ΜΕΜΒΡΑΝΙΚΑ ΔΙΑΜΕΡΙΣΜΑΤΑ & ΔΙΑΛΟΓΗ ΠΡΩΤΕΪΝΩΝ Οι λιπιδικές διπλοστιβάδες ως φραγμοί Νερό Υδρόφιλες φωσφολιπιδικές κεφαλές Φωσφολιπιδική μεμβράνη

Διαβάστε περισσότερα

ΟΡΓΑΝΙΚΕΣ ΟΥΣΙΕΣ. 1. (α) Ποιο μόριο απεικονίζεται στο σχεδιάγραμμα; (β) Ποια είναι η απλούστερη μορφή του R;

ΟΡΓΑΝΙΚΕΣ ΟΥΣΙΕΣ. 1. (α) Ποιο μόριο απεικονίζεται στο σχεδιάγραμμα; (β) Ποια είναι η απλούστερη μορφή του R; ΟΡΓΑΝΙΚΕΣ ΟΥΣΙΕΣ 1. (α) Ποιο μόριο απεικονίζεται στο σχεδιάγραμμα; (β) Ποια είναι η απλούστερη μορφή του R; (γ) Ποιο μέρος του μορίου προσδίδει σε αυτό όξινες ιδιότητες; (δ) Ποιο μέρος του μορίου προσδίδει

Διαβάστε περισσότερα

οµικά στοιχεία βιοµορίων

οµικά στοιχεία βιοµορίων 2-1 Κεφάλαιο 2 οµικά στοιχεία βιοµορίων 2.1. ιαστάσεις των Βιοµορίων Οι διαστάσεις των βιοµορίων κυµαίνονται από µερικά Ångströms (10-10 m) έως µερικές εκατοντάδες Ångströms (10-8 m). (εικόνα 2.1, 2.2)

Διαβάστε περισσότερα

Μέθοδοι μέτρησης μηχανικών ιδιοτήτων κυττάρων και μοντέλα κυτταρικής μηχανικής συμπεριφοράς

Μέθοδοι μέτρησης μηχανικών ιδιοτήτων κυττάρων και μοντέλα κυτταρικής μηχανικής συμπεριφοράς ΕΜΒΙΟΜΗΧΑΝΙΚΗ ΒΙΟΪΑΤΡΙΚΗ ΤΕΧΝΟΛΟΓΙΑ Μέθοδοι μέτρησης μηχανικών ιδιοτήτων κυττάρων και μοντέλα κυτταρικής μηχανικής συμπεριφοράς Πετρόπουλος Ηλίας Σωτηρόπουλος Εμμανουήλ Μέθοδοι μέτρησης των μηχανικών ιδιοτήτων

Διαβάστε περισσότερα

ΘΕΜΑ Α Α1. γ Α2. γ Α3. α Α4. β Α5. β ΘΕΜΑ B B1. B2.

ΘΕΜΑ Α Α1. γ Α2. γ Α3. α Α4. β Α5. β ΘΕΜΑ B B1. B2. ΘΕΜΑ Α Α1. γ (το πριμόσωμα) Α2. γ (οι υποκινητές και οι μεταγραφικοί παράγοντες κάθε γονιδίου) Α3. α (μεταφέρει ένα συγκεκριμένο αμινοξύ στο ριβόσωμα) Α4. β (αποδιάταξη των δύο συμπληρωματικών αλυσίδων)

Διαβάστε περισσότερα

Θέματα πριν τις εξετάσεις. Καλό διάβασμα Καλή επιτυχία

Θέματα πριν τις εξετάσεις. Καλό διάβασμα Καλή επιτυχία Θέματα πριν τις εξετάσεις Καλό διάβασμα Καλή επιτυχία 2013-2014 Θέματα πολλαπλής επιλογής Μετουσίωση είναι το φαινόμενο α. κατά το οποίο συνδέονται δύο αμινοξέα για τον σχηματισμό μιας πρωτεΐνης β. κατά

Διαβάστε περισσότερα

Λ.Χ. Μαργαρίτης ΦΡΟΝΤΙΣΤΗΡΙΟ ΗΛΕΚΤΡΟΝΙΚΗΣ ΜΙΚΡΟΣΚΟΠΙΑΣ, ΜΕΡΟΣ A. http://kyttariki.biol.uoa.gr. Τμήμα Βιολογίας Μάθημα: ΒΙΟΛΟΓΙΑ ΚΥΤΤΑΡΟΥ Γ εξάμηνο.

Λ.Χ. Μαργαρίτης ΦΡΟΝΤΙΣΤΗΡΙΟ ΗΛΕΚΤΡΟΝΙΚΗΣ ΜΙΚΡΟΣΚΟΠΙΑΣ, ΜΕΡΟΣ A. http://kyttariki.biol.uoa.gr. Τμήμα Βιολογίας Μάθημα: ΒΙΟΛΟΓΙΑ ΚΥΤΤΑΡΟΥ Γ εξάμηνο. Τμήμα Βιολογίας Μάθημα: ΒΙΟΛΟΓΙΑ ΚΥΤΤΑΡΟΥ Γ εξάμηνο. ΦΡΟΝΤΙΣΤΗΡΙΟ ΗΛΕΚΤΡΟΝΙΚΗΣ ΜΙΚΡΟΣΚΟΠΙΑΣ, ΜΕΡΟΣ A Λ.Χ. Μαργαρίτης...για περισσότερα... http://kyttariki.biol.uoa.gr Ηλεκτρονική μικροσκοπία Φροντιστήριο

Διαβάστε περισσότερα

Ανατομία και μορφολογία πτηνού

Ανατομία και μορφολογία πτηνού Ανατομία και μορφολογία πτηνού Τα πτηνά είναι ομοιόθερμα σπονδυλωτά που φυλογενετικά σχετίζονται με τους Δεινοσαύρους Τα αρτίγονα πουλιά (Νεόρνιθες) διαιρούνται σε δύο ομάδες: (1) Παλαιόγναθα (κίβι, έμου,

Διαβάστε περισσότερα

Όνομα φοιτητή/φοιτήτριας:

Όνομα φοιτητή/φοιτήτριας: ΠΡΟΟΔΟΣ 2: Δυναμικό Ενεργείας-Ηλεκτροφυσιολογικές Καταγραφές -Ηλεκτρομυογράφημα (ΗΜΓ) ΟΔΗΓΙΕΣ: Οι ερωτήσεις είναι του τύπου "σωστό ή λάθος". Κωδικοποιήστε τις απαντήσεις σας ως εξής: "1"= Σωστό, "0"=Λάθος

Διαβάστε περισσότερα

(Μέρος 1 ο ) Εισηγητής: Ν. Πουλακάκης

(Μέρος 1 ο ) Εισηγητής: Ν. Πουλακάκης Ταξινομικοί χαρακτήρες και Φυλογενετική ανασύσταση. Σχολές ταξινόμησης. Θεωρίες για την Ταξινομική. Φυλογενετική ανάλυση: Μοριακή συστηματική. Οι κύριες διαιρέσεις της Ζωής. (Μέρος 1 ο ) Εισηγητής: Ν.

Διαβάστε περισσότερα

Βιολογία Γ Γενικού Λυκείου Θετικής κατεύθυνσης. Κεφάλαιο 1α Το Γενετικό Υλικό

Βιολογία Γ Γενικού Λυκείου Θετικής κατεύθυνσης. Κεφάλαιο 1α Το Γενετικό Υλικό Βιολογία Γ Γενικού Λυκείου Θετικής κατεύθυνσης Κεφάλαιο 1α Το Γενετικό Υλικό Το DNA είναι το γενετικό υλικό Αρχικά οι επιστήμονες θεωρούσαν ότι οι πρωτεΐνες αποτελούσαν το γενετικό υλικό των οργανισμών.

Διαβάστε περισσότερα

Τμήμα Βιολογίας Μάθημα: ΒΙΟΛΟΓΙΑ ΚΥΤΤΑΡΟΥ Γ εξάμηνο 2014-2015 Διαλέξεις κάθε Τρίτη 13-15 μ.μ. και Παρασκευή 11-13

Τμήμα Βιολογίας Μάθημα: ΒΙΟΛΟΓΙΑ ΚΥΤΤΑΡΟΥ Γ εξάμηνο 2014-2015 Διαλέξεις κάθε Τρίτη 13-15 μ.μ. και Παρασκευή 11-13 Τμήμα Βιολογίας Μάθημα: ΒΙΟΛΟΓΙΑ ΚΥΤΤΑΡΟΥ Γ εξάμηνο 2014-2015 Διαλέξεις κάθε Τρίτη 13-15 μ.μ. και Παρασκευή 11-13 Ισιδώρα Παπασιδέρη, Καθηγήτρια...για περισσότερα... http://kyttariki.biol.uoa.gr, ttp://multimedia.biol.uoa.gr

Διαβάστε περισσότερα

Χαλκός Cu. Στοιχείο µετάπτωσης, µέταλλο. Στο κυτταρικό περιβάλλον βρίσκεται σε δύο µορφές οξείδωσης. Cu + ανηγµένος χαλκός. Cu 2+ οξειδωµένος χαλκός

Χαλκός Cu. Στοιχείο µετάπτωσης, µέταλλο. Στο κυτταρικό περιβάλλον βρίσκεται σε δύο µορφές οξείδωσης. Cu + ανηγµένος χαλκός. Cu 2+ οξειδωµένος χαλκός Χαλκός Cu Στοιχείο µετάπτωσης, µέταλλο Στο κυτταρικό περιβάλλον βρίσκεται σε δύο µορφές οξείδωσης Cu + ανηγµένος χαλκός Cu 2+ οξειδωµένος χαλκός Είναι µαλακό οξύ προτιµά να προσαρτάται σε µαλακούς υποκαταστάτες

Διαβάστε περισσότερα

Μοριακή Αναγνώριση. 5.1. Εισαγωγή. 5.2. Σταθερές σύνδεσης και αποχωρισµού. [A][B] k d = ----------- [AB] [ΑΒ] k i = ---------- [Α][Β] Κεφάλαιο

Μοριακή Αναγνώριση. 5.1. Εισαγωγή. 5.2. Σταθερές σύνδεσης και αποχωρισµού. [A][B] k d = ----------- [AB] [ΑΒ] k i = ---------- [Α][Β] Κεφάλαιο Κεφάλαιο 5-1 5 Μοριακή Αναγνώριση 5.1. Εισαγωγή Ένα από τα σηµαντικότερα χαρακτηριστικά των ζωντανών οργανισµών είναι ότι τα µακροµόρια που περιέχουν κάνουν πολύ εξειδικευµένες αλληλεπιδράσεις µε άλλα

Διαβάστε περισσότερα

Nanocellulose / Νανοκυτταρίνη

Nanocellulose / Νανοκυτταρίνη Nanocellulose / Νανοκυτταρίνη Παρουσίαση ενός καινοτομικού προϊόντος με εξαιρετικές έως απίστευτες μελλοντικές προοπτικές τον 21 ο αιώνα! του Γεωργίου Μαντάνη, Καθηγητή ΤΕΙ/Θ Courtesy: Prof. Arthur Ragauskas,

Διαβάστε περισσότερα

ΚΥΤΤΑΡΙΚΗ ΑΝΑΠΝΟΗ. Καρβουντζή Ηλιάνα Βιολόγος

ΚΥΤΤΑΡΙΚΗ ΑΝΑΠΝΟΗ. Καρβουντζή Ηλιάνα Βιολόγος ΚΥΤΤΑΡΙΚΗ ΑΝΑΠΝΟΗ Η τροφή αποτελείται και από ουσίες μεγάλου μοριακού βάρους (πρωτεΐνες, υδατάνθρακες, λιπίδια, νουκλεϊνικά οξέα). Οι ουσίες αυτές διασπώνται (πέψη) σε απλούστερες (αμινοξέα, απλά σάκχαρα,

Διαβάστε περισσότερα

BC BONACURE FIBRE FORCE

BC BONACURE FIBRE FORCE BC BONACURE FIBRE FORCE start BC Fibre Force Κάντε κλικ για περισσότερες πληροφορίες για τα προϊόντα: Οφέλη Shampoo Spray Conditioner Rinse Out Conditioner Fortifier Treatment Keratin Infusion Η ASK Education

Διαβάστε περισσότερα

Δεξαμενές GRP (Glassfibre Reinforced Polyester), κατάλληλες για χρήση σε compact συστήματα. επεξεργασίας αστικών & βιομηχανικών λυμάτων

Δεξαμενές GRP (Glassfibre Reinforced Polyester), κατάλληλες για χρήση σε compact συστήματα. επεξεργασίας αστικών & βιομηχανικών λυμάτων Δεξαμενές GRP (Glassfibre Reinforced Polyester), κατάλληλες για χρήση σε compact συστήματα επεξεργασίας αστικών & βιομηχανικών λυμάτων ΔΕΞΑΜΕΝΕΣ GRP ΒΑΣΙΚΗ ΤΕΧΝΙΚΗ ΠΕΡΙΓΡΑΦΗ ΠΕΔΙΟ ΕΦΑΡΜΟΓΗΣ ΟΡΙΣΜΟΙ Η παρούσα

Διαβάστε περισσότερα

Η Εξωκυττάρια Μήτρα: Δομή & Λειτουργία

Η Εξωκυττάρια Μήτρα: Δομή & Λειτουργία Η Εξωκυττάρια Μήτρα: Δομή & Λειτουργία Δημήτριος Τζεράνης, Ph.D. Εμβιομηχανική και Βιοϊατρική Τεχνολογία Τμήμα Μηχανολόγων Μηχανικών Ε.Μ.Π. Χειμερινό Εξάμηνο 2015 Περιεχόμενα Σύσταση των Ιστών Κύτταρα

Διαβάστε περισσότερα

Σήμερα θα μελετήσουμε το δέρμα. Τα μέρη του. Χρησιμότητά του. Διαπερατότητα του. Την αλληλεπίδραση με τα καλλυντικά.

Σήμερα θα μελετήσουμε το δέρμα. Τα μέρη του. Χρησιμότητά του. Διαπερατότητα του. Την αλληλεπίδραση με τα καλλυντικά. Ανασκόπιση Έχουμε πει τί είναι μόρια και άτομα. Έχουμε αναγνωρίσει ποια μόρια διαλύονται στο νερό και ποια όχι βάση των πολικών θέσεων που έχουν. Έχουμε συναντήσει μόρια πολύ μεγάλου μεγέθους (πολυμερή)

Διαβάστε περισσότερα

Βιοϋλικά. Ενότητα 5: Πρωτεΐνες, Κύτταρα, Ιστοί Αλληλεπίδραση με Βιοϋλικά. Ελευθέριος Αμανατίδης Πολυτεχνική Σχολή Τμήμα Χημικών Μηχανικών

Βιοϋλικά. Ενότητα 5: Πρωτεΐνες, Κύτταρα, Ιστοί Αλληλεπίδραση με Βιοϋλικά. Ελευθέριος Αμανατίδης Πολυτεχνική Σχολή Τμήμα Χημικών Μηχανικών Βιοϋλικά Ενότητα 5: Πρωτεΐνες, Κύτταρα, Ιστοί Αλληλεπίδραση με Βιοϋλικά Ελευθέριος Αμανατίδης Πολυτεχνική Σχολή Τμήμα Χημικών Μηχανικών Περιεχόμενα ενότητας Πρωτεΐνες Δομή και είδη Λειτουργίες πρωτεϊνών

Διαβάστε περισσότερα

Χηµεία-Βιοχηµεία Τεχνολογικής Κατεύθυνσης Γ Λυκείου 2001

Χηµεία-Βιοχηµεία Τεχνολογικής Κατεύθυνσης Γ Λυκείου 2001 Χηµεία-Βιοχηµεία Τεχνολογικής Κατεύθυνσης Γ Λυκείου 2001 ΕΚΦΩΝΗΣΕΙΣ Ζήτηµα 1ο 1. Να γράψετε στο τετράδιό σας το γράµµα που αντιστοιχεί στη σωστή απάντηση: Η σταθερά Κ w στους 25 ο C έχει τιµή 10-14 : α.

Διαβάστε περισσότερα

Kυτταρική$Bιολογία$ Πολυκυτταρική+οργάνωση+και+ καρκίνος+ ΔIAΛEΞΕΙΣ*19*&*20! (21!&!28/5/2014)! Δρ.$Xρήστος$Παναγιωτίδης,$Τμήμα$Φαρμακευτικής$Α.Π.Θ.

Kυτταρική$Bιολογία$ Πολυκυτταρική+οργάνωση+και+ καρκίνος+ ΔIAΛEΞΕΙΣ*19*&*20! (21!&!28/5/2014)! Δρ.$Xρήστος$Παναγιωτίδης,$Τμήμα$Φαρμακευτικής$Α.Π.Θ. Kυτταρική$Bιολογία$ ΔIAΛEΞΕΙΣ*19*&*20! (21!&!28/5/2014)! Πολυκυτταρική+οργάνωση+και+ καρκίνος+ Ας+ξαναθυμηθούμε+για+λίγο+ τη+κυτταρική+θεωρία+ Η*κυτταρική*θεωρία*! OΛOI!OI!ZΩNTANOI!OPΓANIΣMOI! AΠOTEΛOYNTAI!AΠO!KYTTAPA!H!AΠO!

Διαβάστε περισσότερα

Kυτταρική$Bιολογία$ Πολυκυτταρική+οργάνωση+και+ καρκίνος+ ΔIAΛEΞΕΙΣ*15*&*16! (18!&!21/5/2012)! Δρ.$Xρήστος$Παναγιωτίδης,$Τμήμα$Φαρμακευτικής$Α.Π.Θ.

Kυτταρική$Bιολογία$ Πολυκυτταρική+οργάνωση+και+ καρκίνος+ ΔIAΛEΞΕΙΣ*15*&*16! (18!&!21/5/2012)! Δρ.$Xρήστος$Παναγιωτίδης,$Τμήμα$Φαρμακευτικής$Α.Π.Θ. Kυτταρική$Bιολογία$ ΔIAΛEΞΕΙΣ*15*&*16! (18!&!21/5/2012)! Πολυκυτταρική+οργάνωση+και+ καρκίνος+ Ας+ξαναθυμηθούμε+για+λίγο+ τη+κυτταρική+θεωρία+ Η*κυτταρική*θεωρία*! OΛOI!OI!ZΩNTANOI!OPΓANIΣMOI! AΠOTEΛOYNTAI!AΠO!KYTTAPA!H!AΠO!

Διαβάστε περισσότερα

1.1. Να γράψετε στο τετράδιό σας το γράµµα που αντιστοιχεί στη σωστή απάντηση:

1.1. Να γράψετε στο τετράδιό σας το γράµµα που αντιστοιχεί στη σωστή απάντηση: ΘΕΜΑ 1o 1.1. Να γράψετε στο τετράδιό σας το γράµµα που αντιστοιχεί στη σωστή απάντηση: Η σταθερά Κ w στους 25 ο C έχει τιµή 10-14 : α. µόνο στο καθαρό νερό β. σε οποιοδήποτε υδατικό διάλυµα γ. µόνο σε

Διαβάστε περισσότερα

Κυτταρικό τοίχωμα. Το φυτικό κύτταρο. Χλωροπλάστης Χυμοτόπιο

Κυτταρικό τοίχωμα. Το φυτικό κύτταρο. Χλωροπλάστης Χυμοτόπιο Κυτταρικό τοίχωμα Το φυτικό κύτταρο Χλωροπλάστης Χυμοτόπιο Κυτταρικό τοίχωμα Στέρεα και ελαστική στοιβάδα που περιβάλλει το φυτικό κύτταρο Καθορίζει και διατηρεί το σχήμα και το μέγεθος του κυττάρου Προστατευτική

Διαβάστε περισσότερα

2.1 Εισαγωγή. 2.1 Εισαγωγή. 2.2 Το εσωτερικό των ϖρωτεϊνών είναι υδρόφοβο. 2.3 Η α-έλικα αϖοτελεί ένα σηµαντικό στοιχείο. τη δευτεροταγή δοµή

2.1 Εισαγωγή. 2.1 Εισαγωγή. 2.2 Το εσωτερικό των ϖρωτεϊνών είναι υδρόφοβο. 2.3 Η α-έλικα αϖοτελεί ένα σηµαντικό στοιχείο. τη δευτεροταγή δοµή Κεφάλαιο 2 2.1 Εισαγωγή 2.2 Το εσωτερικό των ϖρωτεϊνών είναι υδρόφοβο 2.3 Η α-έλικα αϖοτελεί ένα σηµαντικό στοιχείο της δευτεροταγούς δοµής 2.4 Η α-έλικα έχει διϖολική ροϖή 2.5 Κάϖοια αµινοξέα ϖροτιµώνται

Διαβάστε περισσότερα

ΒΙΟΛΟΓΙΑ Β ΛΥΚΕΙΟΥ ΓΕΝΙΚΗΣ ΠΑΙΔΕΙΑΣ

ΒΙΟΛΟΓΙΑ Β ΛΥΚΕΙΟΥ ΓΕΝΙΚΗΣ ΠΑΙΔΕΙΑΣ ΕΚΠΑΙΔΕΥΤΗΡΙΑ ΣΥΓΧΡΟΝΗ ΠΑΙΔΕΙΑ ΒΙΟΛΟΓΙΑ Β ΛΥΚΕΙΟΥ ΓΕΝΙΚΗΣ ΠΑΙΔΕΙΑΣ ΕΠΙΜΕΛΕΙΑ:Ν.ΠΑΠΑΓΙΑΝΝΗΣ 2 Η ΧΗΜΕΙΑ ΤΗΣ ΖΩΗΣ 3 1. Ποια είναι τα επίπεδα οργάνωσης της ζωής και ποια τα χημικά χαρακτηριστικά της; Στην

Διαβάστε περισσότερα

Η ζητούμενη σειρά έχει ως εξής: αδενίνη < νουκλεοτίδιο < νουκλεόσωμα < γονίδιο < χρωματίδα < χρωμόσωμα < γονιδίωμα.

Η ζητούμενη σειρά έχει ως εξής: αδενίνη < νουκλεοτίδιο < νουκλεόσωμα < γονίδιο < χρωματίδα < χρωμόσωμα < γονιδίωμα. ΚΕΦ. 1 ο ΕΡΩΤΗΣΕΙΣ ΚΡΙΣΕΩΣ 1. Να κατατάξετε σε σειρά αυξανόμενου μεγέθους τις παρακάτω έννοιες που σχετίζονται με το γενετικό υλικό των οργανισμών: νουκλεόσωμα, χρωμόσωμα, αδενίνη, νουκλεοτίδιο, γονίδιο

Διαβάστε περισσότερα

MANAGING AUTHORITY OF THE OPERATIONAL PROGRAMME EDUCATION AND INITIAL VOCATIONAL TRAINING ΛΙΠΗ. ΘΑΝΑΣΗΣ ΤΖΙΑΜΟΥΡΤΑΣ, Ph.D., C.S.C.

MANAGING AUTHORITY OF THE OPERATIONAL PROGRAMME EDUCATION AND INITIAL VOCATIONAL TRAINING ΛΙΠΗ. ΘΑΝΑΣΗΣ ΤΖΙΑΜΟΥΡΤΑΣ, Ph.D., C.S.C. MANAGING AUTHORITY OF THE OPERATIONAL PROGRAMME EDUCATION AND INITIAL VOCATIONAL TRAINING ΛΙΠΗ ΘΑΝΑΣΗΣ ΤΖΙΑΜΟΥΡΤΑΣ, Ph.D., C.S.C.S Τα λίπη αποτελούν μια συμπυκνωμένη πηγή ενέργειας Ενεργούν σαν διαλύτες

Διαβάστε περισσότερα

Από το βιβλίο του Δρ. Πέτρου Α. Πουλμέντη

Από το βιβλίο του Δρ. Πέτρου Α. Πουλμέντη Από το βιβλίο του Δρ. Πέτρου Α. Πουλμέντη Κεφάλαιο 1 Εισαγωγή στη βιολογική μηχανική Κεφάλαιο 2 Εκβιομηχανική των οστών Οι διαφάνειες που ακολουθούν Η ΑΝΑΤΟΜΙΚΗ ΘΕΣΗ ΤΟΥ ΑΝΘΡΩΠΟΥ Για να περιγράψουμε τα

Διαβάστε περισσότερα

Το μυϊκό σύστημα αποτελείται από τους μύες. Ο αριθμός των μυών του μυϊκού συστήματος ανέρχεται στους 637. Οι μύες είναι όργανα για τη σωματική

Το μυϊκό σύστημα αποτελείται από τους μύες. Ο αριθμός των μυών του μυϊκού συστήματος ανέρχεται στους 637. Οι μύες είναι όργανα για τη σωματική Μύες Το μυϊκό σύστημα αποτελείται από τους μύες. Ο αριθμός των μυών του μυϊκού συστήματος ανέρχεται στους 637. Οι μύες είναι όργανα για τη σωματική κινητικότητα, την σπλαχνική κινητικότητα και τη κυκλοφορία

Διαβάστε περισσότερα

Σύζευξη σπιν-σπιν J = 0 J 0

Σύζευξη σπιν-σπιν J = 0 J 0 Σύζευξη σπιν-σπιν Ας υποθέσουµε ότι έχουµε δύο πυρήνες Α και Χ, οι οποίοι είτε συνδέονται απ ευθείας µε έναν δεσµό είτε η σύνδεσή γίνεται µε περισσότερους δεσµούς. A X J = 0 J 0 Α Χ Α Χ Το σπάσιµο των

Διαβάστε περισσότερα

(αδρές αποικίες) Θέρμανση (λείες αποικίες) ζωντανά ποντίκια ζωντανά ποντίκια νεκρά ποντίκια

(αδρές αποικίες) Θέρμανση (λείες αποικίες) ζωντανά ποντίκια ζωντανά ποντίκια νεκρά ποντίκια Το DNA είναι το γενετικό υλικό 1. Πείραμα Griffith (1928) Βακτήριο πνευμονιόκοκκου (Diplococcus pneumoniae) Χωρίς κάλυμμα Με κάλυμμα (αδρές αποικίες) Θέρμανση (λείες αποικίες) ζωντανά ποντίκια ζωντανά

Διαβάστε περισσότερα

οµή και Λειτουργία της Κυτταρικής Μεµβράνης

οµή και Λειτουργία της Κυτταρικής Μεµβράνης οµή και Λειτουργία της Κυτταρικής Μεµβράνης Αποµόνωση του κυττάρου από το περιβάλλον 10.1-membrane_fluidity.mov Λειτουργίες της κυτταρικής µεµβράνης 1. Ρυθµίζει τη διεύλευση ουσιών 2. Αναγνωρίζει χηµικά

Διαβάστε περισσότερα

ΑΠΑΝΤΗΣΕΙΣ. ΘΕΜΑ 1ο 1. γ 2. γ 3. β 4. α 5. δ

ΑΠΑΝΤΗΣΕΙΣ. ΘΕΜΑ 1ο 1. γ 2. γ 3. β 4. α 5. δ ΘΕΜΑ 1ο 1. γ 2. γ 3. β 4. α 5. δ 1 ΕΙΣΑΓΩΓΙΚΕΣ ΕΞΕΤΑΣΕΙΣ ΤΕΚΝΩΝ ΕΛΛΗΝΩΝ ΤΟΥ ΕΞΩΤΕΡΙΚΟΥ ΚΑΙ ΤΕΚΝΩΝ ΕΛΛΗΝΩΝ ΥΠΑΛΛΗΛΩΝ ΣΤΟ ΕΞΩΤΕΡΙΚΟ ΤΕΤΑΡΤΗ 9 ΣΕΠΤΕΜΒΡΙΟΥ 2009 ΕΞΕΤΑΖΟΜΕΝΟ ΜΑΘΗΜΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ: ΒΙΟΛΟΓΙΑ

Διαβάστε περισσότερα

Γραμμικώς πολωμένα κύματα σε κάθετο επίπεδο

Γραμμικώς πολωμένα κύματα σε κάθετο επίπεδο ΚΥΚΛΙΚΟΣ ΔΙΧΡΩΙΣΜΟΣ Γραμμικώς πολωμένα κύματα σε κάθετο επίπεδο όταν το διάνυσμα του ηλεκτρικού πεδίου ταλαντεύεται κατά μήκος μιας ίσιας γραμμής τότε τα κύματα λέγονται επίπεδα ή γραμμικώς πολωμένα Γραμμικώς

Διαβάστε περισσότερα

ΑΥΤΟΣΥΓΚΡΟΤΗΣΗ ΥΠΕΡΜΟΡΙΑΚΩΝ ΔΟΜΩΝ ΚΑΨΙΔΙΑ ΙΩΝ ΚΑΙ ΦΑΓΩΝ ΒΑΚΤΗΡΙΑΚΕΣ ΜΑΣΤΗΓΙΝΕΣ ΦΥΣΙΟΛΟΓΙΚΗ ΚΑΙ ΜΗ-ΦΥΣΙΟΛΟΓΙΚΗ ΣΥΣΣΩΜΑΤΩΣΗ

ΑΥΤΟΣΥΓΚΡΟΤΗΣΗ ΥΠΕΡΜΟΡΙΑΚΩΝ ΔΟΜΩΝ ΚΑΨΙΔΙΑ ΙΩΝ ΚΑΙ ΦΑΓΩΝ ΒΑΚΤΗΡΙΑΚΕΣ ΜΑΣΤΗΓΙΝΕΣ ΦΥΣΙΟΛΟΓΙΚΗ ΚΑΙ ΜΗ-ΦΥΣΙΟΛΟΓΙΚΗ ΣΥΣΣΩΜΑΤΩΣΗ ΑΥΤΟΣΥΓΚΡΟΤΗΣΗ ΥΠΕΡΜΟΡΙΑΚΩΝ ΔΟΜΩΝ ΚΑΨΙΔΙΑ ΙΩΝ ΚΑΙ ΦΑΓΩΝ ΒΑΚΤΗΡΙΑΚΕΣ ΜΑΣΤΗΓΙΝΕΣ ΦΥΣΙΟΛΟΓΙΚΗ ΚΑΙ ΜΗ-ΦΥΣΙΟΛΟΓΙΚΗ ΣΥΣΣΩΜΑΤΩΣΗ Αυτοσυγκρότηση υπερμοριακων δομών Υπενθύμιση: κολλαγονο ΚΑΨΙΔΙΑ (ΚΕΛΥΦΗ) ΙΩΝ ΚΑΙ

Διαβάστε περισσότερα

LISS ADVANCE ΕΓΧΕΙΡΙΔΙΟ ΧΡΗΣΗΣ

LISS ADVANCE ΕΓΧΕΙΡΙΔΙΟ ΧΡΗΣΗΣ LISS ADVANCE ΕΓΧΕΙΡΙΔΙΟ ΧΡΗΣΗΣ LISS ADVANCE Ανακάλυψε την τελειότητα μιας προηγμένης τεχνικής ισιώματος ΕΞΑΦΑΝΙΖΕΙ ΤΟ ΦΡΙΖΑΡΙΣΜΑ ΜΕΙΩΝΕΙ ΤΟΝ ΑΤΙΘΑΣΟ ΟΓΚΟ ΧΑΡΙΖΕΙ ΛΕΙΟ ΦΙΝΙΡΙΣΜΑ ΕΓΓΥΑΤΑΙ ΑΠΟΤΕΛΕΣΜΑΤΙΚΟΤΗΤΑ

Διαβάστε περισσότερα

ΑΝΤΟΧΗ ΥΛΙΚΩΝ Πείραμα Εφελκυσμού. ΕργαστηριακήΆσκηση2 η

ΑΝΤΟΧΗ ΥΛΙΚΩΝ Πείραμα Εφελκυσμού. ΕργαστηριακήΆσκηση2 η ΑΝΤΟΧΗ ΥΛΙΚΩΝ Πείραμα Εφελκυσμού ΕργαστηριακήΆσκηση2 η Κατηγορίες υλικών Μέταλλα Σιδηρούχαµέταλλα (ατσάλι, ανθρακούχοι, κραµατούχοι και ανοξείγωτοιχάλυβες, κ.α. Πολυµερικά υλικά Πλαστικά Ελαστοµερή Μη

Διαβάστε περισσότερα

Τα τριχιδια φύονται κάθετα στην ράχη του στελέχους και σχηματίζουν την επιφάνεια του φτερού. Στα τριχιδια φύονται κατά διαστήματα υποτριχίδια από την

Τα τριχιδια φύονται κάθετα στην ράχη του στελέχους και σχηματίζουν την επιφάνεια του φτερού. Στα τριχιδια φύονται κατά διαστήματα υποτριχίδια από την Φτέρωμα Κατασκευή Τα φτερά είναι κατασκευασμένα από ένα σκληρό και εύκαμπτο υλικό που ονομάζεται "κερατίνη, είναι ακριβώς το ίδιο υλικό που είναι κατασκευασμένα το ράμφος και τα νύχια του πουλιού αλλά

Διαβάστε περισσότερα

BIOXHMEIA, TOMOΣ I ΠANEΠIΣTHMIAKEΣ EKΔOΣEIΣ KPHTHΣ ΑΠΕΙΚΟΝΙΣΗ ΜΟΡΙΑΚΩΝ ΔΟΜΩΝ

BIOXHMEIA, TOMOΣ I ΠANEΠIΣTHMIAKEΣ EKΔOΣEIΣ KPHTHΣ ΑΠΕΙΚΟΝΙΣΗ ΜΟΡΙΑΚΩΝ ΔΟΜΩΝ BIOXHMEIA, TOMOΣ I ΠANEΠIΣTHMIAKEΣ EKΔOΣEIΣ KPHTHΣ ΑΠΕΙΚΟΝΙΣΗ ΜΟΡΙΑΚΩΝ ΔΟΜΩΝ ΑΠΕΙΚΟΝΙΣΗ ΜΟΡΙΑΚΩΝ ΔΟΜΩΝ ΜΟΡΙΑΚΑ ΜΟΝΤΕΛΑ 1: ΧΩΡΟΠΛΗΡΩΤΙΚΟ ΜΟΝΤΕΛΟ (SPACE-FILLING) 1: ΧΩΡΟΠΛΗΡΩΤΙΚΟ ΜΟΝΤΕΛΟ (SPACE-FILLING)

Διαβάστε περισσότερα

ΕΡΓΑΣΤΗΡΙΟ ΙΣΤΟΛΟΓΙΑΣ Μ. ΠΑΥΛΙ ΗΣ

ΕΡΓΑΣΤΗΡΙΟ ΙΣΤΟΛΟΓΙΑΣ Μ. ΠΑΥΛΙ ΗΣ ΕΡΓΑΣΤΗΡΙΟ ΙΣΤΟΛΟΓΙΑΣ Μ. ΠΑΥΛΙ ΗΣ Hράκλειο, εκέμβριος 2011 ΤΥΠΟΙ ΙΣΤΩΝ 1. Eπιθηλιακός Πολυεδρικά κύτταρα που είναι πάρα πολύ στενά συνδεδεμένα και φέρουν ελάχιστη μεσοκυττάρια ουσία 2. Συνδετικός Κύτταρα

Διαβάστε περισσότερα

ΒΑΣΙΚΕΣ ΔΟΜΕΣ - ΤΟ ΚΥΤΤΑΡΟ

ΒΑΣΙΚΕΣ ΔΟΜΕΣ - ΤΟ ΚΥΤΤΑΡΟ ΤΕΙ ΠΑΤΡΑΣ ΤΜΗΜΑ ΝΟΣΗΛΕΥΤΙΚΗΣ ΑΝΑΤΟΜΙΑ I ΥΠΕΥΘΥΝΟΣ ΚΑΘΗΓΗΤΗΣ : Γεράσιμος Π. Βανδώρος ΒΑΣΙΚΕΣ ΔΟΜΕΣ - ΤΟ ΚΥΤΤΑΡΟ Οι βασικές δομές που εξετάζουμε στην ανατομία μπορούν ιεραρχικά να ταξινομηθούν ως εξής:

Διαβάστε περισσότερα

ΒΙΟΛΟΓΙΑ ΓΕΝΙΚΗΣ ΠΑΙΔΕΙΑΣ Β ΤΑΞΗΣ ΕΝΙΑΙΟΥ ΛΥΚΕΙΟΥ

ΒΙΟΛΟΓΙΑ ΓΕΝΙΚΗΣ ΠΑΙΔΕΙΑΣ Β ΤΑΞΗΣ ΕΝΙΑΙΟΥ ΛΥΚΕΙΟΥ ΒΙΟΛΟΓΙΑ ΓΕΝΙΚΗΣ ΠΑΙΔΕΙΑΣ Β ΤΑΞΗΣ ΕΝΙΑΙΟΥ ΛΥΚΕΙΟΥ ΜΕ ANIMATIONS ΚΑΙ ΣΧΕΔΙΑΓΡΑΜΜΑΤΑ Παν. Πάλλα - ΕΚΦΕ Ν. ΣΜΥΡΝΗΣ 1 ΜΙΑ ΕΙΚΟΝΑ ΧΙΛΙΕΣ ΛΕΞΕΙΣ Η παρουσίαση ακολουθεί τη σειρά των περιεχομένων του βιβλίου Βιολογίας

Διαβάστε περισσότερα

BIOXHMEIA, TOMOΣ I ΠANEΠIΣTHMIAKEΣ EKΔOΣEIΣ KPHTHΣ ΑΠΕΙΚΟΝΙΣΗ ΜΟΡΙΑΚΩΝ ΔΟΜΩΝ

BIOXHMEIA, TOMOΣ I ΠANEΠIΣTHMIAKEΣ EKΔOΣEIΣ KPHTHΣ ΑΠΕΙΚΟΝΙΣΗ ΜΟΡΙΑΚΩΝ ΔΟΜΩΝ BIOXHMEIA, TOMOΣ I ΠANEΠIΣTHMIAKEΣ EKΔOΣEIΣ KPHTHΣ ΑΠΕΙΚΟΝΙΣΗ ΜΟΡΙΑΚΩΝ ΔΟΜΩΝ ΑΠΕΙΚΟΝΙΣΗ ΜΟΡΙΑΚΩΝ ΔΟΜΩΝ ΜΟΡΙΑΚΑ ΜΟΝΤΕΛΑ 1: ΧΩΡΟΠΛΗΡΩΤΙΚΟ ΜΟΝΤΕΛΟ (SPACE-FILLING) 1: ΧΩΡΟΠΛΗΡΩΤΙΚΟ ΜΟΝΤΕΛΟ (SPACE-FILLING)

Διαβάστε περισσότερα

Για τον άνθρωπο π.χ. το 85% περίπου των στερεών συστατικών του σώματός του αποτελείται από πρωτεΐνες. Έτσι οι πρωτεΐνες της τροφής χρησιμοποιούνται :

Για τον άνθρωπο π.χ. το 85% περίπου των στερεών συστατικών του σώματός του αποτελείται από πρωτεΐνες. Έτσι οι πρωτεΐνες της τροφής χρησιμοποιούνται : PΟΛΟΣ ΤΩΝ ΠΡΩΤΕΪΝΩΝ ΣΤΗ ΔΙΑΤΡΟΦΗ Oι πρωτεΐνες είναι τάξη θρεπτικών υλών με ιδιαίτερη σημασία για τους ζωντανούς οργανισμούς, γιατί αποτελούν την κύρια δομική ύλη τους. Περιεκτηκότητα μερικών τροφίμων σε

Διαβάστε περισσότερα

Από τα δεδομένα της πρωτοδιάταξης σε συνδυασμό με τα δεδομένα που λαμβάνονται από ανοσοχημικές

Από τα δεδομένα της πρωτοδιάταξης σε συνδυασμό με τα δεδομένα που λαμβάνονται από ανοσοχημικές Εν αντιθέσει με αυτά που έχουν βρεθεί για τους προκαρυωτικούς οργανισμούς, για τους ευκαρυωτικούς υπάρχουν διαθέσιμες μόνο λίγες ακολουθίες ριβοσωμικών πρωτεϊνών. Από τα δεδομένα της πρωτοδιάταξης σε συνδυασμό

Διαβάστε περισσότερα

BIO111 Μικροβιολογια ιαλεξη 3. Κυτταρικη Χηµεια

BIO111 Μικροβιολογια ιαλεξη 3. Κυτταρικη Χηµεια BIO111 Μικροβιολογια ιαλεξη 3 Κυτταρικη Χηµεια Mικροβιολογία = Bιολογία των µονοκύτταρων οργανισµών και των ιών H µεγάλη σας φίλη Το βακτηριο E.coli 1.000.000X C Γλυκόζη trna αντισωµα ριβοσωµα ATP DNA

Διαβάστε περισσότερα

ΤΟ ΔΕΡΜΑ ΑΝΑΤΟΜΙΑ ΔΕΡΜΑΤΟΣ ΛΕΙΤΟΥΡΓΙΕΣ ΤΟΥ ΔΕΡΜΑΤΟΣ 09/11/2015

ΤΟ ΔΕΡΜΑ ΑΝΑΤΟΜΙΑ ΔΕΡΜΑΤΟΣ ΛΕΙΤΟΥΡΓΙΕΣ ΤΟΥ ΔΕΡΜΑΤΟΣ 09/11/2015 ΜΑΘΗΜΑ 1 ο ΤΟ ΔΕΡΜΑ ΕΙΝΑΙ ΤΟ ΜΕΓΑΛΥΤΕΡΟ ΣΕ ΕΚΤΑΣΗ ΟΡΓΑΝΟ ΤΟΥ ΑΝΘΡΩΠΙΝΟΥ ΣΩΜΑΤΟΣ, ΠΕΡΙΠΟΥ 1,8 Τ.Μ. ΕΙΝΑΙ ΜΙΑ ΕΛΑΣΤΙΚΗ, ΛΕΙΤΟΥΡΓΙΚΗ ΜΕΜΒΡΑΝΗ ΠΟΥ ΠΡΟΣΤΑΤΕΥΕΙ ΤΟΝ ΟΡΓΑΝΙΣΜΟ ΑΠΟ ΧΗΜΙΚΟΥΣ ΚΑΙ ΜΗΧΑΝΙΚΟΥΣ ΕΡΕΘΙΣΜΟΥΣ

Διαβάστε περισσότερα

1.Μαθησιακοί στόχοι του μαθήματος

1.Μαθησιακοί στόχοι του μαθήματος BIOXHMEIA, TOMOΣ I ΠANEΠIΣTHMIAKEΣ EKΔOΣEIΣ KPHTHΣ 1.Μαθησιακοί στόχοι του μαθήματος της ΒΙΟΧΗΜΕΙΑΣ (ΕΤΥ-232) 1)εξοικείωση των φοιτητών με τον μοριακό σχεδιασμό της ζωής 2)εμπέδωση της δομής και λειτουργίας

Διαβάστε περισσότερα

Αλληλεπιδράσεις θρεπτικών συστατικών των τροφίμων

Αλληλεπιδράσεις θρεπτικών συστατικών των τροφίμων Αλληλεπιδράσεις θρεπτικών συστατικών των τροφίμων Τα τρόφιμα είναι σύνθετοι συνδυασμοί που προέρχονται από πολλές πηγες. Όλα τα τρόφιμα έχουν τη δυνατότητα αλλεπίδρασης (χημικής) σε διαφορετικό βαθμό.

Διαβάστε περισσότερα

Έλεγχοι Αποτελεσματικότητας Υποστήριξη Ισχυρισμών Καλλυντικών Προϊόντων

Έλεγχοι Αποτελεσματικότητας Υποστήριξη Ισχυρισμών Καλλυντικών Προϊόντων Έλεγχοι Αποτελεσματικότητας Υποστήριξη Ισχυρισμών Καλλυντικών Προϊόντων Σοφία Χατζηαντωνίου Φαρμακοποιός, PhD Τομέας Φαρμακευτικής Τεχνολογίας Τμήμα Φαρμακευτικής, ΕΚΠΑ ΕΝΑΡΜΟΝΙΣΗ ΣΤΗΝ ΕΛΛΑΔΑ Υπουργική

Διαβάστε περισσότερα

ΔΟΜΗ ΚΑΙ ΛΕΙΤΟΥΡΓΙΑ ΠΛΑΣΜΑΤΙΚΗΣ ΜΕΜΒΡΑΝΗΣ. Πετρολιάγκης Σταμάτης Τμήμα Γ4

ΔΟΜΗ ΚΑΙ ΛΕΙΤΟΥΡΓΙΑ ΠΛΑΣΜΑΤΙΚΗΣ ΜΕΜΒΡΑΝΗΣ. Πετρολιάγκης Σταμάτης Τμήμα Γ4 ΔΟΜΗ ΚΑΙ ΛΕΙΤΟΥΡΓΙΑ ΠΛΑΣΜΑΤΙΚΗΣ ΜΕΜΒΡΑΝΗΣ Πετρολιάγκης Σταμάτης Τμήμα Γ4 ΕΝΝΟΙΑ ΤΗΣ ΠΛΑΣΜΑΤΙΚΗΣ ΜΕΜΒΡΑΝΗΣ Η κυτταρική μεμβράνη ή πλασματική μεμβράνη είναι η εξωτερική μεμβράνη που περιβάλλει το κύτταρο

Διαβάστε περισσότερα

ΕΡΓΑΣΤΗΡΙΑΚΟ ΚΕΝΤΡΟ ΦΥΣΙΚΩΝ ΕΠΙΣΤΗΜΩΝ Ν. ΜΑΓΝΗΣΙΑΣ ( Ε.Κ.Φ.Ε ) ΕΡΓΑΣΤΗΡΙΟ ΒΙΟΛΟΓΙΑΣ

ΕΡΓΑΣΤΗΡΙΑΚΟ ΚΕΝΤΡΟ ΦΥΣΙΚΩΝ ΕΠΙΣΤΗΜΩΝ Ν. ΜΑΓΝΗΣΙΑΣ ( Ε.Κ.Φ.Ε ) ΕΡΓΑΣΤΗΡΙΟ ΒΙΟΛΟΓΙΑΣ ΕΡΓΑΣΤΗΡΙΑΚΟ ΚΕΝΤΡΟ ΦΥΣΙΚΩΝ ΕΠΙΣΤΗΜΩΝ Ν. ΜΑΓΝΗΣΙΑΣ ( Ε.Κ.Φ.Ε ) ΕΡΓΑΣΤΗΡΙΟ ΒΙΟΛΟΓΙΑΣ Θέμα: ΑΠΟΜΟΝΩΣΗ ΝΟΥΚΛΕΪΚΩΝ ΟΞΕΩΝ (DNA ΚΑΙ RNA AΠΟ ΦΥΤΙΚΑ ΚΥΤΤΑΡΑ) Μέσος χρόνος πειράματος: 45 λεπτά Α. ΑΝΑΛΩΣΙΜΑ Εργαλεία

Διαβάστε περισσότερα

ηλεκτρονιακές Κατανοµή

ηλεκτρονιακές Κατανοµή ΧΗΜΕΙΑ Α ΛΥΚΕΙΟΥ ΧΗΜΙΚΟΙ ΕΣΜΟΙ 1. ίνεται ο πίκας: Σύµβολο Στοιχείου Να Ηλεκτρονιακή Κατανοµή X K (2) L(4) Ψ K (2) L(8) M(7) Ζ K (2) L(7) αντιγράψετε τον πίκα Οµάδα Π.Π. στη κόλλα Περίοδος Π.Π. σας τον

Διαβάστε περισσότερα

Χαρίλαος Μέγας Ελένη Φωτάκη Ελευθέριος Νεοφύτου

Χαρίλαος Μέγας Ελένη Φωτάκη Ελευθέριος Νεοφύτου Χαρίλαος Μέγας Ελένη Φωτάκη Ελευθέριος Νεοφύτου Απαντήσεις στις ερωτήσεις: Πρόλογος Το βιβλίο αυτό γράφτηκε για να βοηθήσει το μαθητή της Γ Γυμνασίου στην κατανόηση των θεμελιωδών γνώσεων της Βιολογίας

Διαβάστε περισσότερα

Γαλακτοκομία. Ενότητα 2: Πρωτεΐνες Ορού (WP), 1,5ΔΩ. Τμήμα: Επιστήμης Τροφίμων και Διατροφής Του Ανθρώπου. Διδάσκοντες: Καμιναρίδης Στέλιος, Καθηγητής

Γαλακτοκομία. Ενότητα 2: Πρωτεΐνες Ορού (WP), 1,5ΔΩ. Τμήμα: Επιστήμης Τροφίμων και Διατροφής Του Ανθρώπου. Διδάσκοντες: Καμιναρίδης Στέλιος, Καθηγητής Γαλακτοκομία Ενότητα 2: Πρωτεΐνες Ορού (WP), 1,5ΔΩ Τμήμα: Επιστήμης Τροφίμων και Διατροφής Του Ανθρώπου Διδάσκοντες: Καμιναρίδης Στέλιος, Καθηγητής Μοάτσου Γκόλφω, Eπ. Καθηγήτρια Μαθησιακοί Στόχοι Να γνωρίζουν

Διαβάστε περισσότερα

3 ο Κ Ε Φ Α Λ Α Ι Ο ΠΡΩΤΕΪΝΕΣ Α. ΕΡΩΤΗΣΕΙΣ ΚΛΕΙΣΤΟΥ ΤΥΠΟΥ

3 ο Κ Ε Φ Α Λ Α Ι Ο ΠΡΩΤΕΪΝΕΣ Α. ΕΡΩΤΗΣΕΙΣ ΚΛΕΙΣΤΟΥ ΤΥΠΟΥ 3 ο Κ Ε Φ Α Λ Α Ι Ο ΠΡΩΤΕΪΝΕΣ Α. ΕΡΩΤΗΣΕΙΣ ΚΛΕΙΣΤΟΥ ΤΥΠΟΥ Ερωτήσεις πολλαπλής επιλογής Να βάλετε σε κύκλο το γράµµα που αντιστοιχεί στη σωστή απάντηση ή στη φράση που συµπληρώνει σωστά την πρόταση. 1.

Διαβάστε περισσότερα

ΚΑΤΑΤΑΚΤΗΡΙΕΣ ΕΞΕΤΑΣΕΙΣ ΑΚΑΔΗΜΑΙΚΟΥ ΕΤΟΥΣ 2014-2015

ΚΑΤΑΤΑΚΤΗΡΙΕΣ ΕΞΕΤΑΣΕΙΣ ΑΚΑΔΗΜΑΙΚΟΥ ΕΤΟΥΣ 2014-2015 ΤΕΧΝΟΛΟΓΙΚΟ ΕΚΠΑΙΔΕΥΤΙΚΟ ΙΔΡΥΜΑ ΔΥΤΙΚΗΣ ΜΑΚΕΔΟΝΙΑΣ TECHNOLOGICAL EDUCATION INSTITUTION OF WESTERN MACEDONIA ΚΟΙΛΑ ΚΟΖΑΝΗΣ-GR 50100 I KILA, GR 50101 KOZANI-GREECE http://www.teiwm.gr ΣΧΟΛΗ ΤΕΧΝΟΛΟΓΙΑΣ ΓΕΩΠΟΝΙΑΣ

Διαβάστε περισσότερα

Κεφάλαιο 2. Copyright The McGraw-Hill Companies, Inc. 2011 Utopia Publishing, All rights reserved

Κεφάλαιο 2. Copyright The McGraw-Hill Companies, Inc. 2011 Utopia Publishing, All rights reserved Κεφάλαιο 2 1 Copyright The McGraw-Hill Companies, Inc. 2011 Utopia Publishing, All rights reserved ΟΡΓΑΝΙΚΗ ΜΟΡΙΑΚΗ ΔΟΜΗ ΤΩΝ ΖΩΝΤΑΝΩΝ ΟΡΓΑΝΙΣΜΩΝ «Οργανική» ένωση αναφέρεται σε ενώσεις του C Συμμετέχουν

Διαβάστε περισσότερα

1. Εισαγωγή στο Κύτταρο

1. Εισαγωγή στο Κύτταρο 1. Εισαγωγή στο Κύτταρο 1.1. Ορισμός του κυττάρου. Το κύτταρο είναι η δομική και λειτουργική μονάδα της ζωής (σχήμα 1). Το κύτταρο αποτελεί τη βάση της δομικής και λειτουργικής οργάνωσης ενός οργανισμού.

Διαβάστε περισσότερα

ΕΙΔΗ ΚΥΜΑΤΩΝ εγκάρσια διαμήκη

ΕΙΔΗ ΚΥΜΑΤΩΝ εγκάρσια διαμήκη ΕΙΔΗ ΚΥΜΑΤΩΝ Τα οδεύοντα κύματα στα οποία η διαταραχή της μεταβλητής ποσότητας (πίεση, στάθμη, πεδίο κλπ) συμβαίνει κάθετα προς την διεύθυνση διάδοσης του κύματος ονομάζονται εγκάρσια κύματα Αντίθετα,

Διαβάστε περισσότερα

ΑΠΑΝΤΗΣΕΙΣ. Για τις ερωτήσεις Α1 έως Α3 να γράψετε στο τετράδιό σας τον αριθμό της ερώτησης και δίπλα το γράμμα που αντιστοιχεί στη σωστή απάντηση.

ΑΠΑΝΤΗΣΕΙΣ. Για τις ερωτήσεις Α1 έως Α3 να γράψετε στο τετράδιό σας τον αριθμό της ερώτησης και δίπλα το γράμμα που αντιστοιχεί στη σωστή απάντηση. ΑΠΑΝΤΗΣΕΙΣ ΘΕΜΑ Α Για τις ερωτήσεις Α1 έως Α3 να γράψετε στο τετράδιό σας τον αριθμό της ερώτησης και δίπλα το γράμμα που αντιστοιχεί στη σωστή απάντηση. Α1. Το συζυγές οξύ της ΝΗ 3 είναι: α. ΝΗ 2 - β.νa

Διαβάστε περισσότερα

ΔΙΑΓΩΝΙΣΜΑ ΒΙΟΛΟΓΙΑΣ ΠΡΟΣΑΝΑΤΟΛΙΣΜΟΥ ΚΕΦΑΛΑΙΑ 1 ΚΑΙ 2

ΔΙΑΓΩΝΙΣΜΑ ΒΙΟΛΟΓΙΑΣ ΠΡΟΣΑΝΑΤΟΛΙΣΜΟΥ ΚΕΦΑΛΑΙΑ 1 ΚΑΙ 2 ΔΙΑΓΩΝΙΣΜΑ ΒΙΟΛΟΓΙΑΣ ΠΡΟΣΑΝΑΤΟΛΙΣΜΟΥ ΚΕΦΑΛΑΙΑ 1 ΚΑΙ 2 ΘΕΜΑ 1 ο Α. Στις ερωτήσεις 1-5 να γράψετε στο τετράδιό σας τον αριθμό της ερώτησης και δίπλα του το γράμμα που αντιστοιχεί στη σωστή απάντηση. 1. Το

Διαβάστε περισσότερα

Εξερευνώντας τα Βιομόρια Ένζυμα: Βασικές Αρχές και Κινητική

Εξερευνώντας τα Βιομόρια Ένζυμα: Βασικές Αρχές και Κινητική Εξερευνώντας τα Βιομόρια Ένζυμα: Βασικές Αρχές και Κινητική Βιοχημεία Βιομορίων Αθήνα 2015 Γενικές Ιδιότητες Ένζυμα : Βιολογικοί Καταλύτες Τα ένζυμα είναι πρωτεϊνικά μόρια Μικρή ομάδα καταλυτικών RNA H

Διαβάστε περισσότερα

ΘΕΜΑΤΑ ΒΙΟΛΟΓΙΑΣ ΓΕΝΙΚΗΣ ΠΑΙ ΕΙΑΣ Β ΛΥΚΕΙΟΥ ΑΠΟ ΤΟ ΒΙΒΛΙΟ ΜΟΥ (YΠΟ ΕΚ ΟΣΗ): ΒΙΟΛΟΓΙΑ ΓΕΝΙΚΗΣ ΠΑΙ ΕΙΑΣ Β ΛΥΚΕΙΟΥ

ΘΕΜΑΤΑ ΒΙΟΛΟΓΙΑΣ ΓΕΝΙΚΗΣ ΠΑΙ ΕΙΑΣ Β ΛΥΚΕΙΟΥ ΑΠΟ ΤΟ ΒΙΒΛΙΟ ΜΟΥ (YΠΟ ΕΚ ΟΣΗ): ΒΙΟΛΟΓΙΑ ΓΕΝΙΚΗΣ ΠΑΙ ΕΙΑΣ Β ΛΥΚΕΙΟΥ ΘΕΜΑΤΑ ΒΙΟΛΟΓΙΑΣ ΓΕΝΙΚΗΣ ΠΑΙ ΕΙΑΣ Β ΛΥΚΕΙΟΥ ΑΠΟ ΤΟ ΒΙΒΛΙΟ ΜΟΥ (YΠΟ ΕΚ ΟΣΗ): ΒΙΟΛΟΓΙΑ ΓΕΝΙΚΗΣ ΠΑΙ ΕΙΑΣ Β ΛΥΚΕΙΟΥ (Περιέχει 67 ερωτήσεις θεωρίας µε απαντήσεις, 116 ασκήσεις ανοικτού- κλειστού τύπου µε µ

Διαβάστε περισσότερα

Η ΑΝΑΠΑΡΑΓΩΓΗ ΚΑΙ Η ΑΝΑΠΤΥΞΗ ΤΩΝ ΖΩΩΝ. Αρχιτομία. Αγενής αναπαραγωγή. Παρατομία. Εκβλάστηση. Εγγενής αναπαραγωγή Διπλοφασικός κύκλος.

Η ΑΝΑΠΑΡΑΓΩΓΗ ΚΑΙ Η ΑΝΑΠΤΥΞΗ ΤΩΝ ΖΩΩΝ. Αρχιτομία. Αγενής αναπαραγωγή. Παρατομία. Εκβλάστηση. Εγγενής αναπαραγωγή Διπλοφασικός κύκλος. Η ΑΝΑΠΑΡΑΓΩΓΗ ΚΑΙ Η ΑΝΑΠΤΥΞΗ ΤΩΝ ΖΩΩΝ Αρχιτομία Αγενής αναπαραγωγή Παρατομία Εκβλάστηση Εγγενής αναπαραγωγή Απλοφασικός κύκλος Διπλοφασικός κύκλος Ισογαμία Ανισογαμία Ωογαμία Η ΑΝΑΠΑΡΑΓΩΓΗ ΚΑΙ Η ΑΝΑΠΤΥΞΗ

Διαβάστε περισσότερα

ΒΙΟΛΟΓΙΑ ΚΑΤΕΥΘΥΝΣΗΣ ΠΡΟΤΕΙΝΟΜΕΝΑ ΘΕΜΑΤΑ

ΒΙΟΛΟΓΙΑ ΚΑΤΕΥΘΥΝΣΗΣ ΠΡΟΤΕΙΝΟΜΕΝΑ ΘΕΜΑΤΑ ΒΙΟΛΟΓΙΑ ΚΑΤΕΥΘΥΝΣΗΣ ΠΡΟΤΕΙΝΟΜΕΝΑ ΘΕΜΑΤΑ ΘΕΜΑ Α Ο Ερωτήσεις πολλαπλής επιλογής: Α1 Στην αντιγραφή του DN το σπάσιμο των υδρογονικών δεσμών μεταξύ των δύο συμπληρωματικών αλυσίδων γίνεται με τη βοήθεια

Διαβάστε περισσότερα