ΜΕΘΟΔΟΛΟΓΙΑ ΑΣΚΗΣΕΩΝ ΣΤΟ 1 ο ΚΕΦΑΛΑΙΟ

Save this PDF as:
 WORD  PNG  TXT  JPG

Μέγεθος: px
Εμφάνιση ξεκινά από τη σελίδα:

Download "ΜΕΘΟΔΟΛΟΓΙΑ ΑΣΚΗΣΕΩΝ ΣΤΟ 1 ο ΚΕΦΑΛΑΙΟ"

Transcript

1 ΜΕΘΟΔΟΛΟΓΙΑ ΑΣΚΗΣΕΩΝ ΣΤΟ 1 ο ΚΕΦΑΛΑΙΟ Τα προβλήματα αυτού του κεφαλαίου αναφέρονται στον υπολογισμό : 1. νουκλεοτιδίων ή αζωτούχων βάσεων ή πεντοζών ή φωσφορικών ομάδων 2. φωσφοδιεστερικών δεσμών ή μορίων νερού 3. δεσμών υδρογόνου 4. πλήθος ή ποσοστό μιας αζωτούχου βάσης Για την επίλυση των προβλημάτων αυτών πρέπει να γνωρίζουμε αρχικά τι είναι το οξύ ( μονόκλωνο ή δίκλωνο, γραμμικό ή κυκλικό) 1. Νουκλεϊκό οξύ: DNA ή RNA (δίκλωνο ή μονόκλωνο, γραμμικό ή κυκλικό) 2. Μόριο DNA : δίκλωνο ή μονόκλωνο, γραμμικό ή κυκλικό 3. Ευκαρυωτικό DNA: δίκλωνο (γραμμικό, κυκλικό) 4. Μιτοχονδριακό DNA: δίκλωνο (κυκλικό ή γραμμικό, σε κατώτερα πρωτόζωα) 5. Βακτηριακό DNA : δίκλωνο (κυκλικό) 6. ιικό DNA : δίκλωνο ή μονόκλωνο, γραμμικό ή κυκλικό 7. Μόριο RNA : δίκλωνο ή μονόκλωνο, γραμμικό ή κυκλικό 8. Βακτηριακό ή ευκαρυωτικό RNA : μονόκλωνο γραμμικό 9. ιικό RNA: δίκλωνο ή μονόκλωνο, γραμμικό ή κυκλικό 10. τμήμα DNA ή RNA πάντα γραμμικό Όταν μας ζητούν να υπολογίσουμε νουκλεοτίδια ή πεντόζες ή αζωτούχες βάσεις ή φωσφορικές ομάδες 1. Εάν δίνονται (ν) αζωτούχες βάσεις τότε θα είναι (ν) και τα νουκλεοτίδια, οι πεντόζες, και οι φωσφορικές ομάδες 2. Εάν δίνονται (ν) ζεύγη αζωτούχων βάσεων ( άρα το οξύ δίκλωνο ) τα νουκλεοτίδια κ.λ.π θα είναι 2ν μονόκλωνο γραμμικό : (ν+1) τα νουκλεοτίδια κ.λ.π 3.Αν (ν) οι φωσφοδιεστερικοί δεσμοί κ.λ.π μονόκλωνο κυκλικό : (ν) τα νουκλεοτίδια κ.λ.π δίκλωνο γραμμικό : (ν+2) τα νουκλεοτίδια δίκλωνο κυκλικό : (ν) τα νουκλεοτίδια κ.λ.π Τα νουκλεοτίδια κλπ είναι πάντα ένα παραπάνω από τους φωσφοδιεστερικούς δεσμούς για κάθε αλυσίδα σε γραμμικό μόριο και ίσα με τους φδδ για κάθε αλυσίδα σε κυκλικό μόριο

2 Κατά τη δημιουργία ενός φωσφοδιεστερικού δεσμού αποσπάται κατά την αντίδραση συμπύκνωσης και ένα μόριο νερού. Αριθμός φ.δ=αριθμός μορίων νερού. Το ίδιο ισχύει και κατά την υδρόλυση των φωσφοδιεστερικών δεσμών Στο δίκλωνο DNA ισχύει A=T, G=C. 1. εάν A T ή (και) G C τότε DNA μονόκλωνο 2. εάν A U ή (και) G C τότε RNA μονόκλωνο 3. Σε δίκλωνο RNA ισχύει : A=U και G=C Μεταξύ Αδενίνης και θυμίνης αναπτύσσονται 2 δεσμοί υδρογόνου και μεταξύ Γουανίνης και Κυτοσίνης 3 δεσμοί υδρογόνου Το πλήθος των δεσμών Η υπολογίζεται από : 2 Α + 3 C= Αν ο λόγος A+T/C+G = Χ στη μία αλυσίδα, τότε είναι χ και στην συμπληρωματική της, αλλά και στο δίκλωνο μόριο. (Βλέπε άσκηση 19) Αν ο λόγος A+C/T+G = Χ στη μία αλυσίδα, τότε ο ίδιος λόγος είναι 1/χ στη συμπληρωματική της και 1 στο δίκλωνό μόριο. (Βλέπε άσκηση 20) Όταν μας δίνουν τα ποσοστά των αζωτούχων βάσεων σε κύτταρα διαφορετικών οργανισμών και μας ζητούν να βρούμε εάν οι οργανισμοί ανήκουν στο ίδιο είδος, παίρνουμε στο κάθε κύτταρο την αναλογία : A + T / G + C. Αν οι αναλογίες μας δώσουν ίδιο αποτέλεσμα, τότε τα κύτταρα ανήκουν στο ίδιο είδος. Αν ν ο αριθμός των νουκλεοτιδίων μιας πολυνουκλεοτιδικής αλυσίδας, τότε οι δυνατές άλληλουχίες που προκύπτουν είναι ν 4, αφού έχουμε 4 διαφορετικά μονομερή. Αν πρόκειται για δίκλωνο μόριο το οποίο αποτελείται από ν νουκλεοτίδια, τότε οι δυνατές αλληλουχίες είναι 4 ν/2 (Βλέπε άσκηση 21) Το νουκλεόσωμα αποτελείται από DNA μήκους 146 ζευγών βάσεων και 8 μόρια πρωτεϊνών Υπολογισμοί που αφορούν νουκλεοσώματα Νουκλεόσωμα είναι η βασική μονάδα δημιουργίας του ινιδίου χρωματίνης. Αποτελείται από: 8 μέρη πρωτεϊνών τυλιγμένες ολόγυρα με DNA μήκους 146 ζ. β. Συνήθως στις ασκήσεις ένα ινίδιο χρωματίνης αρχίζει και τελειώνει με νουκλεόσωμα και μεταξύ 2 συνεχόμενων νουκλεοσωμάτων υπάρχει DNA μήκους 54 ζευγών βάσεων. Νουκλεόσωμα Μεσοδιάστημα Άρα 146κ + 54(κ-1)= το μήκος του DNA σε ζεύγη βάσεων Σταθερότερο μόριο: Επειδή ανάμεσα σε G,C υπάρχουν τρεις δεσμοί υδρογόνου ενώ ανάμεσα σε A,T μόνο δύο μπορούμε να υποθέσουμε ότι σταθερότερο είναι το μόριο για το οποίο ισχύει: G+ C > A+T άρα Α+Τ/G+C<1

3 ΑΣΚΗΣΕΙΣ 1. Ένα μόριο DNA αποτελείται από 1000 νουκλεοτίδια. Πόσες πεντόζες περιέχονται σε κάθε πολυνουκλεοτιδική αλυσίδα; 2. Βακτηριακό DNA έχει 2000 φωσφοδιεστερικούς δεσμούς, Πόσα νουκλεοτίδια έχει; 3. Μόριο ευκαρυωτικού RNA έχει 800 νουκλεοτίδια. Με πόσους φωσφοδιεστερικούς δεσμούς συνδέονται αυτά τα νουκλεοτίδια; 4. Σε τμήμα ευκαρυωτικού DNA μετρήθηκαν 5500 νουκλεοτίδια. Από αυτά τα 1500 περιείχαν αδενίνη. Πόσους δεσμούς υδρογόνου περιέχει το μόριο αυτό. 5. Σε μιτοχονδριακό DNA υπολογίστηκαν 157 θυμίνες. Αν το σύνολο των αζωτούχων βάσεων σε αυτό το μόριο είναι 2500, πόσες είναι οι αδενίνες, γουανίνες και οι κυτοσίνες. 6. Να υπολογίσετε πόσα ζεύγη βάσεων και πόσες ιστόνες περιέχονται σε 20 νουκλεοσώματα. 7. Σε ένα τμήμα μιτοχοδριακού DNA υπολογίσαμε 1600 φωσφοδιεστερικούς δεσμούς. Πόσες αζωτούχες βάσεις θα έχει αυτό το DNA. 8. Σε ένα μόριο βακτηριακού DNA εντοπίστηκε η παρακάτω αλληλουχία αζωτούχων βάσεων : GAACTAGACTCGTAGCATACGCGATGACTACGTACGTGTCAAGTCAGTCAA να γράψετε τη συμπληρωματική αλυσίδα. 9. Στο DNA δύο διαφορετικών κυττάρων ανιχνεύτηκε το πλήθος τω αζωτούχων βάσεων, όπως δίνεται στον παρακάτω πίνακα. 1 ο κύτταρο 2 ο κύτταρο Αδενίνη θυμίνη Κυτοσίνη Γουανίνη Τα κύτταρα αυτά ανήκουν στον ίδιο οργανισμό ή σε διαφορετικά είδη οργανισμών; Να τεκμηριώσετε την απάντησή σας. 10. Ένα μόριο RNA που απομονώθηκε από ιό συνίσταται από 1250 αδενίνες και 890 γουανίνες. Να υπολογίσετε: α. Το πλήθος των αζωτούχων βάσεων του μορίου β. Τον αριθμό των φωσφοδιεστερικών δεσμών που συνδέουν τα ριβονουκλεοτίδια 11. Σε μιτοχονδριακό DNA με 1,6 χ 10 8 φωσφοδιεστερικούς δεσμούς απομονώθηκαν 4χ 10 7 θυμίνες. Να υπολογίσετε : α. Από πόσα νουκλεοτίδια συνίσταται αυτό το DNA β. Πόσοι δεσμοί υδρογόνου σταθεροποιούν τη δευτεροταγή δομή του μορίου αυτού. 12. Ένα μόριο DNA έχει μήκος nm. Αν σε κάθε βήμα (στροφή της διπλής έλικας του DNA) υπάρχουν 10 ζεύγη νουκλεοτιδίων με μήκος 3,4 nm : α. Να βρείτε τον αριθμό των νουκλεοτιδίων του παραπάνω μορίου. β. Αν το 15% των νουκλεοτιδίων έχουν Α, ποιος είναι ο αριθμός των δεσμών υδρογόνου που σχηματίζονται στο μόριο αυτό.

4 13. Αν ο λόγος Α+Τ/C+G σ ένα μόριο DNA είναι 3/4 και το σύνολο των δεσμών υδρογόνου Ένα μόριο DNA έχει μήκος nm. Αν σε κάθε βήμα (στροφή της διπλής έλικας του DNA) υπάρχουν 10 ζεύγη νουκλεοτιδίων με μήκος 3,4 nm : 14. Ένα τμήμα DNA έχει 10 φωσφοδιεστερικούς δεσμούς και 15 δεσμούς υδρογόνου. Πόσες A, T, G και C περιέχει 15. Ποιο είναι το μέσο μήκος, σε ζεύγη αζωτούχων βάσεων ενός χρωμοσώματος στο γαμέτη του ανθρώπου. 16. Σε ένα μόριο DNA ευκαρυωτικού κυττάρου υπάρχουν φωσφοδιεστερικοί δεσμοί και δεσμοί υδρογόνου. Ποιος είναι ο αριθμός των νουκλεοτιδίων με κάθε μία αζωτούχα βάση; 17. Σε ένα μόριο DNA ευκαρυωτικού κυττάρου υπάρχουν φωσφοδιεστερικοί δεσμοί και δεσμοί υδρογόνου. Ποιος είναι ο αριθμός των νουκλεοτιδίων με κάθε μία αζωτούχα βάση; 18. Ένα ινίδιο χρωματίνης στη αρχή της μεσόφασης του κυττάρου έχει 400 νουκλεοσώματα. Να βρείτε : α. πόσα νουκλεοσώματα β. πόσες αζωτούχες βάσεις και γ. πόσα μόρια ιστονών θα υπάρχουν μετά την αντιγραφή το στη μεσόφαση. 19. Σε ένα μόριο DNA ο λόγος A+T/C+G στη μια αλυσίδα είναι 6/15. Ποιος είναι ο ίδιος λόγος στη συμπληρωματική της αλυσίδα και ποιος στο δίκλωνο μόριο του DNA; Σε ένα μόριο DNA ο λόγος A+G/T+C στη μία αλυσίδα είναι 9/10. Ποιος είναι ο ίδιος λόγος στη συμπληρωματική της αλυσίδας και ποιος στο δίκλωνο μόριο του DNA; Σε ένα δίκλωνο μόριο DNA βρέθηκε ότι περιέχει 21% αδενίνη. Ποιο είναι το ποσοστό των υπόλοιπων βάσεων στο μόριο του DNA; Πόσοι δεσμοί υδρογόνου αναπτύσσονται στο δίκλωνο μόριο του DNA, αν αυτό αποτελείται από 700 νουκλεοτίδια; Ποιος είναι ο μέγιστος αριθμός διαφορετικών πολυνουκλεοτιδικών αλυσίδων που είναι δυνατόν (θεωρητικά) να προκύψουν από τον συνδυασμό του αριθμού των νουκλεοτιδίων της μιας αλυσίδας του παραπάνω μορίου DNA; Πόσα χρωμοσώματα, πόσα μόρια DNA, πόσες χρωματίδες, πόσα νουκλεοσώματα και πόσες ιστόνες υπάρχουν στο γονιδίωμα σωματικού κυττάρου ανθρώπινου οργανισμού που ωρίσκεται στη μετάφαση; (Δεχθείτε ότι μεταξύ των νουκλεοσωμάτων δεν παρεμβάλλονται άλλα νουκλεοτίδια) Β 23. Ένα νουκλεϊκό οξύ αποτελείται από 200 νουκλεοτίδια. Πόσα μόρια νερού παράγονται κατά τη σύνθεσή του;

5 24. Σε ένα φοιτητή δόθηκαν δύο σωματικά κύτταρα διαφορετικών οργανισμών, τα οποία ήταν στη φάση της μετάφασης. Από ανάλυση που έκανε βρήκε ότι στο κύτταρο I τα μόρια DNA ήταν 42, ενώ στο κύτταρο II ήταν 32. Γνωρίζοντας ότι τα κύτταρα προέρχονται το ένα από διπλοειδή οργανισμό και το άλλο από απλοειδή, να βρείτε ποιο κύτταρο ανήκει στον απλοειδή και ποιο στον διπλοειδή οργανισμό. 25. Κατά τη χημική ανάλυση του γενετικού υλικού από διαφόρους οργανισμούς καταγράφηκαν σχετικά με το πλήθος των αζωτούχων βάσεων και των φωσφοδιεστερικών δεσμών οι τιμές που αναφέρονται στον παρακάτω πίνακα ΔΕΙΓΜΑΤΑ ΤΟΥ ΓΕΝΕΤΙΚΟΥ ΥΛΙΚΟΥ 1ο 2ο 3ο 4ο ΑΔΕΝΙΝΗ ΓΟΥΑΝΙΝΗ ΘΥΜΙΝΗ ΚΥΤΟΣΙΝΗ ΦΩΣΦΟΔΙΕΣΤΕΡΙΚΟΙ ΔΕΣΜΟΙ Από πού μπορούν να προέρχονται τα παραπάνω δείγματα; Κατά την άποψή σας, σε ποιο από τα δείγματα αυτά το γενετικό υλικό είναι σταθερότερο και γιατί; Κατά την εξέταση του πυρηνικού γενετικού υλικού από διάφορα ανθρώπινα κύτταρα έγιναν οι εξής παρατηρήσεις: Στο 1 ο κύτταρο: Εντοπίστηκαν 44 χρωμοσώματα καθένα από τα οποία ήταν μορφολογικά ίδιο με κάποιο άλλο και 2 ακόμη που διέφεραν αρκετά σε μήκος μεταξύ τους. Όλα διαπιστώθηκε πως βρίσκονταν στη μεγαλύτερη δυνατή συσπείρωση. Στο 2 ο κύτταρο: Εντοπίστηκαν 46 χρωμοσώματα καθένα από τα οποία ήταν μορφολογικά ίδιο με κάποιο άλλο. Όλα διαπιστώθηκε πως βρίσκονταν στη μεγαλύτερη δυνατή συσπείρωση. Στο 3 ο κύτταρο: Εντοπίστηκαν 92 ινίδια χρωματίνης συνδεμένα ανά δύο σε ζεύγος, με κανονική συσπείρωση και κάθε ζεύγος μορφολογικά ίδιο με κάποιο άλλο. Στο 4 ο κύτταρο: Εντοπίστηκαν 44 χρωμοσώματα καθένα από τα οποία ήταν μορφολογικά ίδιο με κάποιο άλλο και ένα επιπλέον χωρίς όμοιό του. Όλα διαπιστώθηκε πως βρίσκονταν στη μεγαλύτερη δυνατή συσπείρωση. Στο 5 ο κύτταρο: Εντοπίστηκαν 23 ινίδια χρωματίνης ανόμοια μεταξύ τους. α) Με βάση τις παραπάνω παρατηρήσεις να διατυπώσετε την άποψής σας, για το είδος (σωματικά ή γαμετικά) και την κατάσταση (φάση του κυτταρικού κύκλου κατά την οποία απομονώθηκαν) των κυττάρων αυτών. β) Τι είδους μικροσκόπιο μπορεί να χρειάστηκε για την πραγματοποίηση των σχετικών παρατηρήσεων; Απομονώθηκε το γενετικό υλικό από τους μεταφασικούς πυρήνες δύο κυττάρων και εντοπίστηκαν, στο πρώτο πυρήνα 84 αλυσίδες DNA,στο δεύτερο 84 μόρια DNA.

6 Με δεδομένο ότι το ένα κύτταρο είναι φυσιολογικό και το άλλο μεταλλαγμένο, να βρείτε ποιο από τα δύο κύτταρα είναι το μεταλλαγμένο και ν αιτιολογήσετε την απάντησή σας Κατά την εξέταση του γενετικού υλικού από διάφορα κύτταρα της μύγας δροσόφιλα παρατηρήθηκαν: 1 ο κύτταρο: 8 χρωμοσώματα που ήταν το καθένα όμοιο με κάποιο άλλο. 2 ο κύτταρο: 6 χρωμοσώματα που ήταν το καθένα όμοιο με κάποιο άλλο και 2 ακόμη που ήταν διαφορετικά σε μήκος. 3 ο κύτταρο: 16 ινίδια χρωματίνης, ενώ το κύτταρο βρισκόταν στη μετάφαση. 4 ο κύτταρο: 6 χρωμοσώματα που ήταν το καθένα όμοιο με κάποιο άλλο, και ένα επιπλέον για το οποίο δεν υπήρχε όμοιο. Ποιο είναι τα είδος των κυττάρων σε κάθε μια από τις παραπάνω περιπτώσεις η μύγα δροσόφιλα είναι διπλοειδής οργανισμός με 2n=8

Κατάταξη Αδενίνη 1 Γονίδιο 4 Νουκλεοτίδιο 2 Νουκλεόσωμα 3 Βραχίονας 5 Χρωματίδα 6 Γονιδίωμα 8 Καρυότυπος 9 Μεταφασικό χρωμόσωμα 7

Κατάταξη Αδενίνη 1 Γονίδιο 4 Νουκλεοτίδιο 2 Νουκλεόσωμα 3 Βραχίονας 5 Χρωματίδα 6 Γονιδίωμα 8 Καρυότυπος 9 Μεταφασικό χρωμόσωμα 7 Α1. 1. δ 2. α 3. δ 4. γ 5. γ Βιολογία ΘΕΜΑ A κατεύθυνσης Α2. Κατάταξη Αδενίνη 1 Γονίδιο 4 Νουκλεοτίδιο 2 Νουκλεόσωμα 3 Βραχίονας 5 Χρωματίδα 6 Γονιδίωμα 8 Καρυότυπος 9 Μεταφασικό χρωμόσωμα 7 ΘΕΜΑ Β 1.

Διαβάστε περισσότερα

ΚΕΦΑΛΑΙΟ 1. Μ.ΒΡΑΧΝΟΥΛΑ Σελίδα 1

ΚΕΦΑΛΑΙΟ 1. Μ.ΒΡΑΧΝΟΥΛΑ Σελίδα 1 ΚΕΦΑΛΑΙΟ 1 Μ.ΒΡΑΧΝΟΥΛΑ Σελίδα 1 ΑΣΚΗΣΕΙΣ 1. Σε ένα δίκλωνο µόριο DNA ο λόγος Α / C είναι 1/ 4. Το μήκος του είναι 20.000 ζεύγη βάσεων. Ποια η εκατοστιαία σύσταση και ποιος ο αριθµός των νουκλεοτιδίων που

Διαβάστε περισσότερα

Κεφάλαιο 1 ο Το γενετικό υλικό Μεθοδολογία Ασκήσεων

Κεφάλαιο 1 ο Το γενετικό υλικό Μεθοδολογία Ασκήσεων Κεφάλαιο 1 ο Το γενετικό υλικό Μεθοδολογία Ασκήσεων 1. Ένα μόριο νουκλεϊκού οξέος για να χαρακτηρισθεί πλήρως θα πρέπει να γνωρίζουμε αν είναι: i. DNA ή RNA ii. iii. Μονόκλωνο ή δίκλωνο Γραμμικό ή κυκλικό

Διαβάστε περισσότερα

Ασκήσεις. 1 ο Κεφάλαιο: Το Γενετικό Υλικό

Ασκήσεις. 1 ο Κεφάλαιο: Το Γενετικό Υλικό Ασκήσεις 1. Αν ο λόγος A + Τ / C + G στη μια αλυσίδα του DNA είναι 7/10, πόσος είναι ο ίδιος λόγος: α. στη συμπληρωματική της αλυσίδα, β. στο μόριο; 2. Αν ο λόγος A + G / T + C στη μια αλυσίδα του DNA

Διαβάστε περισσότερα

ΔΙΑΦΟΡΕΣ ΑΣΚΗΣΕΙΣ ΣΤΟ 1 ΚΕΦΑΛΑΙΟ

ΔΙΑΦΟΡΕΣ ΑΣΚΗΣΕΙΣ ΣΤΟ 1 ΚΕΦΑΛΑΙΟ 1 ΔΙΑΦΟΡΕΣ ΑΣΚΗΣΕΙΣ ΣΤΟ 1 ΚΕΦΑΛΑΙΟ Το μόριο DNA μιας χρωματίδας μεταφασικού χωμοσώματος ενός φυσιολογικού ευκαρυωτικού κυττάρου περιέχει το 29% των νουκλεoτιδίων του με αζωτούχα βάση την T. a. Ποιο είναι

Διαβάστε περισσότερα

ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ

ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ ΠΕΙΡΑΜΑΤΙΚΟ ΛΥΚΕΙΟ ΠΑΝ/ΜΙΟΥ ΜΑΚΕΔΟΝΙΑΣ ΖΑΡΦΤΖΙΑΝ ΜΑΡΙΛΕΝΑ ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ ΑΣΚΗΣΕΙΣ ΣΤΟ 1 ο ΚΕΦΑΛΑΙΟ ΠΕΙΡΑΜΑΤΑ 1. Σε ένα πείραμα παρόμοιο με αυτό που διεξήγαγε ο Griffith, αφού θανατώσατε με

Διαβάστε περισσότερα

ΘΕΜΑΤΑ ΒΙΟΛΟΓΙΑΣ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ ΑΠΟ ΤΟ ΒΙΒΛΙΟ ΜΟΥ (YΠΟ ( ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ

ΘΕΜΑΤΑ ΒΙΟΛΟΓΙΑΣ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ ΑΠΟ ΤΟ ΒΙΒΛΙΟ ΜΟΥ (YΠΟ ( ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ ΘΕΜΑΤΑ ΒΙΟΛΟΓΙΑΣ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ ΑΠΟ ΤΟ ΒΙΒΛΙΟ ΜΟΥ (YΠΟ ( ΣΥΓΓΡΑΦΗ): ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ (Θα περιέχει ερωτήσεις θεωρίας µε απαντήσεις, ασκήσεις ανοικτούκλειστού τύπου µε

Διαβάστε περισσότερα

ΑΠΑΝΤΗΣΕΙΣ ΒΙΟΛΟΓΙΑΣ ΚΑΤΕΥΘΥΝΣΗΣ ΔΙΑΓΩΝΙΣΜΑ ΣΤΟ 1 ο ΚΕΦΑΛΑΙΟ 12-9-2015

ΑΠΑΝΤΗΣΕΙΣ ΒΙΟΛΟΓΙΑΣ ΚΑΤΕΥΘΥΝΣΗΣ ΔΙΑΓΩΝΙΣΜΑ ΣΤΟ 1 ο ΚΕΦΑΛΑΙΟ 12-9-2015 ΑΠΑΝΤΗΣΕΙΣ ΒΙΟΛΟΓΙΑΣ ΚΑΤΕΥΘΥΝΣΗΣ ΔΙΑΓΩΝΙΣΜΑ ΣΤΟ 1 ο ΚΕΦΑΛΑΙΟ 12-9-2015 ΘΕΜΑ Α Α1. α. in vitro β. in vivo γ. in vitro δ. in vitro Α2. γ Μεταξύ των δύο δεοξυριβονουκλεοτιδίων έχουμε συμπληρωματικότητα (Α=Τ)

Διαβάστε περισσότερα

Βιολογία Γ Γενικού Λυκείου Θετικής κατεύθυνσης. Κεφάλαιο 1α Το Γενετικό Υλικό

Βιολογία Γ Γενικού Λυκείου Θετικής κατεύθυνσης. Κεφάλαιο 1α Το Γενετικό Υλικό Βιολογία Γ Γενικού Λυκείου Θετικής κατεύθυνσης Κεφάλαιο 1α Το Γενετικό Υλικό Το DNA είναι το γενετικό υλικό Αρχικά οι επιστήμονες θεωρούσαν ότι οι πρωτεΐνες αποτελούσαν το γενετικό υλικό των οργανισμών.

Διαβάστε περισσότερα

ΚΕΦΑΛΑΙΟ 1 ο... 2 I. Το γενετικό υλικό... 2 ΕΡΩΤΗΣΕΙΣ ΠΟΛΛΑΠΛΗΣ ΕΠΙΛΟΓΗΣ... 5 ΝΑ ΣΥΜΠΛΗΡΩΣΕΤΕ ΤΑ ΚΕΝΑ ΜΕ ΤΗΝ ΚΑΤΑΛΛΗΛΗ ΛΕΞΗ... 8 ΠΡΟΒΛΗΜΑΤΑ...

ΚΕΦΑΛΑΙΟ 1 ο... 2 I. Το γενετικό υλικό... 2 ΕΡΩΤΗΣΕΙΣ ΠΟΛΛΑΠΛΗΣ ΕΠΙΛΟΓΗΣ... 5 ΝΑ ΣΥΜΠΛΗΡΩΣΕΤΕ ΤΑ ΚΕΝΑ ΜΕ ΤΗΝ ΚΑΤΑΛΛΗΛΗ ΛΕΞΗ... 8 ΠΡΟΒΛΗΜΑΤΑ... ΚΕΦΑΛΑΙΟ 1 ο ΚΕΦΑΛΑΙΟ 1 ο... 2 I. Το γενετικό υλικό... 2 ΕΡΩΤΗΣΕΙΣ ΠΟΛΛΑΠΛΗΣ ΕΠΙΛΟΓΗΣ... 5 ΝΑ ΣΥΜΠΛΗΡΩΣΕΤΕ ΤΑ ΚΕΝΑ ΜΕ ΤΗΝ ΚΑΤΑΛΛΗΛΗ ΛΕΞΗ.... 8 ΠΡΟΒΛΗΜΑΤΑ... 9 ΙΑΓΩΝΙΣΜΑ...12 ΚΕΦΑΛΑΙΟ 1 ο I. Το γενετικό

Διαβάστε περισσότερα

Ασκήσεις για το Κεφάλαιο 1: Το γενετικό υλικό

Ασκήσεις για το Κεφάλαιο 1: Το γενετικό υλικό Ασκήσεις για το Κεφάλαιο 1: Το γενετικό υλικό A) Ερωτήσεις με πολλές πιθανές απαντήσεις Να βάλετε σε κύκλο το γράμμα ή τα γράμματα που αντιστοιχούν στη σωστή φράση ή στη φράση που συμπληρώνει σωστά την

Διαβάστε περισσότερα

Θέματα Πανελλαδικών 2000-2013

Θέματα Πανελλαδικών 2000-2013 Θέματα Πανελλαδικών 2000-2013 ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΗΜΕΡΗΣΙΩΝ ΛΥΚΕΙΩΝ ΕΣΠΕΡΙΝΩΝ ΛΥΚΕΙΩΝ ΕΠΑΝΑΛΗΠΤΙΚΕΣ Κεφάλαιο 1 ΚΕΦΑΛΑΙΟ 1 ΘΕΜΑ 1 ο Γράψτε τον αριθμό καθεμιάς από τις παρακάτω προτάσεις και δίπλα το γράμμα

Διαβάστε περισσότερα

ΙΑΓΩΝΙΣΜΑ ΒΙΟΛΟΓΙΑΣ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ

ΙΑΓΩΝΙΣΜΑ ΒΙΟΛΟΓΙΑΣ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ ΙΑΓΩΝΙΣΜΑ ΒΙΟΛΟΓΙΑΣ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ ΚΕΦΑΛΑΙΟ 1: Το γενετικό υλικό ΘΕΜΑ: 1 ο (Μονάδες 25 ) Να επιλέξετε τη σωστή απάντηση στις παρακάτω ερωτήσεις. 1. Το πείραµα των Hershey και Chase ήταν:

Διαβάστε περισσότερα

Φ Ρ Ο Ν Τ Ι Σ Τ Η Ρ Ι Α ΘΕΩΡΗΤΙΚΗ ΘΕΤΙΚΗ ΤΕΧΝΟΛΟΓΙΚΗ ΚΑΤΕΥΘΥΝΣΗ ΕΠΑ.Λ

Φ Ρ Ο Ν Τ Ι Σ Τ Η Ρ Ι Α ΘΕΩΡΗΤΙΚΗ ΘΕΤΙΚΗ ΤΕΧΝΟΛΟΓΙΚΗ ΚΑΤΕΥΘΥΝΣΗ ΕΠΑ.Λ Βιολογία ΘΕΜΑ Α κατεύθυνσης 1. δ 2. α 3. γ 4. δ 5. γ 6. α 7. δ 8. α 9. α 10. α ΘΕΜΑ Β Β1. Η ραδιενέργεια 32 Ρ θα βρίσκεται στο κλάσμα Β, δηλαδή στο κλάσμα εκείνο που περιλαμβάνει τα βακτήρια που έχουν

Διαβάστε περισσότερα

Θέματα Πανελλαδικών

Θέματα Πανελλαδικών Θέματα Πανελλαδικών 2000-2015 ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΗΜΕΡΗΣΙΩΝ ΛΥΚΕΙΩΝ ΕΣΠΕΡΙΝΩΝ ΛΥΚΕΙΩΝ ΕΠΑΝΑΛΗΠΤΙΚΕΣ ΟΜΟΓΕΝΩΝ Κεφάλαιο 1 Περιεχόμενα Περιεχόμενα 1 Κεφάλαιο 1 ο Το γενετικό υλικό Θέμα 1 ο 2 Θέμα 2 ο 8 Θέμα

Διαβάστε περισσότερα

(αδρές αποικίες) Θέρμανση (λείες αποικίες) ζωντανά ποντίκια ζωντανά ποντίκια νεκρά ποντίκια

(αδρές αποικίες) Θέρμανση (λείες αποικίες) ζωντανά ποντίκια ζωντανά ποντίκια νεκρά ποντίκια Το DNA είναι το γενετικό υλικό 1. Πείραμα Griffith (1928) Βακτήριο πνευμονιόκοκκου (Diplococcus pneumoniae) Χωρίς κάλυμμα Με κάλυμμα (αδρές αποικίες) Θέρμανση (λείες αποικίες) ζωντανά ποντίκια ζωντανά

Διαβάστε περισσότερα

ΒΙΟΛΟΓΙΑ - Γ Λ ΚΑΤΕΥΘΥΝΣΗ. ΑΣΚΗΣΕΙΣ ΒΙΟΛΟΓΙΑΣ - Γ Λ ΚΑΤΕΥΘΥΝΣΗ (ανάκληση γνώσεων από Β Λ)

ΒΙΟΛΟΓΙΑ - Γ Λ ΚΑΤΕΥΘΥΝΣΗ. ΑΣΚΗΣΕΙΣ ΒΙΟΛΟΓΙΑΣ - Γ Λ ΚΑΤΕΥΘΥΝΣΗ (ανάκληση γνώσεων από Β Λ) 1 ΒΙΟΛΟΓΙΑ - Γ Λ ΚΑΤΕΥΘΥΝΣΗ ΑΣΚΗΣΕΙΣ ΒΙΟΛΟΓΙΑΣ - Γ Λ ΚΑΤΕΥΘΥΝΣΗ (ανάκληση γνώσεων από Β Λ) 1. Κατά τον σχηματισμό ενός μορίου RNA αποβάλλονται 2008 μόρια νερού. Να βρεθεί το μήκος του. [2009b (βάσεις)]

Διαβάστε περισσότερα

ΤΕΣΤ ΒΙΟΛΟΓΙΑΣ Γ ΛΥΚΕΙΟΥ ΘΕΤΙΚΗ ΚΑΤΕΥΘΥΝΣΗ. ΘΕΜΑ 1 Ο Απαντήστε στις παρακάτω ερωτήσεις πολλαπλής επιλογής.

ΤΕΣΤ ΒΙΟΛΟΓΙΑΣ Γ ΛΥΚΕΙΟΥ ΘΕΤΙΚΗ ΚΑΤΕΥΘΥΝΣΗ. ΘΕΜΑ 1 Ο Απαντήστε στις παρακάτω ερωτήσεις πολλαπλής επιλογής. 1 ΤΕΣΤ ΒΙΟΛΟΓΙΑΣ Γ ΛΥΚΕΙΟΥ ΘΕΤΙΚΗ ΚΑΤΕΥΘΥΝΣΗ ΘΕΜΑ 1 Ο Απαντήστε στις παρακάτω ερωτήσεις πολλαπλής επιλογής. 1. Γραμμικό μόριο DNA θα βρούμε: Α. Σε πλασμίδια Β. Στο κύριο μόριο DNA του βακτηρίου. Γ. Σε

Διαβάστε περισσότερα

Βιολογία Θετικής Κατεύθυνσης. Κεφάλαιο 1 ο -Το γενετικό υλικό

Βιολογία Θετικής Κατεύθυνσης. Κεφάλαιο 1 ο -Το γενετικό υλικό Βιολογία Θετικής Κατεύθυνσης Κεφάλαιο 1 ο -Το γενετικό υλικό Το γενετικό υλικό Ιστορική αναδρομή 1869: Το DNA εντοπίζεται στον πυρήνα των κυττάρων 1944: Μέχρι τότε δεν ήταν γνωστό ότι αποτελεί το γενετικό

Διαβάστε περισσότερα

Η ζητούμενη σειρά έχει ως εξής: αδενίνη < νουκλεοτίδιο < νουκλεόσωμα < γονίδιο < χρωματίδα < χρωμόσωμα < γονιδίωμα.

Η ζητούμενη σειρά έχει ως εξής: αδενίνη < νουκλεοτίδιο < νουκλεόσωμα < γονίδιο < χρωματίδα < χρωμόσωμα < γονιδίωμα. ΚΕΦ. 1 ο ΕΡΩΤΗΣΕΙΣ ΚΡΙΣΕΩΣ 1. Να κατατάξετε σε σειρά αυξανόμενου μεγέθους τις παρακάτω έννοιες που σχετίζονται με το γενετικό υλικό των οργανισμών: νουκλεόσωμα, χρωμόσωμα, αδενίνη, νουκλεοτίδιο, γονίδιο

Διαβάστε περισσότερα

Βιολογία Κατεύθυνσης Γ Λυκείου

Βιολογία Κατεύθυνσης Γ Λυκείου Βιολογία Κατεύθυνσης Γ Λυκείου 2013-2014 ΓΕ.Λ. ΣΟΡΩΝΗΣ ΜΑΣΤΗ ΧΡΙΣΤΙΝΑ Κεφάλαιο 1 ΤΟ ΓΕΝΕΤΙΚΟ ΥΛΙΚΟ Ταξίδι στο χρόνο 1869 Απομονώνεται DNA από τον κυτταρικό πυρήνα 1903 Αποδεικνύεται ότι τα χρωμοσώματα

Διαβάστε περισσότερα

θετικής κατεύθυνσης Παραδόσεις του μαθήματος Επιμέλεια: ΑΡΓΥΡΗΣ ΓΙΑΝΝΗΣ

θετικής κατεύθυνσης Παραδόσεις του μαθήματος Επιμέλεια: ΑΡΓΥΡΗΣ ΓΙΑΝΝΗΣ Βιολογία θετικής κατεύθυνσης Παραδόσεις του μαθήματος Επιμέλεια: ΑΡΓΥΡΗΣ ΓΙΑΝΝΗΣ 1ο κεφάλαιο Το γενετικό υλικό Τι αποτελεί το γενετικό υλικό; Από το 1869, που το DNA εντοπίστηκε στον πυρήνα των κυττάρων,

Διαβάστε περισσότερα

Να επιλέξετε την φράση που συμπληρώνει ορθά κάθε μία από τις ακόλουθες προτάσεις:

Να επιλέξετε την φράση που συμπληρώνει ορθά κάθε μία από τις ακόλουθες προτάσεις: ΜΑΘΗΜΑ / ΤΑΞΗ : ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ ΗΜΕΡΟΜΗΝΙΑ: 2/12/2016 ΕΠΙΜΕΛΕΙΑ ΔΙΑΓΩΝΙΣΜΑΤΟΣ: ΛΑΖΑΡΑΚΗ ΝΟΤΑ ΑΠΑΝΤΗΣΕΙΣ ΘΕΜΑ Α Να επιλέξετε την φράση που συμπληρώνει ορθά κάθε μία από τις ακόλουθες

Διαβάστε περισσότερα

ΑΠΑΝΤΗΣΕΙΣ ΣΤΟ 1 ο ΔΙΑΓΩΝΙΣΜΑ ΒΙΟΛΟΓΙΑΣ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ

ΑΠΑΝΤΗΣΕΙΣ ΣΤΟ 1 ο ΔΙΑΓΩΝΙΣΜΑ ΒΙΟΛΟΓΙΑΣ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ ΑΠΑΝΤΗΣΕΙΣ ΣΤΟ 1 ο ΔΙΑΓΩΝΙΣΜΑ ΒΙΟΛΟΓΙΑΣ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ ΘΕΜΑ 1 ο Α. Ερωτήσεις πολλαπλής επιλογής 1. δ 2. β 3. γ 4. γ 5. β Β. Ερωτήσεις σωστού λάθους 1. Λάθος 2. Σωστό 3. Λάθος 4. Λάθος 5. Σωστό ΘΕΜΑ

Διαβάστε περισσότερα

ΑΠΑΝΤΗΣΕΙΣ. Να επιλέξετε την φράση που συμπληρώνει ορθά κάθε μία από τις ακόλουθες προτάσεις:

ΑΠΑΝΤΗΣΕΙΣ. Να επιλέξετε την φράση που συμπληρώνει ορθά κάθε μία από τις ακόλουθες προτάσεις: ΜΑΘΗΜΑ / ΤΑΞΗ : ΑΠΑΝΤΗΣΕΙΣ ΒΙΟΛΟΓΙΑΣ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ / Γ ΛΥΚΕΙΟΥ ΗΜΕΡΟΜΗΝΙΑ: 21/09/2015 ΕΠΙΜΕΛΕΙΑ: ΝΟΤΑ ΛΑΖΑΡΑΚΗ ΘΕΜΑ 1 Ο ΑΠΑΝΤΗΣΕΙΣ Να επιλέξετε την φράση που συμπληρώνει ορθά κάθε μία από τις ακόλουθες

Διαβάστε περισσότερα

Βιομόρια: Τα μόρια που βρίσκονται στα κύτταρα των οργανισμών και αποτελούν απαραίτητο συστατικό αυτών.

Βιομόρια: Τα μόρια που βρίσκονται στα κύτταρα των οργανισμών και αποτελούν απαραίτητο συστατικό αυτών. Κεφάλαιο 1: ΤΟ ΓΕΝΕΤΙΚΟ ΥΛΙΚΟ Βιομόρια: Τα μόρια που βρίσκονται στα κύτταρα των οργανισμών και αποτελούν απαραίτητο συστατικό αυτών. Βιολογικά μακρομόρια ( ή πολυμερή ): Κατηγορία βιομορίων με μεγάλο ΜΒ

Διαβάστε περισσότερα

ΘΕΜΑΤΑ ΠΑΝΕΛΛΗΝΙΩΝ ΕΞΕΤΑΣΕΩΝ ΣΤΟ 1 Ο ΚΕΦΑΛΑΙΟ (ΓΕΝΕΤΙΚΟ ΥΛΙΚΟ) 2000 ΗΜΕΡΗΣΙΟ 3. Στα προκαρυωτικά κύτταρα το γενετικό υλικό είναι:

ΘΕΜΑΤΑ ΠΑΝΕΛΛΗΝΙΩΝ ΕΞΕΤΑΣΕΩΝ ΣΤΟ 1 Ο ΚΕΦΑΛΑΙΟ (ΓΕΝΕΤΙΚΟ ΥΛΙΚΟ) 2000 ΗΜΕΡΗΣΙΟ 3. Στα προκαρυωτικά κύτταρα το γενετικό υλικό είναι: 1 ο ΓΕΝΙΚΟ ΛΥΚΕΙΟ ΗΡΑΚΛΕΙΟΥ - ΚΑΠΕΤΑΝΑΚΕΙΟ ΘΕΜΑΤΑ ΠΑΝΕΛΛΗΝΙΩΝ ΕΞΕΤΑΣΕΩΝ ΣΤΟ 1 Ο ΚΕΦΑΛΑΙΟ (ΓΕΝΕΤΙΚΟ ΥΛΙΚΟ) 2000 ΗΜΕΡΗΣΙΟ 3. Στα προκαρυωτικά κύτταρα το γενετικό υλικό είναι: α. γραµµικό δίκλωνοdνα β. γραµµικό

Διαβάστε περισσότερα

Να επιλέξετε την φράση που συμπληρώνει ορθά κάθε μία από τις ακόλουθες προτάσεις:

Να επιλέξετε την φράση που συμπληρώνει ορθά κάθε μία από τις ακόλουθες προτάσεις: ΜΑΘΗΜΑ / ΤΑΞΗ : ΒΙΟΛΟΓΙΑ / Β Λ ΠΡΟΕΤΟΙΜΑΣΙΑ Γ Λ ΗΜΕΡΟΜΗΝΙΑ: 28/02/2016 ΕΠΙΜΕΛΕΙΑ ΔΙΑΓΩΝΙΣΜΑΤΟΣ: ΝΟΤΑ ΛΑΖΑΡΑΚΗ ΘΕΜΑ 1 Ο Να επιλέξετε την φράση που συμπληρώνει ορθά κάθε μία από τις ακόλουθες προτάσεις:

Διαβάστε περισσότερα

ΒΙΟΛΟΓΙΑ κατεύθυνσης

ΒΙΟΛΟΓΙΑ κατεύθυνσης Κεφάλαιο 1 ο ΒΙΟΛΟΓΙΑ κατεύθυνσης Θέματα μικρής δυσκολίας (κατάλληλα για 2 ο Θέμα Πανελληνίων) 1. Ποιο είναι το συμπέρασμα στο οποίο κατέληξε ο Griffith με το πείραμα που πραγματοποίησε; Ο Griffith κατέληξε

Διαβάστε περισσότερα

Οι αζωτούχες βάσεις των νουκλεοτιδίων είναι:

Οι αζωτούχες βάσεις των νουκλεοτιδίων είναι: 1 ΑΣΚΗΣΕΙΣ ΝΟΥΚΛΕΙΚΩΝ ΟΞΕΩΝ ΑΣΚΗΣΗ 1 Ποια είναι η δομή των νουκλεοτιδίων; Τα νουκλεοτίδια προέρχονται από τη σύνδεση με ομοιοπολικό δεσμό, τριών διαφορετικών μορίων. Μιας πεντόζης (σάκχαρο με πέντε άτομα

Διαβάστε περισσότερα

ΘΕΜΑ 1 Ο ΜΑΘΗΜΑ / ΤΑΞΗ : ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ ΣΕΙΡΑ: ΗΜΕΡΟΜΗΝΙΑ: 22/09/2013

ΘΕΜΑ 1 Ο ΜΑΘΗΜΑ / ΤΑΞΗ : ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ ΣΕΙΡΑ: ΗΜΕΡΟΜΗΝΙΑ: 22/09/2013 ΜΑΘΗΜΑ / ΤΑΞΗ : ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ ΣΕΙΡΑ: ΗΜΕΡΟΜΗΝΙΑ: 22/09/2013 ΘΕΜΑ 1 Ο Να επιλέξετε την φράση που συμπληρώνει ορθά κάθε μία από τις ακόλουθες προτάσεις: 1. Το ζεύγος των φυλετικών

Διαβάστε περισσότερα

ΚΕΦΑΛΑΙΟ 1ο : ΤΟ ΓΕΝΕΤΙΚΟ ΥΛΙΚΟ

ΚΕΦΑΛΑΙΟ 1ο : ΤΟ ΓΕΝΕΤΙΚΟ ΥΛΙΚΟ ΚΕΦΑΛΑΙΟ 1ο : ΤΟ ΓΕΝΕΤΙΚΟ ΥΛΙΚΟ Το DNA είναι το γενετικό υλικό. Ποιο πίστευαν αρχικά οι επιστήμονες πως είναι το μόριο που μεταφέρει τη γενετική πληροφορία; Παρ όλο που το DNA εντοπίστηκε στον πυρήνα των

Διαβάστε περισσότερα

ΤΟ ΓΕΝΕΤΙΚΟ ΥΛΙΚΟ. Με αναφορά τόσο στους προκαρυωτικούς όσο και στους ευκαρυωτικούς οργανισμούς

ΤΟ ΓΕΝΕΤΙΚΟ ΥΛΙΚΟ. Με αναφορά τόσο στους προκαρυωτικούς όσο και στους ευκαρυωτικούς οργανισμούς ΤΟ ΓΕΝΕΤΙΚΟ ΥΛΙΚΟ Με αναφορά τόσο στους προκαρυωτικούς όσο και στους ευκαρυωτικούς οργανισμούς Λειτουργίες Γενετικού Υλικού o Αποθήκευση της γενετικής πληροφορίας. Η οργάνωση της γενετικής πληροφορίας

Διαβάστε περισσότερα

ΑΠΑΝΤΗΣΕΙΣ ΘΕΜΑ Α Να επιλέξετε τη φράση που συμπληρώνει ορθά κάθε μία από τις ακόλουθες προτάσεις:

ΑΠΑΝΤΗΣΕΙΣ ΘΕΜΑ Α Να επιλέξετε τη φράση που συμπληρώνει ορθά κάθε μία από τις ακόλουθες προτάσεις: ΜΑΘΗΜΑ / ΤΑΞΗ : ΒΙΟΛΟΓΙΑ / Β Λ ΠΡΟΕΤΟΙΜΑΣΙΑΣ Γ Λ ΗΜΕΡΟΜΗΝΙΑ: 05/03/2017 ΕΠΙΜΕΛΕΙΑ ΔΙΑΓΩΝΙΣΜΑΤΟΣ : ΝΟΤΑ ΛΑΖΑΡΑΚΗ ΑΠΑΝΤΗΣΕΙΣ ΘΕΜΑ Α Να επιλέξετε τη φράση που συμπληρώνει ορθά κάθε μία από τις ακόλουθες προτάσεις:

Διαβάστε περισσότερα

ΘΕΜΑ Α Να επιλέξετε τη φράση που συμπληρώνει ορθά κάθε μία από τις ακόλουθες προτάσεις: 1. Στο DNA των μιτοχονδρίων περιέχονται πληροφορίες για:

ΘΕΜΑ Α Να επιλέξετε τη φράση που συμπληρώνει ορθά κάθε μία από τις ακόλουθες προτάσεις: 1. Στο DNA των μιτοχονδρίων περιέχονται πληροφορίες για: ΜΑΘΗΜΑ / ΤΑΞΗ : ΒΙΟΛΟΓΙΑ / Β Λ ΠΡΟΕΤΟΙΜΑΣΙΑΣ Γ Λ ΗΜΕΡΟΜΗΝΙΑ: 05/03/2017 ΕΠΙΜΕΛΕΙΑ ΔΙΑΓΩΝΙΣΜΑΤΟΣ: ΝΟΤΑ ΛΑΖΑΡΑΚΗ ΘΕΜΑ Α Να επιλέξετε τη φράση που συμπληρώνει ορθά κάθε μία από τις ακόλουθες προτάσεις: 1.

Διαβάστε περισσότερα

Να επιλέξετε την φράση που συμπληρώνει ορθά κάθε μία από τις ακόλουθες προτάσεις:

Να επιλέξετε την φράση που συμπληρώνει ορθά κάθε μία από τις ακόλουθες προτάσεις: ΜΑΘΗΜΑ / ΤΑΞΗ : ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ ΣΕΙΡΑ: ΗΜΕΡΟΜΗΝΙΑ: 21/09/2014 ΘΕΜΑ 1 Ο Να επιλέξετε την φράση που συμπληρώνει ορθά κάθε μία από τις ακόλουθες προτάσεις: 1. Για το γονιδίωμα της γάτας

Διαβάστε περισσότερα

1 ο κεφάλαιο-το γενετικό υλικό 1.1. Το DNA είναι το γενετικό υλικό

1 ο κεφάλαιο-το γενετικό υλικό 1.1. Το DNA είναι το γενετικό υλικό 1 ο κεφάλαιο-το γενετικό υλικό 1.1. Το DNA είναι το γενετικό υλικό 1.1.1.Με βάση την εικόνα που σας δίνεται (πείραμα Griffith) να απαντήσετε στις ερωτήσεις που ακολουθούν. Α. Το συστατικό των βακτηρίων

Διαβάστε περισσότερα

1. Ο Griffith στα πειράματά του χρησιμοποίησε:

1. Ο Griffith στα πειράματά του χρησιμοποίησε: ΜΑΘΗΜΑ / ΤΑΞΗ : ΒΙΟΛΟΓΙΑ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ ΣΕΙΡΑ: ΧΕΙΜΕΡΙΝΑ ΗΜΕΡΟΜΗΝΙΑ: 27/11/11 ΘΕΜΑ 1 Ο Α. Να επιλέξετε τη φράση που συμπληρώνει ορθά κάθε μία από τις ακόλουθες προτάσεις: 1. Ο Griffith στα πειράματά

Διαβάστε περισσότερα

ΑΠΑΝΤΗΣΕΙΣ ΚΡΙΤΗΡΙΟΥ ΑΞΙΟΛΟΓΗΣΗΣ ΓΙΑ ΤΟ 1 Ο ΚΕΦΑΛΑΙΟ ΒΙΟΛΟΓΙΑΣ ΠΡΟΣΑΝΑΤΟΛΙΣΜΟΥ ΑΥΓΟΥΣΤΟΣ 2015

ΑΠΑΝΤΗΣΕΙΣ ΚΡΙΤΗΡΙΟΥ ΑΞΙΟΛΟΓΗΣΗΣ ΓΙΑ ΤΟ 1 Ο ΚΕΦΑΛΑΙΟ ΒΙΟΛΟΓΙΑΣ ΠΡΟΣΑΝΑΤΟΛΙΣΜΟΥ ΑΥΓΟΥΣΤΟΣ 2015 ΑΠΑΝΤΗΣΕΙΣ ΚΡΙΤΗΡΙΟΥ ΑΞΙΟΛΟΓΗΣΗΣ ΓΙΑ ΤΟ 1 Ο ΚΕΦΑΛΑΙΟ ΒΙΟΛΟΓΙΑΣ ΠΡΟΣΑΝΑΤΟΛΙΣΜΟΥ ΑΥΓΟΥΣΤΟΣ 2015 ΘΕΜΑ 1 Ο 1. γ 2. δ 3. α 4. δ 5. δ ΘΕΜΑ 2 Ο Α) Το γενετικό υλικό των προκαρυωτικών κυττάρων είναι ένα δίκλωνο

Διαβάστε περισσότερα

4 DNA ελικάση Δ Περιέχουν πανομοιότυπο DNA. 6 Πριμόσωμα ΣΤ Σταθερότητα κατά μήκος της κάθε πολυνουκλεοτιδικής αλυσίδας

4 DNA ελικάση Δ Περιέχουν πανομοιότυπο DNA. 6 Πριμόσωμα ΣΤ Σταθερότητα κατά μήκος της κάθε πολυνουκλεοτιδικής αλυσίδας Θέμα 1 ο 1. Αντιστοιχείστε όλες τις έννοιες της στήλης 1 με όλες τις φράσεις της στήλης 2 (Οι αντιστοιχίσεις να γραφούν στην κόλλα απαντήσεων σας & όχι στη φωτοτυπία των θεμάτων) 1 2 1 Αδελφές χρωματίδες

Διαβάστε περισσότερα

ΕΡΩΤΗΣΕΙΣ Π Ο Λ Λ Α Π Λ Η Σ Ε Π Ι Λ Ο Γ Η Σ ΝΑ ΣΗΜΕΙΩΣΕΙΣ ΤΗ ΣΩΣΤΗ ΑΠΑΝΤΗΣΗ

ΕΡΩΤΗΣΕΙΣ Π Ο Λ Λ Α Π Λ Η Σ Ε Π Ι Λ Ο Γ Η Σ ΝΑ ΣΗΜΕΙΩΣΕΙΣ ΤΗ ΣΩΣΤΗ ΑΠΑΝΤΗΣΗ ΕΡΩΤΗΣΕΙΣ Π Ο Λ Λ Α Π Λ Η Σ Ε Π Ι Λ Ο Γ Η Σ ΝΑ ΣΗΜΕΙΩΣΕΙΣ ΤΗ ΣΩΣΤΗ ΑΠΑΝΤΗΣΗ 1. Η ποσότητα του DNΑ α. είναι ίδια σε όλους τους απλοειδείς οργανισµούς β. είναι σταθερή σε όλους τους διπλοειδείς οργανισµούς

Διαβάστε περισσότερα

ΑΠΑΝΤΗΣΕΙΣ ΣΤΟ ΔΙΑΓΩΝΙΣΜΑ ΒΙΟΛΟΓΙΑΣ ΠΡΟΣΑΝΑΤΟΛΙΣΜΟΥ ΚΕΦΑΛΑΙΑ 1 ΚΑΙ 2

ΑΠΑΝΤΗΣΕΙΣ ΣΤΟ ΔΙΑΓΩΝΙΣΜΑ ΒΙΟΛΟΓΙΑΣ ΠΡΟΣΑΝΑΤΟΛΙΣΜΟΥ ΚΕΦΑΛΑΙΑ 1 ΚΑΙ 2 ΑΠΑΝΤΗΣΕΙΣ ΣΤΟ ΔΙΑΓΩΝΙΣΜΑ ΒΙΟΛΟΓΙΑΣ ΠΡΟΣΑΝΑΤΟΛΙΣΜΟΥ ΚΕΦΑΛΑΙΑ 1 ΚΑΙ 2 ΘΕΜΑ 1 ο Α. Ερωτήσεις πολλαπλής επιλογής 1. β 2. δ 3. α 4. γ 5. δ Β. Ερωτήσεις σωστού λάθους 1. Λάθος 2. Σωστό 3. Σωστό 4. Σωστό 5.

Διαβάστε περισσότερα

ΟΡΟΛΟΓΙΑ 1 ΟΥ ΚΕΦΑΛΑΙΟΥ

ΟΡΟΛΟΓΙΑ 1 ΟΥ ΚΕΦΑΛΑΙΟΥ ΟΡΟΛΟΓΙΑ 1 ΟΥ ΚΕΦΑΛΑΙΟΥ 1. In vitro 2. In vivo 3. Αναστολείς μίτωσης 4. Απλοειδές κύτταρο 5. Απλοειδής οργανισμός 6. Αριθμός ή αλληλουχία βάσεων 7. Αυτοσωμικά χρωμοσώματα 8. Βήμα έλικας 9. Γονιδίωμα κυττάρου

Διαβάστε περισσότερα

Τα χημικά στοιχεία που είναι επικρατέστερα στους οργανισμούς είναι: i..

Τα χημικά στοιχεία που είναι επικρατέστερα στους οργανισμούς είναι: i.. ΦΥΛΛΟ ΕΡΓΑΣΙΑΣ ΣΤΟ 1 ο ΚΕΦΑΛΑΙΟ «XHMIKH ΣΥΣΤΑΣΗ ΤΟΥ ΚΥΤΤΑΡΟΥ» ΕΙΣΑΓΩΓΗ ΚΑΙ Η ΧΗΜΕΙΑ ΤΗΣ ΖΩΗΣ Α. ΔΡΑΣΤΗΡΙΟΤΗΤΕΣ ΜΕΣΑ ΣΤΗΝ ΤΑΞΗ 1. Όταν αναφερόμαστε στον όρο «Χημική Σύσταση του Κυττάρου», τί νομίζετε ότι

Διαβάστε περισσότερα

ΒΙΟΛΟΓΙΑ Γ ΛΥΚΕΙΟΥ_ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ

ΒΙΟΛΟΓΙΑ Γ ΛΥΚΕΙΟΥ_ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ ΕΙΚΟΝΑ_1.1 In vivo πειράματα απόδειξης της έννοιας του μετασχηματισμού και in vitro απόδειξη ότι το DNA είναι αυτό που προκαλεί το μετασχηματισμό. ΕΡΩΤΗΣΕΙΣ 1. Γιατί πιστεύετε ότι θανατώνονται τα βακτήρια

Διαβάστε περισσότερα

Το γενετικό υλικό. κεφάλαιο. Πνευμονιόκοκκοι (Diploccoccus pneumoniae) Φωτογραφία από ηλεκτρονικό μικροσκόπιο σάρωσης

Το γενετικό υλικό. κεφάλαιο. Πνευμονιόκοκκοι (Diploccoccus pneumoniae) Φωτογραφία από ηλεκτρονικό μικροσκόπιο σάρωσης Το γενετικό υλικό κεφάλαιο Πνευμονιόκοκκοι (Diploccoccus pneumoniae) Φωτογραφία από ηλεκτρονικό μικροσκόπιο σάρωσης To DNA είναι το γενετικό υλικό Η απάντηση δόθηκε το 1944, όταν οι Avery, Mac-Leod και

Διαβάστε περισσότερα

Bιολογία προσανατολισμού

Bιολογία προσανατολισμού Bιολογία προσανατολισμού Α. 1. γ 2. β 3. γ 4. γ 5. β ΘΕΜΑ Α ΘΕΜΑ B B1. Περιγραφή του πολυσώματος όπως αυτό περιγράφεται στις σελίδες 41-42. B2. Σελίδες 37-38 Στους προκαρυωτικούς οργανισμούς... σχηματίζεται

Διαβάστε περισσότερα

igenetics ΜΑΘΗΜΑ 3 Το γενετικό υλικό

igenetics ΜΑΘΗΜΑ 3 Το γενετικό υλικό igenetics ΜΑΘΗΜΑ 3 Το γενετικό υλικό ΛΕΙΤΟΥΡΓΙΕΣ ΤΟΥ ΓΕΝΕΤΙΚΟΥ ΥΛΙΚΟΥ ΑΠΟΘΗΚΕΥΣΗ Στο DNA (RNA ιών) οι πληροφορίες για τα χαρακτηριστικά ενός οργανισμού (γονίδια) ΔΙΑΤΗΡΗΣΗ Από κύτταρο σε κύτταρο και από

Διαβάστε περισσότερα

Η ΣΥΓΧΡΟΝΗ ΔΥΝΑΜΗ ΣΤΗΝ ΕΚΠΑΙΔΕΥΣΗ ΜΕ ΟΡΓΑΝΩΣΗ ΜΕΘΟΔΟ ΣΥΣΤΗΜΑ & ΠΡΟΓΡΑΜΜΑΤΙΣΜΟ www.2001.gr Ν.ΓΡΗΓΟΡΑ & ΦΡΟΥΡΙΟΥ 9 ΤΗΛ. 2531024049

Η ΣΥΓΧΡΟΝΗ ΔΥΝΑΜΗ ΣΤΗΝ ΕΚΠΑΙΔΕΥΣΗ ΜΕ ΟΡΓΑΝΩΣΗ ΜΕΘΟΔΟ ΣΥΣΤΗΜΑ & ΠΡΟΓΡΑΜΜΑΤΙΣΜΟ www.2001.gr Ν.ΓΡΗΓΟΡΑ & ΦΡΟΥΡΙΟΥ 9 ΤΗΛ. 2531024049 ΝΙΚΟΠΟΥΛΟΣ ΚΩΝ/ΝΟΣ 5 η ΕΚΔΟΣΗ Η ΣΥΓΧΡΟΝΗ ΔΥΝΑΜΗ ΣΤΗΝ ΕΚΠΑΙΔΕΥΣΗ ΜΕ ΟΡΓΑΝΩΣΗ ΜΕΘΟΔΟ ΣΥΣΤΗΜΑ & ΠΡΟΓΡΑΜΜΑΤΙΣΜΟ www.2001.gr Ν.ΓΡΗΓΟΡΑ & ΦΡΟΥΡΙΟΥ 9 ΤΗΛ. 2531024049 1 2 3 ΔΙΑΦΟΡΕΣ ΜΕΤΑΞΥ DNA και RNA DNA Δίκλωνο

Διαβάστε περισσότερα

ΘΕΜΑ Α ΘΕΜΑ Β ΑΠΑΝΤΗΣΕΙΣ. Α1. β. Α2. γ. Α3. δ. Α4. γ. Α5. β Β1. 5, 4, 2, 1, 3. Β2. Τα δομικά μέρη του οπερονίου της λακτόζης είναι κατά σειρά τα εξής:

ΘΕΜΑ Α ΘΕΜΑ Β ΑΠΑΝΤΗΣΕΙΣ. Α1. β. Α2. γ. Α3. δ. Α4. γ. Α5. β Β1. 5, 4, 2, 1, 3. Β2. Τα δομικά μέρη του οπερονίου της λακτόζης είναι κατά σειρά τα εξής: ΕΙΣΑΓΩΓΙΚΕΣ ΕΞΕΤΑΣΕΙΣ ΤΕΚΝΩΝ ΕΛΛΗΝΩΝ ΤΟΥ ΕΞΩΤΕΡΙΚΟΥ ΚΑΙ ΤΕΚΝΩΝ ΕΛΛΗΝΩΝ ΥΠΑΛΛΗΛΩΝ ΣΤΟ ΕΞΩΤΕΡΙΚΟ ΔΕΥΤΕΡΑ 10 ΣΕΠΤΕΜΒΡΙΟΥ 2014 ΕΞΕΤΑΖΟΜΕΝΟ ΜΑΘΗΜΑ: ΒΙΟΛΟΓΙΑ ΑΠΑΝΤΗΣΕΙΣ ΘΕΜΑ Α Α1. β Α2. γ Α3. δ Α4. γ Α5. β ΘΕΜΑ

Διαβάστε περισσότερα

ΘΕΜΑ Α Να επιλέξετε την φράση που συμπληρώνει ορθά κάθε μία από τις ακόλουθες προτάσεις:

ΘΕΜΑ Α Να επιλέξετε την φράση που συμπληρώνει ορθά κάθε μία από τις ακόλουθες προτάσεις: ΜΑΘΗΜΑ / ΤΑΞΗ: ΒΙΟΛΟΓΙΑ ΟΠ / Γ ΛΥΚΕΙΟΥ (ΘΕΡΙΝΑ & ΧΕΙΜΕΡΙΝΑ) ΗΜΕΡΟΜΗΝΙΑ: 22/10/2017 ΕΠΙΜΕΛΕΙΑ ΔΙΑΓΩΝΙΣΜΑΤΟΣ: ΛΑΖΑΡΑΚΗ ΝΟΤΑ ΘΕΜΑ Α Να επιλέξετε την φράση που συμπληρώνει ορθά κάθε μία από τις ακόλουθες προτάσεις:

Διαβάστε περισσότερα

ΘΕΜΑΤΑ ΒΙΟΛΟΓΙΑΣ ΓΕΝΙΚΗΣ ΠΑΙ ΕΙΑΣ Β ΛΥΚΕΙΟΥ ΑΠΟ ΤΟ ΒΙΒΛΙΟ ΜΟΥ (YΠΟ ΕΚ ΟΣΗ): ΒΙΟΛΟΓΙΑ ΓΕΝΙΚΗΣ ΠΑΙ ΕΙΑΣ Β ΛΥΚΕΙΟΥ

ΘΕΜΑΤΑ ΒΙΟΛΟΓΙΑΣ ΓΕΝΙΚΗΣ ΠΑΙ ΕΙΑΣ Β ΛΥΚΕΙΟΥ ΑΠΟ ΤΟ ΒΙΒΛΙΟ ΜΟΥ (YΠΟ ΕΚ ΟΣΗ): ΒΙΟΛΟΓΙΑ ΓΕΝΙΚΗΣ ΠΑΙ ΕΙΑΣ Β ΛΥΚΕΙΟΥ ΘΕΜΑΤΑ ΒΙΟΛΟΓΙΑΣ ΓΕΝΙΚΗΣ ΠΑΙ ΕΙΑΣ Β ΛΥΚΕΙΟΥ ΑΠΟ ΤΟ ΒΙΒΛΙΟ ΜΟΥ (YΠΟ ΕΚ ΟΣΗ): ΒΙΟΛΟΓΙΑ ΓΕΝΙΚΗΣ ΠΑΙ ΕΙΑΣ Β ΛΥΚΕΙΟΥ (Περιέχει 67 ερωτήσεις θεωρίας µε απαντήσεις, 116 ασκήσεις ανοικτού- κλειστού τύπου µε µ

Διαβάστε περισσότερα

Ερευνητική εργασία Β τετραμήνου των μαθητών: Μελαμπιανάκη Ειρήνη Νίμεσχαϊμ Κάτριν Πολόβινα Σοφία Σαμιόγλου Νικολέτα Στυλιανάκη Κωνσταντίνα

Ερευνητική εργασία Β τετραμήνου των μαθητών: Μελαμπιανάκη Ειρήνη Νίμεσχαϊμ Κάτριν Πολόβινα Σοφία Σαμιόγλου Νικολέτα Στυλιανάκη Κωνσταντίνα Ερευνητική εργασία Β τετραμήνου των μαθητών: Μελαμπιανάκη Ειρήνη Νίμεσχαϊμ Κάτριν Πολόβινα Σοφία Σαμιόγλου Νικολέτα Στυλιανάκη Κωνσταντίνα Υπεύθυνη καθηγήτρια: Δασκαλάκη Κατερίνα Μοίρες 2012-2013 Περιεχόμενα

Διαβάστε περισσότερα

ΑΠΑΝΤΗΣΕΙΣ. ΘΕΜΑ Α Α1. β Α2. γ Α3. δ Α4. γ Α5. β

ΑΠΑΝΤΗΣΕΙΣ. ΘΕΜΑ Α Α1. β Α2. γ Α3. δ Α4. γ Α5. β ΘΕΜΑ Α Α1. β Α2. γ Α3. δ Α4. γ Α5. β 1 ΕΙΣΑΓΩΓΙΚΕΣ ΕΞΕΤΑΣΕΙΣ ΤΕΚΝΩΝ ΕΛΛΗΝΩΝ ΤΟΥ ΕΞΩΤΕΡΙΚΟΥ ΚΑΙ ΤΕΚΝΩΝ ΕΛΛΗΝΩΝ ΥΠΑΛΛΗΛΩΝ ΣΤΟ ΕΞΩΤΕΡΙΚΟ ΤΕΤΑΡΤΗ 10 ΣΕΠΤΕΜΒΡΙΟΥ 2014 ΕΞΕΤΑΖΟΜΕΝΟ ΜΑΘΗΜΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ:

Διαβάστε περισσότερα

KΕΦΑΛΑΙΟ 1ο Χημική σύσταση του κυττάρου. Να απαντήσετε σε καθεμιά από τις παρακάτω ερωτήσεις με μια πρόταση:

KΕΦΑΛΑΙΟ 1ο Χημική σύσταση του κυττάρου. Να απαντήσετε σε καθεμιά από τις παρακάτω ερωτήσεις με μια πρόταση: KΕΦΑΛΑΙΟ 1ο Χημική σύσταση του κυττάρου Ενότητα 1.1: Χημεία της ζωής Ενότητα 2.1: Μακρομόρια Να απαντήσετε σε καθεμιά από τις παρακάτω ερωτήσεις με μια πρόταση: 1. Για ποιο λόγο θεωρείται αναγκαία η σταθερότητα

Διαβάστε περισσότερα

ΒΙΟΛΟΓΙΑ Ο.Π. ΘΕΤΙΚΩΝ ΣΠΟΥΔΩΝ

ΒΙΟΛΟΓΙΑ Ο.Π. ΘΕΤΙΚΩΝ ΣΠΟΥΔΩΝ Κανάρη 36, Δάφνη Τηλ. 210 9713934 & 210 9769376 ΔΙΑΓΩΝΙΣΜΑ ΠΡΟΣΟΜΟΙΩΣΗΣ ΒΙΟΛΟΓΙΑ Ο.Π. ΘΕΤΙΚΩΝ ΣΠΟΥΔΩΝ ΘΕΜΑ Α Α1.Γ. Α2.Γ. Α3.Β. Α4.Β. Α5.Β. ΘΕΜΑ Β 1. Οι σωστές απαντήσεις είναι: A. Μεγαλύτερη συμβολή γενετικού

Διαβάστε περισσότερα

ΜΑΘΗΜΑ / ΤΑΞΗ : ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΟΥ ΠΡΟΣΑΝΑΤΟΛΙΣΜΟΥ / Γ ΛΥΚΕΙΟΥ ΑΠΑΝΤΗΣΕΙΣ

ΜΑΘΗΜΑ / ΤΑΞΗ : ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΟΥ ΠΡΟΣΑΝΑΤΟΛΙΣΜΟΥ / Γ ΛΥΚΕΙΟΥ ΑΠΑΝΤΗΣΕΙΣ ΜΑΘΗΜΑ / ΤΑΞΗ : ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΟΥ ΠΡΟΣΑΝΑΤΟΛΙΣΜΟΥ / Γ ΛΥΚΕΙΟΥ ΗΜΕΡΟΜΗΝΙΑ: 04/09/2016 ΘΕΜΑ Α Α.1. β. Α.2. β. Α.3. γ. Α.4. δ. ΑΠΑΝΤΗΣΕΙΣ Α.5. β. Μονάδες 25 ΘΕΜΑ Β Β. 1. Ιχνηθέτηση. είναι η σήμανση χημικών

Διαβάστε περισσότερα

Επιβίωση ποντικών 1 ζωντανά βακτήρια S ΟΧΙ 2 ζωντανά βακτήρια R ΝΑΙ ένεση σε ποντικούς 3 βακτήρια S που προηγουμένως θανατώθηκαν με θέρμανση ΝΑΙ

Επιβίωση ποντικών 1 ζωντανά βακτήρια S ΟΧΙ 2 ζωντανά βακτήρια R ΝΑΙ ένεση σε ποντικούς 3 βακτήρια S που προηγουμένως θανατώθηκαν με θέρμανση ΝΑΙ 1. ΤΟ ΓΕΝΕΤΙΚΟ ΥΛΙΚΟ Το DA είναι το γενετικό υλικό Να περιγράψετε το πείραμα του Griffith Ο Griffith ασχολήθηκε με δύο στελέχη 1 του πνευμονόκοκκου (του βακτηρίου 2 Diplococcus pneumoniae) που είχαν τις

Διαβάστε περισσότερα

Ζεύγη βάσεων ΓΕΝΕΤΙΚΗ. 2. Δομή νουκλεϊκών οξέων. Φωσφοδιεστερικός δεσμός

Ζεύγη βάσεων ΓΕΝΕΤΙΚΗ. 2. Δομή νουκλεϊκών οξέων. Φωσφοδιεστερικός δεσμός Ζεύγη βάσεων Αδενίνη Θυμίνη Γουανίνη Κυτοσίνη ΓΕΝΕΤΙΚΗ Φωσφοδιεστερικός δεσμός 2. Δομή νουκλεϊκών οξέων ΝΟΥΚΛΕΪΚΑ ΟΞΕΑ ΣΥΣΤΑΣΗ ΟΡΓΑΝΙΣΜΩΝ ΣΕ ΟΡΓΑΝΙΚΕΣ ΕΝΩΣΕΙΣ ΜΙΚΡΟΜΟΡΙΑ ΜΑΚΡΟΜΟΡΙΑ 1. Αμινοξέα πρωτεϊνες

Διαβάστε περισσότερα

ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ ΟΝΟΜΑΤΕΠΩΝΥΜΟ: ΤΜΗΜΑ: ΘΕΜΑ 1 Ο. 3. Το DNA των μιτοχονδρίων έχει μεγαλύτερο μήκος από αυτό των χλωροπλαστών.

ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ ΟΝΟΜΑΤΕΠΩΝΥΜΟ: ΤΜΗΜΑ: ΘΕΜΑ 1 Ο. 3. Το DNA των μιτοχονδρίων έχει μεγαλύτερο μήκος από αυτό των χλωροπλαστών. ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ ΟΝΟΜΑΤΕΠΩΝΥΜΟ: ΤΜΗΜΑ: ΘΕΜΑ 1 Ο Α. Να γράψετε τον αριθμό της καθεμιάς από τις παρακάτω προτάσεις 1-5 και δίπλα του τη λέξη Σωστό, αν η πρόταση είναι σωστή, ή Λάθος, αν η πρόταση

Διαβάστε περισσότερα

28/11/2010 ΒΙΟΛΟΓΙΑ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ. ΘΕΜΑ 1 ο Α. Να βάλετε σε κύκλο το γράμμα που αντιστοιχεί στη σωστή απάντηση. (10 μόρια)

28/11/2010 ΒΙΟΛΟΓΙΑ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ. ΘΕΜΑ 1 ο Α. Να βάλετε σε κύκλο το γράμμα που αντιστοιχεί στη σωστή απάντηση. (10 μόρια) ΕΠΩΝΥΜΟ:... ΤΣΙΜΙΣΚΗ &ΚΑΡΟΛΟΥ ΝΤΗΛ ΓΩΝΙΑ THΛ: 270727 222594 ΟΝΟΜΑ:... ΤΜΗΜΑ:... ΗΜΕΡΟΜΗΝΙΑ:... ΑΡΤΑΚΗΣ 12 - Κ. ΤΟΥΜΠΑ THΛ: 919113 949422 28/11/2010 ΒΙΟΛΟΓΙΑ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ ΘΕΜΑ 1 ο Α. Να βάλετε

Διαβάστε περισσότερα

Β1. «σελ. 120 σχ. βιβλίου: Για την επιλογή οργάνων συμβατών για μεταμόσχευση» Β2. «σελ. 136 σχ. βιβλίου: Το πρόβατο Dolly κλωνοποίηση θηλαστικών»

Β1. «σελ. 120 σχ. βιβλίου: Για την επιλογή οργάνων συμβατών για μεταμόσχευση» Β2. «σελ. 136 σχ. βιβλίου: Το πρόβατο Dolly κλωνοποίηση θηλαστικών» Βιολογία Κατεύθυνσης Γ Λυκείου Απαντήσεις 2012 Α1. α Α2. γ Α3. δ Α4. β Α5. γ ΘΕΜΑ Β ΘΕΜΑ Α Β1. «σελ. 120 σχ. βιβλίου: Για την επιλογή οργάνων συμβατών για μεταμόσχευση» Β2. «σελ. 136 σχ. βιβλίου: Το πρόβατο

Διαβάστε περισσότερα

Πανελλήνιες Εξετάσεις Ημερήσιων Γενικών Λυκείων. Εξεταζόμενο Μάθημα: Βιολογία Θετικής Κατεύθυνσης, Ημ/νία: 30 Μαίου Απαντήσεις Θεμάτων

Πανελλήνιες Εξετάσεις Ημερήσιων Γενικών Λυκείων. Εξεταζόμενο Μάθημα: Βιολογία Θετικής Κατεύθυνσης, Ημ/νία: 30 Μαίου Απαντήσεις Θεμάτων Πανελλήνιες Εξετάσεις Ημερήσιων Γενικών Λυκείων Εξεταζόμενο Μάθημα: Βιολογία Θετικής Κατεύθυνσης, Ημ/νία: 30 Μαίου 2012 Απαντήσεις Θεμάτων ΘΕΜΑ Α Α1. Η διπλά έλικα του DNA ξετυλίγεται κατά την μεταγραφή

Διαβάστε περισσότερα

3. Σε ένα σωματικό κύτταρο ανθρώπου που βρίσκεται στη μεσόφαση πριν την αντιγραφή υπάρχουν:

3. Σε ένα σωματικό κύτταρο ανθρώπου που βρίσκεται στη μεσόφαση πριν την αντιγραφή υπάρχουν: ΜΑΘΗΜΑ / ΤΑΞΗ : ΒΙΟΛΟΓΙΑ ΚΑΤΕΥΘΥΝΣΗΣ ΣΕΙΡΑ: ΗΜΕΡΟΜΗΝΙΑ: ΘΕΜΑ 1 Ο Α. Να επιλέξετε τη φράση που συμπληρώνει ορθά κάθε μία από τις ακόλουθες προτάσεις: 1. Στο οπερόνιο της λακτόζης: Α. Η πρωτεΐνη καταστολέας

Διαβάστε περισσότερα

ΑΠΑΝΤΗΣΕΙΣ. ΘΕΜΑ Α Α1. γ Α2. α Α3. δ Α4. β Α5. α

ΑΠΑΝΤΗΣΕΙΣ. ΘΕΜΑ Α Α1. γ Α2. α Α3. δ Α4. β Α5. α ΘΕΜΑ Α Α1. γ Α2. α Α3. δ Α4. β Α5. α 1 ΕΙΣΑΓΩΓΙΚΕΣ ΕΞΕΤΑΣΕΙΣ ΤΕΚΝΩΝ ΕΛΛΗΝΩΝ ΤΟΥ ΕΞΩΤΕΡΙΚΟΥ ΚΑΙ ΤΕΚΝΩΝ ΕΛΛΗΝΩΝ ΥΠΑΛΛΗΛΩΝ ΣΤΟ ΕΞΩΤΕΡΙΚΟ ΤΕΤΑΡΤΗ 5 ΣΕΠΤΕΜΒΡΙΟΥ 2012 ΕΞΕΤΑΖΟΜΕΝΟ ΜΑΘΗΜΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ:

Διαβάστε περισσότερα

Ημερομηνία: Κυριακή 29 Οκτωβρίου 2017 Διάρκεια Εξέτασης: 3 ώρες ΕΚΦΩΝΗΣΕΙΣ

Ημερομηνία: Κυριακή 29 Οκτωβρίου 2017 Διάρκεια Εξέτασης: 3 ώρες ΕΚΦΩΝΗΣΕΙΣ ΤΑΞΗ: ΜΑΘΗΜΑ: Γ ΓΕΝΙΚΟΥ ΛΥΚΕΙΟΥ ΒΙΟΛΟΓΙΑ ΠΡΟΣΑΝΑΤΟΛΙΣΜΟΥ Ημερομηνία: Κυριακή 29 Οκτωβρίου 2017 Διάρκεια Εξέτασης: 3 ώρες ΕΚΦΩΝΗΣΕΙΣ Στις ημιτελείς προτάσεις Α1 Α4 να γράψετε στο τετράδιό σας τον αριθμό

Διαβάστε περισσότερα

ΒΙΟΛΟΓΙΑ Ο.Π. ΘΕΤΙΚΩΝ ΣΠΟΥΔΩΝ. Να σημειώσετε το γράμμα που συμπληρώνει κατάλληλα τη φράση:

ΒΙΟΛΟΓΙΑ Ο.Π. ΘΕΤΙΚΩΝ ΣΠΟΥΔΩΝ. Να σημειώσετε το γράμμα που συμπληρώνει κατάλληλα τη φράση: Κανάρη 36, Δάφνη Τηλ. 210 9713934 & 210 9769376 ΔΙΑΓΩΝΙΣΜΑ ΠΡΟΣΟΜΟΙΩΣΗΣ ΒΙΟΛΟΓΙΑ Ο.Π. ΘΕΤΙΚΩΝ ΣΠΟΥΔΩΝ ΘΕΜΑ Α Να σημειώσετε το γράμμα που συμπληρώνει κατάλληλα τη φράση: Α1. Ο Griffith απέδειξε: Α. ότι

Διαβάστε περισσότερα

ΘΕΜΑ Α Να επιλέξετε την φράση που συμπληρώνει ορθά κάθε μία από τις ακόλουθες προτάσεις:

ΘΕΜΑ Α Να επιλέξετε την φράση που συμπληρώνει ορθά κάθε μία από τις ακόλουθες προτάσεις: ΜΑΘΗΜΑ / ΤΑΞΗ: ΒΙΟΛΟΓΙΑ ΟΠ / Γ ΛΥΚΕΙΟΥ ΗΜΕΡΟΜΗΝΙΑ: 22/10/2017 ΕΠΙΜΕΛΕΙΑ ΔΙΑΓΩΝΙΣΜΑΤΟΣ: ΛΑΖΑΡΑΚΗ ΝΟΤΑ ΘΕΜΑ Α Να επιλέξετε την φράση που συμπληρώνει ορθά κάθε μία από τις ακόλουθες προτάσεις: 1. Η εκατοστιαία

Διαβάστε περισσότερα

ΠΑΘΟΓΟΝΟ (σκότωνε τα ποντίκια που µόλυνε)

ΠΑΘΟΓΟΝΟ (σκότωνε τα ποντίκια που µόλυνε) ΚΕΦΑΛΑΙΟ 1ο: ΤΟ ΓΕΝΕΤΙΚΟ ΥΛΙΚΟ 1 ΠΟΙΟ ΜΟΡΙΟ ΜΕΤΑΦΕΡΕΙ ΤΗ ΓΕΝΕΤΙΚΗ ΠΛΗΡΟΦΟΡΙΑ; Το 1969 εντοπίστηκε στον πυρήνα των κυττάρων το DNA Μέχρι το 1944 δεν ήταν γνωστό ότι αποτελεί το γενετικό υλικό των οργανισµών

Διαβάστε περισσότερα

ΑΣΚΗΣΕΙΣ ΣΤΙΣ ΟΡΓΑΝΙΚΕΣ ΟΥΣΙΕΣ ΓΙΑ ΤΗ ΒΙΟΛΟΓΙΑ Γ ΛΥΚΕΙΟΥ. 3. Πώς ονομάζεται η βιοχημική αντίδραση της συνένωσης των δύο μορίων; Συμπύκνωση

ΑΣΚΗΣΕΙΣ ΣΤΙΣ ΟΡΓΑΝΙΚΕΣ ΟΥΣΙΕΣ ΓΙΑ ΤΗ ΒΙΟΛΟΓΙΑ Γ ΛΥΚΕΙΟΥ. 3. Πώς ονομάζεται η βιοχημική αντίδραση της συνένωσης των δύο μορίων; Συμπύκνωση ΑΣΚΗΣΕΙΣ ΣΤΙΣ ΟΡΓΑΝΙΚΕΣ ΟΥΣΙΕΣ ΓΙΑ ΤΗ ΒΙΟΛΟΓΙΑ Γ ΛΥΚΕΙΟΥ Α ΖΗΤΗΜΑ: 1. Ποιο μόριο απεικονίζεται στο σχεδιάγραμμα; Γλυκόζη 2. Εάν δύο τέτοια μόρια ενωθούν μαζί τι θα προκύψει; Μαλτόζη 3. Πώς ονομάζεται η

Διαβάστε περισσότερα

Ποιες είναι οι ομοιότητες και οι διαφορές μεταξύ της αντιγραφής και της

Ποιες είναι οι ομοιότητες και οι διαφορές μεταξύ της αντιγραφής και της ΚΕΦ. 2 ο ΕΡΩΤΗΣΕΙΣ ΚΡΙΣΕΩΣ Ποιες είναι οι ομοιότητες και οι διαφορές μεταξύ της αντιγραφής και της μεταγραφής; Διαφορές Αντιγραφή Μεταγραφή 1. Διατηρείται και μεταβιβάζεται η 1. Μεταβιβάζεται η γενετική

Διαβάστε περισσότερα

γ ρ α π τ ή ε ξ έ τ α σ η σ τ ο μ ά θ η μ α ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ

γ ρ α π τ ή ε ξ έ τ α σ η σ τ ο μ ά θ η μ α ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ γ ρ α π τ ή ε ξ έ τ α σ η σ τ ο μ ά θ η μ α ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ Γ ' ΛΥΚΕΙΟΥ Τάξη: Γ Λυκείου Τμήμα: Βαθμός: Ονοματεπώνυμο: Καθηγητές: Θ Ε Μ Α A 1. Να επιλέξετε τη σωστή απάντηση: Α1. Το γονίδιο

Διαβάστε περισσότερα

Β. Σελ 60 σχολικού: «Η αποµόνωση του συνολικού έως και σελ 61 από µία cdna βιβλιοθήκη.». Γ. ι ι α α α ι α α ι α α α! " # $ % & ' ( ) ( ) ( * % + α ι α

Β. Σελ 60 σχολικού: «Η αποµόνωση του συνολικού έως και σελ 61 από µία cdna βιβλιοθήκη.». Γ. ι ι α α α ι α α ι α α α!  # $ % & ' ( ) ( ) ( * % + α ι α ! THΛ: 270727 222594 THΛ: 919113 949422 Απαντήσεις: " # $ % & ' 1=γ, 2=β, 3=γ, 4=β, 5=δ. " # $ % ( ' εδοµένα από την ανάλυση του ποσοστού των βάσεων σε µόρια DNA από διαφορετικούς οργανισµούς έδειχναν

Διαβάστε περισσότερα

Κυριακή 15/02/2015 Ημερομηνία

Κυριακή 15/02/2015 Ημερομηνία Διαγώνισμα 2014-15 Ενδεικτικές απαντήσεις Κυριακή 15/02/2015 Ημερομηνία Βιολογία Κατεύθυνσης Εξεταζόμενο μάθημα Γ Λυκείου Τάξη Θέμα 1 ο : 1 α, 2 γ, 3 ε, 4 α, 5 ε Θέμα 2 ο : Α. Η απεικόνιση των μεταφασικών

Διαβάστε περισσότερα

Τηλ: Ανδρέου Δημητρίου 81 & Ακριτών 26 -ΚΑΛΟΓΡΕΖΑ

Τηλ: Ανδρέου Δημητρίου 81 & Ακριτών 26 -ΚΑΛΟΓΡΕΖΑ ΔΙΑΓΩΝΙΣΜΑ ΒΙΟΛΟΓΙΑΣ Γ ΛΥΚΕΙΟΥ- ΘΕΤΙΚΗ ΚΑΤΕΥΘΥΝΣΗ (Ιανουάριος 2014) 1 ο ΘΕΜΑ Απαντήστε στις παρακάτω ερωτήσεις πολλαπλής επιλογής. Μία απάντηση είναι η σωστή. 1. Υβριδοποίηση: Α. Είναι ιδιότητα του DNA

Διαβάστε περισσότερα

ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ ΓΕΝΙΚΟΥ ΛΥΚΕΙΟΥ ΚΑΙ ΕΠΑΛ (ΟΜΑ Α Β ) 2012

ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ ΓΕΝΙΚΟΥ ΛΥΚΕΙΟΥ ΚΑΙ ΕΠΑΛ (ΟΜΑ Α Β ) 2012 ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ ΓΕΝΙΚΟΥ ΛΥΚΕΙΟΥ ΚΑΙ ΕΠΑΛ (ΟΜΑ Α Β ) 2012 ΘΕΜΑ Α Να γράψετε στο τετράδιό σας τον αριθμό καθεμιάς από τις παρακάτω ημιτελείς προτάσεις Α1 έως Α5 και δίπλα το γράμμα που αντιστοιχεί

Διαβάστε περισσότερα

Τύποι νουκλεϊκών οξέων

Τύποι νουκλεϊκών οξέων Τύποι νουκλεϊκών οξέων DNA ένας τύπος, μια λειτουργία RNA - 4 τύποι, 4 λειτουργίες Ριβοσωμικό RNA Αγγελιαφόρο RNA Μεταφορικό RNA Καταλυτικό RNA Βιοχημεία Ι Δ-1 Βιοχημεία Ι Δ-2 3 5 φωσφοδιεστερικός δεσμός

Διαβάστε περισσότερα

γραπτή εξέταση στo μάθημα ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ

γραπτή εξέταση στo μάθημα ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ γραπτή εξέταση στo μάθημα ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ Γ ' ΛΥΚΕΙΟΥ Τάξη: Γ Λυκείου Τμήμα: Βαθμός: Ονοματεπώνυμο: Καθηγητές: ΠΑΣΣΙΑ Α. Θ Ε Μ Α A 1. Να επιλέξετε τη σωστή απάντηση: Α1. Κάθε μεταφορικό RNA

Διαβάστε περισσότερα

Βιολογία Γενικής Παιδείας Β Λυκείου

Βιολογία Γενικής Παιδείας Β Λυκείου Απρίλιος Μάιος 12 Βιολογία Γενικής Παιδείας Β Λυκείου Βιολογία Γενικής Παιδείας Β Λυκείου (Ερωτήσεις που παρουσιάζουν ενδιαφέρον) 1. Τι είναι τα βιομόρια και ποια είναι τα βασικά χαρακτηριστικά τους; Βιομόρια

Διαβάστε περισσότερα

Απομόνωση ανθρώπινου DNA γονιδιώματος & ποιοτικός και ποσοτικός προσδιορισμός

Απομόνωση ανθρώπινου DNA γονιδιώματος & ποιοτικός και ποσοτικός προσδιορισμός Απομόνωση ανθρώπινου DNA γονιδιώματος & ποιοτικός και ποσοτικός προσδιορισμός Ευαγγελία - Ειρήνη Τσερμπίνι 1. Σκοπός Σκοπός της παρούσας άσκησης είναι η απομόνωση ανθρώπινου DNA γονιδιώματος από δείγμα

Διαβάστε περισσότερα

Γ ΓΕΝΙΚΟΥ ΛΥΚΕΙΟΥ ΒΙΟΛΟΓΙΑ ΠΡΟΣΑΝΑΤΟΛΙΣΜΟΥ ΘΕΤΙΚΩΝ ΣΠΟΥΔΩΝ. Ημερομηνία: Κυριακή 23 Οκτωβρίου 2016 Διάρκεια Εξέτασης: 3 ώρες ΕΚΦΩΝΗΣΕΙΣ

Γ ΓΕΝΙΚΟΥ ΛΥΚΕΙΟΥ ΒΙΟΛΟΓΙΑ ΠΡΟΣΑΝΑΤΟΛΙΣΜΟΥ ΘΕΤΙΚΩΝ ΣΠΟΥΔΩΝ. Ημερομηνία: Κυριακή 23 Οκτωβρίου 2016 Διάρκεια Εξέτασης: 3 ώρες ΕΚΦΩΝΗΣΕΙΣ ΤΑΞΗ: ΜΑΘΗΜΑ: Γ ΓΕΝΙΚΟΥ ΛΥΚΕΙΟΥ ΒΙΟΛΟΓΙΑ ΠΡΟΣΑΝΑΤΟΛΙΣΜΟΥ ΘΕΤΙΚΩΝ ΣΠΟΥΔΩΝ Ημερομηνία: Κυριακή 23 Οκτωβρίου 2016 Διάρκεια Εξέτασης: 3 ώρες ΕΚΦΩΝΗΣΕΙΣ ΘΕΜΑ Α Στις ημιτελείς προτάσεις Α1 Α4 να γράψετε στο

Διαβάστε περισσότερα

Οργά νωση Γενετικού Υλικού

Οργά νωση Γενετικού Υλικού Βιολογία Γ Γυμνασίου: Διατήρηση και Συνέχεια της Ζωής Οργά νωση Γενετικού Υλικού Γονίδιο: Η μονάδα της κληρονομικότητας. Ουσιαστικά είναι ένα κομμάτι από το DNA που αποθηκεύει πληροφορίες για κάποιο συγκεκριμένο

Διαβάστε περισσότερα

ΚΕΦΑΛΑΙΟ 5. Διατήρηση και συνέχεια της ζωής

ΚΕΦΑΛΑΙΟ 5. Διατήρηση και συνέχεια της ζωής ΚΕΑΛΑΙΟ 5 ιατήρηση και συνέχεια της ζωής 5.2 H ροή της γενετικής πληροφορίας 3 Πώς βρέθηκε η δομή του DNA στο χώρο; Η ανακάλυψη της δομής του DNA πραγματοποιήθηκε το 1953 από τους Watson και Crick. Από

Διαβάστε περισσότερα

Βιολογία προσανατολισμού

Βιολογία προσανατολισμού Βιολογία προσανατολισμού Α. 1. β. 2. γ. 3. γ. 4. α. 5. δ. ΘΕΜΑ Α ΘΕΜΑ Β Β1. Σχολικό βιβλίο σελ. 131 «Το βακτήριο... στο σώμα των φυτών.» Β2.1 Ε, 2 Δ, 3 Α, 4 Β Β3. Σχολικό βιβλίο σελ. 108 «Η θερμοκρασία..

Διαβάστε περισσότερα

ΒΙΟΛΟΓΙΑ Ο.Π. ΘΕΤΙΚΩΝ ΣΠΟΥΔΩΝ

ΒΙΟΛΟΓΙΑ Ο.Π. ΘΕΤΙΚΩΝ ΣΠΟΥΔΩΝ Κανάρη 36, Δάφνη Τηλ. 210 9713934 & 210 9769376 ΔΙΑΓΩΝΙΣΜΑ ΠΡΟΣΟΜΟΙΩΣΗΣ ΒΙΟΛΟΓΙΑ Ο.Π. ΘΕΤΙΚΩΝ ΣΠΟΥΔΩΝ ΘΕΜΑ Α Α1. Γ. Α2. Β. Α3. Γ. Α4. Α. Α5. Β. ΘΕΜΑ Β 1. Οι σωστές απαντήσεις είναι: A. Βιβλίο σελ. 65

Διαβάστε περισσότερα

Βιολογία προσανατολισμού

Βιολογία προσανατολισμού Βιολογία προσανατολισμού ΘΕΜΑ Α Στις προτάσεις από Α1-Α5 να βρείτε την σωστή απάντηση. Α1. Ένας ερευνητής απομόνωσε ένα ασυνεχές γονίδιο από το γονιδίωμα ανθρώπινων κυττάρων. Το γονίδιο συνδέθηκε με βακτηριακό

Διαβάστε περισσότερα

ΠΑΝΕΛΛΗΝΙΕΣ ΕΞΕΤΑΣΕΙΣ Γ ΤΑΞΗΣ ΗΜΕΡΗΣΙΟΥ ΓΕΝΙΚΟΥ ΛΥΚΕΙΟΥ ΚΑΙ ΕΠΑΛ (ΟΜΑΔΑ Β ) ΤΕΤΑΡΤΗ 30 ΜΑΪΟΥ 2012 ΕΞΕΤΑΖΟΜΕΝΟ ΜΑΘΗΜΑ: ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ

ΠΑΝΕΛΛΗΝΙΕΣ ΕΞΕΤΑΣΕΙΣ Γ ΤΑΞΗΣ ΗΜΕΡΗΣΙΟΥ ΓΕΝΙΚΟΥ ΛΥΚΕΙΟΥ ΚΑΙ ΕΠΑΛ (ΟΜΑΔΑ Β ) ΤΕΤΑΡΤΗ 30 ΜΑΪΟΥ 2012 ΕΞΕΤΑΖΟΜΕΝΟ ΜΑΘΗΜΑ: ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ ΠΑΝΕΛΛΗΝΙΕΣ ΕΞΕΤΑΣΕΙΣ Γ ΤΑΞΗΣ ΗΜΕΡΗΣΙΟΥ ΓΕΝΙΚΟΥ ΛΥΚΕΙΟΥ ΚΑΙ ΕΠΑΛ (ΟΜΑΔΑ Β ) ΤΕΤΑΡΤΗ 30 ΜΑΪΟΥ 2012 ΕΞΕΤΑΖΟΜΕΝΟ ΜΑΘΗΜΑ: ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ ΘΕΜΑ Α Να γράψετε στο τετράδιό σας τον αριθμό καθεμιάς

Διαβάστε περισσότερα

τα βιβλία των επιτυχιών

τα βιβλία των επιτυχιών Τα βιβλία των Εκδόσεων Πουκαμισάς συμπυκνώνουν την πολύχρονη διδακτική εμπειρία των συγγραφέων μας και αποτελούν το βασικό εκπαιδευτικό υλικό που χρησιμοποιούν οι μαθητές των φροντιστηρίων μας. Μέσα από

Διαβάστε περισσότερα

ΒΙΟΛΟΓΙΑ Γ ΛΥΚΕΙΟΥ, ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ

ΒΙΟΛΟΓΙΑ Γ ΛΥΚΕΙΟΥ, ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ EIKONA 2.1 Ημισυντηρητικός μηχανισμός αντιγραφής του DNA 1. Να γράψετε τα ένζυμα που (α) προκαλούν ξετύλιγμα των αλυσίδων του αρχικού (μητρικού μορίου) DNA και (β) συνθέτουν τις νέες αλυσίδες του DNA.

Διαβάστε περισσότερα

ΑΠΑΝΤΗΣΕΙΣ. ΘΕΜΑ Α Α1. δ Α2. α Α3. α Α4. γ Α5. β. ΘΕΜΑ Β Β1. Στήλη Ι Στήλη ΙΙ 1. Γ 2. Β 3. Ε 4. Α 5. Δ

ΑΠΑΝΤΗΣΕΙΣ. ΘΕΜΑ Α Α1. δ Α2. α Α3. α Α4. γ Α5. β. ΘΕΜΑ Β Β1. Στήλη Ι Στήλη ΙΙ 1. Γ 2. Β 3. Ε 4. Α 5. Δ ΘΕΜΑ Α Α1. δ Α2. α Α3. α Α4. γ Α5. β ΕΙΣΑΓΩΓΙΚΕΣ ΕΞΕΤΑΣΕΙΣ ΤΕΚΝΩΝ ΕΛΛΗΝΩΝ ΤΟΥ ΕΞΩΤΕΡΙΚΟΥ ΚΑΙ ΤΕΚΝΩΝ ΕΛΛΗΝΩΝ ΥΠΑΛΛΗΛΩΝ ΠΟΥ ΥΠΗΡΕΤΟΥΝ ΣΤΟ ΕΞΩΤΕΡΙΚΟ ΤΡΙΤΗ 7 ΣΕΠΤΕΜΒΡΙΟΥ 2016 ΕΞΕΤΑΖΟΜΕΝΟ ΜΑΘΗΜΑ ΟΜΑΔΑΣ ΠΡΟΣΑΝΑΤΟΛΙΣΜΟΥ

Διαβάστε περισσότερα

Ο µαθητής που έχει µελετήσει το κεφάλαιο γενετικό υλικό πρέπει να γνωρίζει:

Ο µαθητής που έχει µελετήσει το κεφάλαιο γενετικό υλικό πρέπει να γνωρίζει: Ο µαθητής που έχει µελετήσει το κεφάλαιο γενετικό υλικό πρέπει να γνωρίζει: Με ποια πειράµατα οι επιστήµονες κατέληξαν στο συµπέρασµα ότι το DNA είναι το γενετικό υλικό του κυττάρου. Ποιες οι διαφορές

Διαβάστε περισσότερα

ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ ΑΠΑΝΤΗΣΕΙΣ ΣΤΑ ΘΕΜΑΤΑ ΕΞΕΤΑΣΕΩΝ 2012

ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ ΑΠΑΝΤΗΣΕΙΣ ΣΤΑ ΘΕΜΑΤΑ ΕΞΕΤΑΣΕΩΝ 2012 ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ ΑΠΑΝΤΗΣΕΙΣ ΣΤΑ ΘΕΜΑΤΑ ΕΞΕΤΑΣΕΩΝ 2012 ΘΕΜΑ Α 1. α 2. γ 3. δ 4. β 5. γ ΘΕΜΑ Β 1. Σελ 120: Τα κύτταρα των οργάνων έχουν στην επιφάνειά τους ειδικά αντιγόνα επιφανείας, που αναγνωρίζονται

Διαβάστε περισσότερα

ΤΕΛΟΣ 1ΗΣ ΑΠΟ 5 ΣΕΛΙΔΕΣ

ΤΕΛΟΣ 1ΗΣ ΑΠΟ 5 ΣΕΛΙΔΕΣ ΑΡΧΗ 1ΗΣ ΣΕΛΙΔΑΣ ΕΞΕΤΑΣΕΙΣ Γ ΤΑΞΗΣ ΗΜΕΡΗΣΙΟΥ ΓΕΝΙΚΟΥ ΛΥΚΕΙΟΥ ΚΑΙ ΕΠΑΛ(ΟΜΑΔΑ Β ) ΣΑΒΒΑΤΟ 28 ΝΟΕΜΒΡΙΟΥ 2015 ΕΞΕΤΑΖΟΜΕΝΟ ΜΑΘΗΜΑ: ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ ΣΥΝΟΛΟ ΣΕΛΙΔΩΝ: ΠΕΝΤΕ (5) ΘΕΜΑ Α Να γράψετε στο

Διαβάστε περισσότερα

Θέματα πριν τις εξετάσεις. Καλό διάβασμα Καλή επιτυχία

Θέματα πριν τις εξετάσεις. Καλό διάβασμα Καλή επιτυχία Θέματα πριν τις εξετάσεις Καλό διάβασμα Καλή επιτυχία 2013-2014 Θέματα πολλαπλής επιλογής Μετουσίωση είναι το φαινόμενο α. κατά το οποίο συνδέονται δύο αμινοξέα για τον σχηματισμό μιας πρωτεΐνης β. κατά

Διαβάστε περισσότερα

ΤΕΛΟΣ 1ΗΣ ΑΠΟ 5 ΣΕΛΙ ΕΣ

ΤΕΛΟΣ 1ΗΣ ΑΠΟ 5 ΣΕΛΙ ΕΣ ΑΡΧΗ 1ΗΣ ΣΕΛΙ ΑΣ ΝΕΟ & ΠΑΛΑΙΟ ΣΥΣΤΗΜΑ ΕΣΠΕΡΙΝΩΝ ΠΑΝΕΛΛΑΔΙΚΕΣ ΕΞΕΤΑΣΕΙΣ Δ ΤΑΞΗΣ ΕΣΠΕΡΙΝΟΥ ΓΕΝΙΚΟΥ ΛΥΚΕΙΟΥ ΚΑΙ ΕΠΑΛ (ΟΜΑΔΑ Β ) ΠΑΡΑΣΚΕΥΗ 27 ΜΑΪΟΥ 2016 - ΕΞΕΤΑΖΟΜΕΝΟ ΜΑΘΗΜΑ: ΒΙΟΛΟΓΙΑ ΠΡΟΣΑΝΑΤΟΛΙΣΜΟΥ (ΝΕΟ

Διαβάστε περισσότερα

ΒΙΟΛΟΓΙΑ Β ΛΥΚΕΙΟΥ ΓΕΝΙΚΗΣ ΠΑΙΔΕΙΑΣ

ΒΙΟΛΟΓΙΑ Β ΛΥΚΕΙΟΥ ΓΕΝΙΚΗΣ ΠΑΙΔΕΙΑΣ ΕΚΠΑΙΔΕΥΤΗΡΙΑ ΣΥΓΧΡΟΝΗ ΠΑΙΔΕΙΑ ΒΙΟΛΟΓΙΑ Β ΛΥΚΕΙΟΥ ΓΕΝΙΚΗΣ ΠΑΙΔΕΙΑΣ ΕΠΙΜΕΛΕΙΑ:Ν.ΠΑΠΑΓΙΑΝΝΗΣ 2 Η ΧΗΜΕΙΑ ΤΗΣ ΖΩΗΣ 3 1. Ποια είναι τα επίπεδα οργάνωσης της ζωής και ποια τα χημικά χαρακτηριστικά της; Στην

Διαβάστε περισσότερα

ΑΠΑΝΤΗΣΕΙΣ. Α. Να επιλέξετε τη φράση που συμπληρώνει ορθά κάθε μία από τις ακόλουθες προτάσεις:

ΑΠΑΝΤΗΣΕΙΣ. Α. Να επιλέξετε τη φράση που συμπληρώνει ορθά κάθε μία από τις ακόλουθες προτάσεις: ΘΕΜΑ 1 Ο ΑΠΑΝΤΗΣΕΙΣ Α. Να επιλέξετε τη φράση που συμπληρώνει ορθά κάθε μία από τις ακόλουθες προτάσεις: 1. Στο οπερόνιο της λακτόζης: Α. Η πρωτεΐνη καταστολέας συνδέεται με το ρυθμιστικό γονίδιο Β. Το

Διαβάστε περισσότερα

ΤΕΛΟΣ 1ΗΣ ΑΠΟ 5 ΣΕΛΙ ΕΣ

ΤΕΛΟΣ 1ΗΣ ΑΠΟ 5 ΣΕΛΙ ΕΣ ΑΡΧΗ 1ΗΣ ΣΕΛΙ ΑΣ Γ ΗΜΕΡΗΣΙΩΝ ΠΑΝΕΛΛΗΝΙΕΣ ΕΞΕΤΑΣΕΙΣ Γ ΤΑΞΗΣ ΗΜΕΡΗΣΙΟΥ ΓΕΝΙΚΟΥ ΛΥΚΕΙΟΥ ΚΑΙ ΕΠΑΛ (ΟΜΑ Α Β ) ΤΕΤΑΡΤΗ 30 ΜΑΪΟΥ 2012 ΕΞΕΤΑΖΟΜΕΝΟ ΜΑΘΗΜΑ: ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ ΣΥΝΟΛΟ ΣΕΛΙ ΩΝ: ΠΕΝΤΕ (5)

Διαβάστε περισσότερα

Η ΧΗΜΕΙΑ ΤΗΣ ΖΩΗΣ. Καρβουντζή Ηλιάνα Βιολόγος

Η ΧΗΜΕΙΑ ΤΗΣ ΖΩΗΣ. Καρβουντζή Ηλιάνα Βιολόγος Η ΧΗΜΕΙΑ ΤΗΣ ΖΩΗΣ Χημικά στοιχεία που συνθέτουν τους οργανισμούς Ο C, το H 2, το O 2 και το N 2 είναι τα επικρατέστερα στους οργανισμούς σε ποσοστό 96% κ.β. Γιατί; Συμμετέχουν σε σημαντικό βαθμό στη σύνθεση

Διαβάστε περισσότερα

Ασκήσεις 1 ου ΚΕΦΑΛΑΙΟΥ

Ασκήσεις 1 ου ΚΕΦΑΛΑΙΟΥ Ασκήσεις 1 ου ΚΕΦΑΛΑΙΟΥ 1. Η ανάλυση δειγμάτων DNA από δύο βακτηριακές καλλιέργειες έδωσε τα εξής αποτελέσματα: στην πρώτη καλλιέργεια βρέθηκε ποσοστό αδενίνης (Α) 28% και στη δεύτερη καλλιέργεια βρέθηκε

Διαβάστε περισσότερα