13 5 Vol13 No5 9 10 Life Science Research Oct 9 9 PCR Sumf1 *,,,,, 481 : (chromatin immunoprecipitation assay, ChIP) activator protein-2 alpha (AP-2 α) Sumf 1 PCR, AP-2 α Sumf 1, DNA, Sumf 1 103 ~111, 411 ~419 GCCGTCAGG GAAGTCCTG, GCCTCTAGG GGATCTCTG,, AP-2 α Sumf 1 : AP-2 α; Sumf 1; PCR; : Q955 :A :7-7847(9)05-0430-07 Site-directed Mutagenesis of Sumf 1 Gene of Mouse Based on Overlap Extension PCR and Construction of Eukaryotic Expression Vector SHUAI Yong HU Xing-wang YI Duo WANG Cheng ZHAO Xiao-meng ZHOU Chang * Key Laboratory of Protein Chemistry and Developmental Biology of State Education Ministry of China College of Life Sciences Hunan Normal University Changsha 481 Hunan China Abstract Through ChIP experiment Sumf1 was screened out as one of the target genes of transcription factor activator protein-2 alpha AP-2 α Site-directed mutagenesis method based on overlap extension PCR was used to introduce mutations in the two sites which were AP-2α binding sites in the Sumf1 intron fragment and the site-directed mutagenesis eukaryotic expression vector were constructed DNA sequencing showed that GCCGTCAGG of 103~111 sites had been changed into GAAGTCCTG and GCCTCTAGG of 411 ~419 sites had been changed into GGATCTCTG from mutagenesis Site-directed mutagenesis was successfully implemented and laid the foundation for further study of AP-2α regulation of the expression of Sumf1 Key words: transcription factor AP-2α Sulfatase-modifying factor 1 Sumf1 overlap extension PCR sitedirected mutagenesis Life Science Research 9 13 5 430~436 AP-2 : 9-04-18 : 9-09-18 : 30258 09B059 : 1983 - * 1972- Tel 0731-88872916 E-mail: zhouchang01@gmailcom
5 : PCR Sumf1 431 DNA AP-2 sulfatase C-α- AP-2α AP-2β AP-2γ AP-2δ AP-2ε AP-2 MSD [13] AP- lysosomal storage 2 AP-2 disease LSD Sumf 1 DNA [14] PCR Electrophoretic Mobility Shift puc19-chip-dna Assay EMSA AP-2α AP-2γ NCBI AP-2α G / C CCNN A /C/ G G / A G G [1] / C / T AP-2α Sumf 1 [2] 1987 HeLa JASPAR AP-2α AP-2α Sumf 1 AP-2α c-erbb-2 AP-2α EMSA AP-2α Sumf 1 Sumf 1 AP-2α DNA AP-2α AP-2α DNA AP-2α MAR p 21 waf / cip ER ErbB 2 [3~5] MCAM/MUC 18 c-kit E-cadherin [6~8] AP-2α AP-2α PCR AP-2α Sumf1 AP-2α AP-2α AP-2α Sumf 1 1 [9] ChIP 11 AP-2α Ecoli DH 5α ptal-luc AP-2α ptal-sumf 1 AP-2α 1 Sumf 1 +56 954 ~ +57 785 Sulfatase-modifying factor 1 Sumf 1 Sumf 1 FGE C-alpha-formylglycine-generating Qiagen T4 enzyme Sumf 1 6 E 1 DNA Kpn Xho SUMF 1 3 p 262 New England Biolabs pmd 18-T 6 E 1 Sumf 1 78 555 [12] C-alpha-formylglycine Sumf 1 EMSA AP-2α Sumf 1 TaKaRa Ex Taq DNA PCR 9 8 1 TaKaRa 1 DNA 89% 12 407 kda SUMF 2 121 PCR [10] [11] PCR [15] Primer Premier 50
432 9 8 4 1 1 Table 1 Primers used in this study Fragments Primers Sequences for primers listed 5 to 3 1 2 3 4 F 1 R 1 MF 1 MR 1 F 2 R 2 MF 2 MR 2 CGggtaccGACTCTGGAAAGGAAGGCGTAT CCctcgagACTATTAACAATCATGCCAGCA CACAGGACTTCCTGGGCTT AGGAAGTCCTGTGGTCTGTGTG CGggtacc GACTGAGGGTCTGCACATGC CCctcgagGAATTCAAGCAGTGCCCCC TCAGGATCTCTGTTTACTTGCA GCAAGTAAACAGAGATCCTGATAC Notes: The bases for substitutions were shadowed the restriction sites were underlined 103~111 F 1 EP DNA 5 -CGggtaccGACTCTGGAAAGGAAGGCGTAT-3 PCR 1 PCR 2 1 R 1 5 -CCctcgagACTATTAAC AATCATGCCAGCA-3 Kpn 1 R 1 3 PCR Xho 3 PCR 1 2 MF 1 MR 1 MF 1 5 -CACAGGA CTTCCTGGGCTT-3 MR 1 5 -AGGAAGTC CTGTGGTCTGTGTG -3 MF 1 MR 1 50 μl Ex Taq DNA polymerase 05 μl dntp 411~419 2 mmol/l 4 μl 5 μmol/l 20 μl F 2 5 -CGggtaccGAC TGAGGGTCTGCACATGC -3 R 2 5 min 94 35 s 55 30 s 5 -CCctcgagGAATTCAAGCAGTGCCCCC-3 Kpn Xho 10 min Sumf 1-M 2 MF 2 MR 2 PCR 1 F 2 MR 2 PCR 2 MF 2 5 -TCAGGATCTCTGTTTACTTGCA -3 MR 2 5 - GCAAGTAAACAGAGATCCT GATAC -3 MF MR DNA 122 PCR 2 1 μl F Sumf 1-M 1 PCR PCR μl 10 Buffer 20 μl 345 μl PCR 95 72 45 s 25 72 MF 2 R 2 PCR 3 F 2 R 2 PCR Sumf 1-M 1 Sumf 1-M 2 1% 1 μl F1 R2 PCR Sumf 1 3 PCR Sumf 1-M 1 ptal-sumf 1 123 F 1 MR 1 Sumf 1-M 1 Sumf 1-M 2 Sumf 1- PCR PCR 1 M 1% DNA 1 ptal-sumf 1 T 4 DNA PMD MF 1 R 1 18-T 16 PCR PCR 2 Ecoli DH 5 α LB DNA 2 PCR PCR 1% PCR
5 : PCR Sumf1 433 F1 MF1 F2 MF2 MR1 R1 MR2 R2 A Fragment 2 Fragment 4 Fragment 1 Fragment 3 B Fragments 3+4 Fragments 1+2 C 1 PCR A: PCR 1 2 DNA ; B: 1 2, 3 4, PCR 3 Sumf 1-M 1 Sumf 1-M 2; C: Sumf 1-M 1 Sumf 1-M 2, PCR Sumf 1-M ( ) Fig 1 Site-directed mutagenesis by overlap extensions PCR A: Synthesis of DNA fragments by PCR 1 and PCR 2; B: Fragment 1 mixed with fragment 2 and fragment 3 mixed with fragment 4 then synthesis of Sumf 1-M 1 and Sumf 1-M 2 by PCR 3; C Sumf 1-M 1 mixed with Sumf 1-M 2 then synthesis of Sumf 1-M entire gray bars represent substitution sites 124 2 Kpn Xho PMD 18-T- Sumf 1-M 1 Vector PMD 18-T-Sumf 1-M 2 21 Vector PMD 18-T-Sumf 1-M Vector PCR PCR Sumf 1-M 1 Sumf 1-M 2 Sumf 1-M Kpn Xho PCR 2 1% ptal-luc 113 161 Sumf 1-M 2 PCR 1 ptal-luc CIAP T 4 PCR 2 228 263 2 DNA DNA 16 Sumf 1-M 1 Sumf 1-M 2 PCR 3 DH 5 α 261 470 3 Sumf 1-M PCR ptal-sumf 1-M 1 ptal-sumf 1-M 2 ptal- 670 4 PMD Sumf 1-M PCR 18-T Vector DH 5α PCR 5 Sumf 1-M 1 PCR 1 Kpn Xho Marker 1 2 3 4 2 PCR 1 2 Sumf 1-M 1 PCR 1 PCR 2 ; 3 4 Sumf 1-M 2 PCR 1 PCR 2 Fig2 PCR amplification products were obtained by an overlap extension PCR Lane 1: first PCR step fragment 1 were obtained by PCR amplification; Lane 2: second PCR step fragment 2 were obtained by PCR amplification; Lane 3: first PCR step fragment 3 were obtained by PCR amplification; Lane 4: second PCR step fragment 4 were obtained by PCR amplification
434 9 Marker 1 2 Marker 1 3 PCR 1 Sumf 1-M 1 PCR 3 ; 2 Sumf 1-M 2 PCR 3 Fig3 PCR amplification products were obtained by an overlap extension PCR Lane 1: third PCR step Sumf 1-M 1 were obtained by PCR amplification Lane 2: third PCR step Sumf 1-M 2 were obtained by PCR amplification 4 PCR 1 Sumf 1-M PCR Fig4 PCR amplification products were obtained by an overlap extension PCR Lane 1: Sumf 1-M entire were obtained by PCR amplification Marker 1 2 3 4 5 6 7 8 9 10 11 12 5 PMD 18-T-Sumf 1-M 1 PMD 18-T-Sumf 1-M 2 PMD 18-T-Sumf 1-M PCR 1~12 PCR ; 1~5 PMD 18-T-Sumf 1-M 1 PCR ; 6~10 PMD 18-T-Sumf 1-M 2 PCR ; 11 12 PMD 18-T-Sumf 1-M PCR Fig5 Identification of recombinant plasmids PMD 18-T-Sumf 1-M 1 PMD 18-T-Sumf 1-M 2 and PMD 18-T-Sumf 1- M entire Lanes 1~12: positive PCR products of recombinant plasmids Lanes 1~5: PCR products of PMD 18-T-Sumf 1-M 1 plasmids Lanes 6~10: PCR products of PMD 18-T-Sumf 1-M 2 plasmids Lanes 11~12: PCR products of PMD 18-T-Sumf 1-M entire plasmids 22 PCR 6 9 10 5 8 12 14 1~4 ptal-sumf 1-M 1 PCR 6 7 9 10 ptal-sumf 1-M 2 PCR 11 13 ptal-sumf 1-M PCR PCR 1 6 11 DNA 7 8 PCR PCR 103 ~111 GCCGTCAGG GAAGTCCTG 411~419 GCCTCTAGG GGATCTCTG ptal- Sumf 1-M 1 ptal- Sumf 1-M 2 ptal-sumf 1-M 3 3 site directed mutagenesis SDM
5 : PCR Sumf1 435 Marker 1 2 3 4 5 6 7 8 9 10 11 12 13 14 6 ptal-sumf 1-M 1 ptal-sumf 1-M 2 ptal-sumf 1-M PCR 1~4 6 7 9 10 11 13 PCR ; 5 8 12 14 1~4 ptal-sumf 1-M 1 PCR ; 6 7 9 10 ptal-sumf 1-M 2 PCR ; 11 13 ptal-sumf 1-M PCR Fig6 Identification of recombinant plasmids ptal-sumf 1-M 1 ptal-sumf 1-M 2 and ptal-sumf 1-M entire Lanes 1 ~4 6 7 9 10 11 13: positive PCR products of recombinant plasmids Lanes 5 8 12 14: negative PCR products of recombinant plasmids Lanes 1~5: PCR products of ptal-sumf 1-M 1 plasmids Lanes 6~10: PCR products of ptal-sumf 1-M 2 plasmids Lanes 11~14: PCR products of ptal-sumf 1-M entire plasmids Marker 1 2 Marker 1 7 ptal-sumf 1-M1 ptal-sumf 1-M2 1 Kpn Xho ptal-sumf 1-M1 8 ptal-sumf 1-M ; 2 Kpn Xho ptal-sumf 1- M2 1 Kpn Xho ptal-sumf 1-M Fig7 Double digestion of ptal-sumf 1-M 1 plasmids Fig8 Double digestion of ptal-sumf 1-M entire plasmids and ptal-sumf 1-M 2 plasmids Lane 1: ptal-sumf 1-M 1 plasmids were digested with Kpn Lane 1: ptal-sumf 1-M entire plasmids were digested with Kpn and Xho and Xho Lane 2: ptal-sumf 1-M 2 plasmids were digested with Kpn and Xho 190 810 9 10 103 ~111 GCCGTCAGG 411 ~419 GCCTCTAGG GAAGTCCTG GGATCTCTG, Fig9 Results of sequencing Fig10 Results of sequencing GCCGTCAGG of 103 ~111 sites were changed into GCCTCTAGG of 411~419 sites were changed into GAAGTCCTG from mutagenesis Arrows represent mutations GGATCTCTG from mutagenesis Arrows represent mutations
436 9 PCR PCR PCR 4049 3 oestrogen[j] Oncogene 0 19 2 280-288 5 DNA cells[j] J Biol Chem 1998 273 26 16501-16508 15~20 Tm 4358-4369 Tm Primer Premier 50 Cell Biochem 1 83 3 364-372 PCR 103~ et al 111 411~419 lacking transcription factor AP-2[J] PCR 238-241 AP-2 α Sumf 1 3 ptal-luc 293 FT COS-7 AP-2 α Sumf 1 AP-2 α Sumf 1 (References): 4049 [2] MITCHELL P J WANG C TJIAN R Positive and negative regulation of transcription in vitro enhancer binding protein AP-2 is inhibited by SV 40 T antigen[j] Cell 1987 50 847-861 [3] PELLIKANEN M J PEKOLA T T ROPPONEN K M et al p 21 WAF1 expression in invasive breast cancer and its association with p 53 AP-2 cell proliferation and prognosis [J] Clin Pathol 3 56 3 214-220 [1] MCPHERSON L A WEIGEL R J AP-2 α and AP-2 γ a comparison of binding site specificity and trans-activation of the estrogen receptor promoter and single site promoter constructs[j] Nucleic Acids Research 1999 27 20 4040- [4] MCPHERSON L A WEIGEL R J AP-2 α and AP-2 γ a comparison of binding site specificity and trans-activation of the estrogen receptor promoter and single site promoter constructs[j] Nucleic Acids Research 1999 27 20 4040- [5] PERISSIV MENNIN COTTONE E et al AP-2 transcription factors in the regulation of ERBB2 gene transcription by [6] JEAN D GERSHENWALD J E HUANG S et al Loss of AP-2 results in upregulation of MCAM/MUC 18 and an increase in tumor growth and metastasis of human melanoma [7] HUANG S JEAN D LUCA M et al Loss of AP-2 results in downregulation of c-kit and enhancement of melanoma tumorigenicity and metastasis[j] The EMBO 1998 17 15 [8] BALDIA SANTINID BATTISTA T et al Expression of AP-2 transcription factor and of its downstream target genes c- kit E-cadherin and p 21 in human cutaneous melanoma [J] [9] ZHANG J HAGOPIAN-DONALDSON S SERBEDAIJA G Neural tube skeletal and bodywall defects in mice Nature 1996 381 [10] ZITO E FRALDI A PEPE S et al Sulphatase activities are regulated by the interaction of sulphatase-modifying factor 1 with SUMF2[J] EMBO Reports 5 6 7 655-660 [11] ZITO E BUONO M PEPE S et al Sulfatase modifying factor 1 trafficking through the cells from endoplasmic reticulum to the endoplasmic reticulum[j] European Molecular Biology Organization 7 26 2443-2453 [12] ROESER D PREUSSER-KUNZE A SCHMIDT B et al A general binding mechanism for all human sulfatases by the formylglycine-generating enzyme[j] PNAS 6 103 1 81-86 [13] COSMA M P PEPE S ANNUNZIATA I et al The multiple sulfatase deficiency gene encodes an essential and limiting factor for the activity of sulfatases[j] Cell 3 113 445-456 [14] SETTEMBRE C ANNUNZIATA I SPAMPANATO C et al Systemic inflammation and neurodegeneration in a mouse model of multiple sulfatase deficiency[j] PNAS 6 104 11 4506-4511 [15] PCR [M] HUANG Pei-tang YU Wei-yuan CHEN Tian-mi et al Translate PCR Lab Manual[M] Beijing Science Press 1999416-444