Effect of intravenous injecting plasmid encoding interleukin-19-igg on experimental autoimmune myocarditis in rats

Σχετικά έγγραφα
IL - 13 /IL - 18 ELISA PCR RT - PCR. IL - 13 IL - 18 mrna. 13 IL - 18 mrna IL - 13 /IL Th1 /Th2

Effects of soothing liver and invigorating spleen recipes of TCM on hepatic inflammatory cytokines of rats with nonalcoholic steatosishepatitis

Τα ηπατικά επίπεδα του FOXP3 mrna στη χρόνια ηπατίτιδα Β εξαρτώνται από την έκφραση των οδών Fas/FasL και PD-1/PD-L1

0. 35g kg ~ 2. 0cm 10min. Nar- 15μL 6mm

Effect of shengjiang powder on protection of myocardial injury in patients with sepsis

Η ΥΠΕΡΕΚΦΡΑΣΗ ΤΟΥ SMAD7 ΠΡΟΣΤΑΤΕΥΕΙ ΤΟ ΗΠΑΡ ΑΠΟ ΤΗΝ TGF-Β/SMAD ΜΕΣΟΛΑΒΟΥΜΕΝΗ ΙΝΟΓΕΝΕΣΗ

Cellular Physiology and Biochemistry

High mobility group 1 HMG1

Contents Part I Psychoneuroimmunology and Systems Biology Mechanisms 1 From Psychoneuroimmunology to Personalized, Systems, and Dynamical Medicine

Antimicrobial Ability of Limonene, a Natural and Active Monoterpene

Relationship between Connective Tissue Diseases and Thyroid Diseases

BGP TRACP-5b BGP TRACP-5b P 0.05

Effect of extract method on pharmacokinetics of baicalin and berberine in dogs

74. 93% ± 2. 15% vs % ± 2. 54% P < A ConA. A doi /j. issn

ACTA CHINESE MEDICINE. diabetic nephropathies DN 24. urine protein quantitation in 24 hours 24hUTP serum creatinine Scr

svari Real-time RT-PCR RSV

α 1 2- Cloning and Expression of alpha 1 2-fucosyltransferase in E. coli BIOTECHNOLOGY BULLETIN

Shiraia sp. Slf14 III

Simon et al. Supplemental Data Page 1

< (0.999) Graft (0.698) (0.483) <0.001 (0.698) (<0.001) (<0.001) 3 months (0.999) (0.483) (<0.001) 6 months (<0.

Octretide joint proton pump inhibitors in treating non-variceal gastrointestinal bleeding a Metaanalysis

Optimizing Microwave-assisted Extraction Process for Paprika Red Pigments Using Response Surface Methodology

ΑΜΦΙΚΟΙΛΙΑΚΗ ΒΗΜΑΤΟΔΟΤΗΣΗ

Supplementary Table 1. Primers used for RT-qPCR analysis of striatal and nigral tissue.

TGFp FSH INH INH

Christopher Stephen Inchley, 2015

ΠΡΟΓΡΑΜΜΑ ΜΕΤΑΠΤΥΧΙΑΚΩΝ ΣΠΟΥΔΩΝ ΣΤΙΣ «ΚΛΙΝΙΚΕΣ ΚΑΙ ΚΛΙΝΙΚΟΕΡΓΑΣΤΗΡΙΑΚΕΣ ΙΑΤΡΙΚΕΣ ΕΙΔΙΚΟΤΗΤΕΣ»

MSM Men who have Sex with Men HIV -

Chapter 1. Fingolimod attenuates ceramide induced blood-brain barrier dysfunction in multiple sclerosis by targeting reactive astrocytes

Science of Sericulture

CPT. Tsuchiya. beta. quantitative RT PCR QIAGEN IGFBP. Fect Transfection Reagent sirna. RT PCR RNA Affymetrix GeneChip Expression Array

α α Pneumocystis jirovecii

Παιδιατρική ΒΟΡΕΙΟΥ ΕΛΛΑΔΟΣ, 23, 3. Γ Παιδιατρική Κλινική, Αριστοτέλειο Πανεπιστήμιο, Ιπποκράτειο Νοσοκομείο Θεσσαλονίκης, 2

SUPPLEMENTARY INFORMATION

Comparison of HPLC fingerprint between enzymatic Calculus bovis and natural Calculus bovis

Supplementary Figure 1

Comparison of carbon-sulfur and carbon-amine bond in therapeutic drug: -S-aromatic heterocyclic podophyllum derivatives display antitumor activity

Heart failure: Therapy in 2012 ΓΕΏΡΓΙΟΣ Κ ΕΥΘΥΜΙΑΔΗΣ ΚΑΡΔΙΟΛΟΓΟΣ

ΓΕΝΙΚΕΣ ΑΡΧΕΣ ΑΝΟΣΟΠΑΘΟΓΕΝΕΙΑΣ ΣΤΗ ΣΗΨΗ

A strategy for the identification of combinatorial bioactive compounds. contributing to the holistic effect of herbal medicines

c Key words: cultivation of blood, two-sets blood culture, detection rate of germ Vol. 18 No

PNS mg kg - 1. Rb 1

Εισαγωγή στη Real Time PCR. Καραπέτσας Θανάσης PhD, MSc

DOI: /j.cnki.cjcpe APD RVOT I NCX tail RVOT RVOT RVOT RVOT APD RVOT RVOT RVOT RVOT APD RVOT

ADI TS2 A

Study on Purification Technology and Antioxidant Activity of Total Flavonoid from Eriobotryae Folium

DC-CIK. Tca8113, [ ] (2011) CIK, Tca8113. Tca8113 DC CIK DC-CIK ; t (P=0.0132); , SAS Tca8113

ΑΝΕΠΑΡΚΕΙΑ ΑΟΡΤΗΣ ΚΑΙ ΔΥΣΛΕΙΤΟΥΡΓΙΑ ΑΡΙΣΤΕΡΑΣ ΚΟΙΛΙΑΣ

2. Η Βαρύτητα Διαφόρων Γλυκαιμικών Δεικτών Νοσηλείας στην Λειτουργική Έκβαση του ΑΕΕ των Διαβητικών Ασθενών

ΙΔΡΥΜΑ. Θεσσαλονίκη, ύλα

Accumulation of Soil Arsenic by Panax notoginseng and Its Associated Health Risk

The effect of curcumin on the stability of Aβ. dimers

, SLC26A4 HEK 293. The construction of wild-type SLC26A4 gene expression vector and the expression in HEK293 cells

Journal of Ningxia Medical University BRCA2. M2610I 2405 delt stp ± t = P > %

Study on the Strengthen Method of Masonry Structure by Steel Truss for Collapse Prevention

Rapid determination of soluble reactive silicate in seawater by flow injection analysis with spectrophotometric detection and its application

Differences in Contents of Neutral Aroma Components and Sensory Evaluation in Air-cured Burley Leaves from Different Curing Barns

Οι επιδόσεις Ελλήνων στο Mini Mental State Examination με βάση την ηλικία και τη νοητική κατάσταση από την παιδική στην τρίτη ηλικία.

The influence of various blood purification methods on intradialytic hypotension in maintenance dialysis

# Effect of PPAR-α agonist on adipokines expression in rats fed with high-fat diet LI yan#, HUANG bin, CHENG hua, LIANG zhen, LIU shan-ying

PE CVVH PE+HP HP+CVVH HP+CVVH+PE CVVH. ENLAV of HCO - 3 ENLAV-HCO ± μmol /L HP+PE HP+CVVH HP+CVVH+PE

*,* + -+ on Bedrock Bath. Hideyuki O, Shoichi O, Takao O, Kumiko Y, Yoshinao K and Tsuneaki G

http / / cjbmb. bjmu. edu. cn Chinese Journal of Biochemistry and Molecular Biology human telomerase reverse transcriptase htert

ΑΘΛΗΤΙΣΜΟΣ και ΥΠΕΡΤΑΣΗ

Journal of Ningxia Medical University. Annexin P19 mrna P < AnnexinA2 P19 mrna. AnnexinA2 P19 mrna. PCR 1.

Survivin sirna. Inhibitory effect of small interference RNA targeting survivin nanospheres on human pancreatic carcinoma BXPC-3 cell growth

Cinnamaldehyde Prevents Endothelial Dysfunction Induced by High Glucose by Activating Nrf2

HIV HIV HIV HIV AIDS 3 :.1 /-,**1 +332

Supporting Information

Supporting Information

rp, ribosomal protein 60S rp mrna rpl30 rps14 RT-PCR mrna nonsense-mediated mrna decay smg-2 smg-2 mrna rp rpl-1 rpl-1

Απεικονιστική εκτίμηση της Δεξιάς Κοιλίας. Κων/νος Φαρσαλινός Ωνάσειο Καρδιοχειρουργικό Κέντρο

Πτυχιακή Εργασία Η ΠΟΙΟΤΗΤΑ ΖΩΗΣ ΤΩΝ ΑΣΘΕΝΩΝ ΜΕ ΣΤΗΘΑΓΧΗ

ΚΕΡΚΙΔΙΚΗ ΚΑΙ ΜΗΡΙΑΙΑ ΠΡΟΣΠΕΛΑΣΗ ΣΕ ΣΤΕΦΑΝΙΟΓΡΑΦΙΕΣ ΚΑΙ ΑΓΓΕΙΟΠΛΑΣΤΙΚΕΣ. ΜΙΑ ΣΥΓΚΡΙΤΙΚΗ ΜΕΛΕΤΗ

Biapenem BIPM Lot No g mg

Abstract... I. Zusammenfassung... II. 1 Aim of the work Introduction Short overview of Chinese hamster ovary cell lines...

Supporting Information

ATR12181 , , AT1 : R : A : (2007) ATR SHR ( 10 mg kg - 1 d - 1 ) , AT1R c2fos c2jun,

Modulation of immunol-properties by chito-oligosaccharide

Electrolyzed-Reduced Water as Artificial Hot Spring Water

The toxicity of three chitin synthesis inhibitors to Calliptamus italicus Othoptera Acridoidea

Mitomycin C application for the prevention of postoperative synechiae formation at the anterior commissure.

Supplementary Information. Living Ring-Opening Polymerization of Lactones by N-Heterocyclic Olefin/Al(C 6 F 5 ) 3

Παρουσίαση ερευνητικού έργου

Identification of Fish Species using DNA Method

Μελέτη της έκφρασης του ογκοκατασταλτικού γονιδίου Cyld στον καρκίνο του μαστού

Motion analysis and simulation of a stratospheric airship

(Fenneropenaeus chinensis)

Παρουσίαση περιστατικού: Φαρμακευτική πολυπεκτομή με μακροχρόνια λήψη μοντελουκάστης.

1-4 certified reference material CRM. DSC HPLC ± 0. 4 % k = 2 P = GBW

VBA Microsoft Excel. J. Comput. Chem. Jpn., Vol. 5, No. 1, pp (2006)

CHAPTER INTRODUCTION... 1 CHAPTER REVIEW OF LITERATURE...

Ελκώδης Κολίτιδα: Χαρακτηριστικά της νόσου και Θεραπευτικοί στόχοι

Comparison of Evapotranspiration between Indigenous Vegetation and Invading Vegetation in a Bog

GDNF 220YL) 2,52. (glial cell line2de2. 015d 15d rived neurotrophic factor GDNF) 1993 Lin B49 (L15) (FBS) (poly2l2lysin, pll) (laminin, LN) GDNF GDNF

Πρώιμη και όψιμη ΙΦΝΕ: διαφορετικός φαινότυπος, διαφορετικά μονοπάτια στη φλεγμονή; Γ. Μπάμιας

Ankylosing Spondylitis AS. NSAIDs. NSAIDs 100% B27 NSAID ~ 90% FDA EMA

Metal-free Oxidative Coupling of Amines with Sodium Sulfinates: A Mild Access to Sulfonamides

microrna126 GATA mg /kg 800 November 2013 Vol. 35 No. 11 Chinese Traditional Patent Medicine 10% 5% GATA-3 40 BALB /c GATA-3 TH2 NA126

1 h, , CaCl 2. pelamis) 58.1%, (Headspace solid -phase microextraction and gas chromatography -mass spectrometry,hs -SPME - Vol. 15 No.

Transcript:

744 Chinese Journal of Pathophysiology 2015 31 4744-749 1000-4718 2015 04-0744-06 IL-19 * 12 1 12 2 2 1 1 361102 2 361004 19 interleukin-19 IL-19 experimental autoimmune myocarditis EAM EAM 6 IL-19 17 PCR atrial natriuretic peptide ANP brain natriuretic peptide BNP IL-18 IL-1β IL-12p35 IFN-γ IL-19 ANP BNP IL-19 19 R363. 2 A doi 10. 3969 /j. issn. 1000-4718. 2015. 04. 030 Effect of intravenous injecting plasmid encoding interleukin-19-igg on experimental autoimmune myocarditis in rats CHANG He 12 ZHAO Fa-yun 1 WANG Yan 12 LI Gang 2 ZHANG Le 2 ZOU Jun 1 1 Xiamen University Medical CollegeXiamen 361102China 2 Xiamen Heart CenterXiamen 361004China. E-mail zoujun@ xmu. edu. cn ABSTRACTAIM To evaluate the effect of intravenous injecting plasmid encoding interleukin-19-igg on experimental autoimmune myocarditis EAM in rats. METHODS Cardiac myosin was emulsified with equal volume of complete Freund s adjuvant. The animal model of EAM was established by injecting with the preparation in both footpads of the Lewis rats. The rats were intravenously injected with the plasmid encoding IL-19-IgG on day 6. Echocardiography was performed before the rats were sacrificed on day 17. The effect of IL-19-IgG plasmid injection was evaluated by measuring the heart weight /body weightmyocarditis arearelative expression levels of atrial natriuretic peptide ANP and brain natriuretic peptide BNP in the hearts. The mrna expression levels of related cytokines including IL-18IL-1βIL-12p35 and IFN-γ were detected. RESULTS The rats in model group showed significant myocardial damage and a decrease in the left ventricular functions. The rats in the treatment group injected with IL-19-IgG plasmid showed an improvement of the cardiac functions. The ratio of heart weight /body weightthe area of myocarditis and the mrna levels of ANP and BNP were significantly lower in IL-19-IgG treatment group than those in model group. The mrna levels of IL-18IL-1βIL- 12p35 and IFN-γ were also significantly decreased in IL-19-IgG treatment group. CONCLUSION Intravenous injection of plasmid encoding IL-19-IgG effectively prevents the development of the left ventricular remodeling and myocardial damage in EAM rats. KEY WORDSInterleukin-19 Autoimmune myocarditis 2014-10-27 2014-12-26 * No. 81270294 No. 2013-ZQN-ZD-37 No. 2012J01415 Tel 0592-2181330 E-mail zoujun@ xmu. edu. cn 1

745 Master Mix FermantasKod Plus 10 Kod Plus buffer Not I Swa I E. coli JM109 1 TaKaRaDEPC Solarbio T B SYBR qpcr Mix Toyobo TaKaRa experimental autoimmune myocarditis EAM 2 Th1 /Th2 EAM 2. 1 pcaggs-igg Fc 19 interleukin-19 IL-19 pcaggs-il-19-igg Fc Kod Plus DNA Toyobo IL-19 2 IL-20R1 / IL-20R2 IL-20 IL-24 PCR Not I Swa I IL-10 2 IL-10 E. coli JM 109 IL-10 B 37 16 h PCR DC T PCR IL-19 IL-19 Omega IL-1β IL-6 2 g /L IL-8 CCL5 CXCL9 2. 2 EAM 3 Th1 Th2 0. 3 mol /L KCl 10 g /L Th1 Th2 IL-19 10 g /L 4 IL-19 EAM 0. 2 ml EAM + SP-IgG EAM + IL-19-IgG IL-19 9 2. 3 6 5 800 IL-19 μg 400 μl pcaggs-sp-igg Fc pcaggs-il-19-igg 80 ml /kg 15 s 24 h 3 6 RNA cd- NA cdna 0. 5 μl 20 μl PCR 1 8 Lewis 180 ~ 200 g cdna 5 μl 1 μl 2% 120 V 20 SCXK 2002-003 min IL-19 SP mrna BeckmanC1000 2. 4 17 PCR Bio-Rad7500 10% 3 ml /kg PCR ABI Cell Biosciences 14. 0 MHz M complete Freund s adjuvant left ventricular CFADifcoTrizol Invitrogen Revert Aid First Strand cdna Kit Dream Taq Green PCR Oxoid OmegaThunderbird pcaccs-sp-igg Fc 1 EAM cdna pcacggs-igg Fc Taq DNA Fermantas 1 GE Vivid7 end-diastolic internal diameter LVEDd left ventricular end-systolic internal diameterlv-

746 EDs interventricular septal thicknessnatriuretic peptide ANP brain natriuretic IVS left ventricular posterior wall thickness LVPW left ventricular fractional shortening LVFS ejection frac- tions EF 2. 5 17 RNA 2 μg cdna -3- glyceraldehyde-3-phosphate dehydrogenasegap- 5 mm DH 20 μl PCR ABI 10% 7500 PCR 95 10 HE 0 ~ 4 min 95 15 s 60 1 min 40 95 15 s 0 1 < 5% 2 60 1 min 95 15 s 60 15 s ANP BNP 5% ~ 10% 3 10% ~ IL-18 IL-1β IL-12p35 IFN-γ 20% 4 > 20% 7 2. 6 Real-time PCR atrial 1 Table 1. peptide BNP mrna Trizol RNA DEPC RNA A 260 /A 280 1. 8 ~ 2. 0 TaKaRa 1 IL-19 The primers for real-time PCR Name Sense primer Anti-sense primer IL-19 5 -ttcatttaaatggtgttcgttctctgctcagtt-3 5 -gcatcgcggccgccagacgtttcctgatgattcct -3 SP 5 -ttcatttaaatgccttcaccatgaagtccag-3 5 -gcatcgcggccgctgtctccaacagcatttcctta -3 ANP 5 -atggatttcaagaacctgctaga-3 5 -gctccaatcctgtcaatcctac-3 BNP 5 -gatgattctgctcctgcttttc-3 5 -gccatttcctctgacttttctc-3 IFN-γ 5 -gaaagacaaccaggccatcag-3 5 -tcatgaatgcatccttttttgc-3 IL-1β 5 -gctagtgtgtgatgttcccattag-3 5 -cttttccatcttcttctttgggta-3 IL-12p35 5 - agacatcacacgggacaaaac -3 5 -cacagggtcatcatcaaagaag-3 IL-18 5 -atcagaccactttggcagactt-3 5 - cttccatccttcacagataggg-3 GAPDH 5 -atcaccatcttccaggagcga-3 5 - agccttctccatggtggtgga-3 3 ± mean ± SD SPSS 16. 0 P < 0. 05 1 IL-19 EAM 24 h RT-PCR Figure 1. EAM SP IL-19 SP-IgG IL- 1 19-IgG 1 2 The mrna expression of SP and IL-19 in the liver tissues of the rats with experimental autoimmune myocarditis EAM determined by RT-PCR. SP-IgG IL-19-IgG 17 HE IgG EAM + SP-IgG 3 EAM + SP-IgG 3 EAM + IL-19-IgG 17 2 EAM + SP- EAM + SP-IgG LVEDd LVESd IgG EAM + IL-19- LVPWIVS LVEF LVFS

747 EAM + SP-IgG EAM + IL-19- IgG LVPW IVS LVEF LVFS 2 4 ANP BNP 17 RNA cdna PCR ANP BNP Figure 2. The histopathological images of the hearts with experimental autoimmune myocarditis EAM. EAM + SP-IgG ANP BNP EAM + IL-19-Ig 2 EAM EAM + SP-IgG ANP BNP Figure 3. The heart weight /body weight A and myocarditis area B in the rats with experimental autoimmune myocarditis EAM. Mean ± SD. n = 6. * P < 0. 05 ** P < 0. 01 vs EAM + SP-IgG. 3 2 Table 2. Evaluation of the heart functions in the rats with experimental autoimmune myocarditis EAM by echocardiography Mean ± SD. n = 6 Cardiac function Normal EAM + SP-IgG EAM + IL-19-IgG LVEDd mm 6. 575 ± 0. 131 7. 051 ± 0. 137 7. 090 ± 0. 219 LVESd mm 3. 990 ± 0. 115 4. 872 ± 0. 115 5. 000 ± 0. 182 LVPW mm 1. 359 ± 0. 036 1. 767 ± 0. 196 1. 265 ± 0. 068 * IVS mm 1. 350 ± 0. 049 1. 566 ± 0. 117 1. 237 ± 0. 067 * LVEF % 75. 460 ± 1. 057 52. 780 ± 4. 201 63. 420 ± 2. 034 * LVFS % 41. 000 ± 1. 067 26. 280 ± 1. 493 30. 380 ± 0. 856 * * P < 0. 05 vs EAM + SP-IgG. 4 EAM + IL-19-IgG EAM + SP-IgG Liu 6 Zhang 8 IL-18 IL-1β IL-12p35 IFN-γ EAM + IL-19-IgG EAM + SP-IgG IL-18 IL-1β IL-12p35 IFNγ 5 EAM + IL- 19-IgG PCAGGS Ig-Fc IL-19 IL-19 EAM IL-19

748 Figure 4. 4 The relative mrna expression of ANP A and BNP B in the rat myocardium of the rats with experimental autoimmune myocarditis EAM. Mean ± SD. n = 6. * P < 0. 05 ** P < 0. 01 vs EAM + SP-IgG. ANP BNP mrna Figure 5. 5 The relative mrna expression of IL-18 IL-1β IL-12p35 and IFN-γ in the myocardium of the rats with experimental autoimmune myocarditis EAM. Mean ± SD. n = 6. IL-18 IL-1β IL-12p35 IFN-γ * P < 0. 05 ** P < 0. 01 vs EAM + SP-IgG. IL-19 IL-18 IL-1β IL-12p35 Th1 /Th2 IFN-γ IL-19 IL-10 IL-10 IL-10 EAM 9 EAM EAM IL-1 IL-19-IgG IL-19-IgG EAM / B NK ANP BNP mrna IL-19 2 IL-1α

749 IL-1β 2Sabat RWallace EEndesfelder Set al. IL-19 and IL- IL-1α IL-1β 20 two novel cytokines with importance in inflammatory diseases J. Expert Opin Ther Targets200711 5 601-612. EAM 14 IL-1β 3Hsing CHChiu CJChang LYet al. IL-19 is involved IL-1β ILin the pathogenesis of endotoxic shock J. Shock2008 12 29 17-15. DC IL-12 Th1 4Azuma YTNakajima HTakeuchi T. IL-19 as a potential Th0 Th1 IFN-γ therapeutic in autoimmune and inflammatory diseases J. Th2 10 IL-18 IFN-γ Curr Pharm Des201117 343776-3780. 5. IL-19 IL-1 Th1 IL-18 IL-12 T NK 6Liu FSong YLiu D. Hydrodynamics-based transfection IFN-γ Th1 Th1 in animals by systemic administration of plasmid DNA J. IFN-γ EAM Gene Ther19996 71258-1266. EAM IL-19 7. Lewis Th J. Th2 200723 3536-539. 8Zhang GBudker VWolff JA. High levels of foreign IL-19 gene expression in hepatocytes after tail vein injections of naked plasmid DNAJ. Hum Gene Ther199910 IL-19 Azuma 101735-1737. 11 IL-19 - / - DSS 9Oral HBKotenko SVYilmaz Met al. Regulation of T cells and cytokines by the interleukin-10 IL-10 -family cytokines IL-19IL-20IL-22IL-24 and IL-26 J. Eur IL-19 J Immunol200636 2380-388. 12 10Afanasyeva MWang YKaya Zet al. Interleukin-12 receptor / STAT4 signaling is required for the development of IL-19 MAPK autoimmune myocarditis in mice by an interferon-gammaindependent pathwayj. Circulation2001104 25 IL-19 IL-19 mrna 3145-3151. 13 IL-19 11Azuma YTMatsuo YKuwamura Met al. Interleukin- CD4 + T Th2 19 protects mice from innate-mediated colonic inflammation J. Inflamm Bowel Dis201016 61017-1028. IL-19 IL-10 IL-19 T IFN-γ IL-4 IL-13 14 12Canto EGarcia Planella EZamora-Atenza Cet al. Interleukin-19 impairment in active Crohn s disease patients IL-19 J. PLoS One20149 4e93910. IL-6 TNF-α 13Cuneo AAHerrick DAutieri MV. IL-19 reduces VSMC IL-19 2 IL-20R1 /IL-20R2 activation by regulation of mrna regulatory factor HuR IL-19 and reduction of mrna stability J. J Mol Cell Cardiol IL-19 201049 4647-654. IL-19 14Jordan WJEskdale JBoniotto Met al. Human IL-19 regulates immunity through auto-induction of IL-19 and 15 production of IL-10J. Eur J Immunol200535 5 1576-1582. 15Gallagher G. Interleukin-19 multiple roles in immune 1Leuschner FKatus HAKaya Z. Autoimmune myocarditis pastpresent and future J. J Autoimmun 2009 33 3-4282-289. J. 2012 28 129-34. regulation and diseasej. Cytokine Growth Factor Rev 201021 5345-352.