744 Chinese Journal of Pathophysiology 2015 31 4744-749 1000-4718 2015 04-0744-06 IL-19 * 12 1 12 2 2 1 1 361102 2 361004 19 interleukin-19 IL-19 experimental autoimmune myocarditis EAM EAM 6 IL-19 17 PCR atrial natriuretic peptide ANP brain natriuretic peptide BNP IL-18 IL-1β IL-12p35 IFN-γ IL-19 ANP BNP IL-19 19 R363. 2 A doi 10. 3969 /j. issn. 1000-4718. 2015. 04. 030 Effect of intravenous injecting plasmid encoding interleukin-19-igg on experimental autoimmune myocarditis in rats CHANG He 12 ZHAO Fa-yun 1 WANG Yan 12 LI Gang 2 ZHANG Le 2 ZOU Jun 1 1 Xiamen University Medical CollegeXiamen 361102China 2 Xiamen Heart CenterXiamen 361004China. E-mail zoujun@ xmu. edu. cn ABSTRACTAIM To evaluate the effect of intravenous injecting plasmid encoding interleukin-19-igg on experimental autoimmune myocarditis EAM in rats. METHODS Cardiac myosin was emulsified with equal volume of complete Freund s adjuvant. The animal model of EAM was established by injecting with the preparation in both footpads of the Lewis rats. The rats were intravenously injected with the plasmid encoding IL-19-IgG on day 6. Echocardiography was performed before the rats were sacrificed on day 17. The effect of IL-19-IgG plasmid injection was evaluated by measuring the heart weight /body weightmyocarditis arearelative expression levels of atrial natriuretic peptide ANP and brain natriuretic peptide BNP in the hearts. The mrna expression levels of related cytokines including IL-18IL-1βIL-12p35 and IFN-γ were detected. RESULTS The rats in model group showed significant myocardial damage and a decrease in the left ventricular functions. The rats in the treatment group injected with IL-19-IgG plasmid showed an improvement of the cardiac functions. The ratio of heart weight /body weightthe area of myocarditis and the mrna levels of ANP and BNP were significantly lower in IL-19-IgG treatment group than those in model group. The mrna levels of IL-18IL-1βIL- 12p35 and IFN-γ were also significantly decreased in IL-19-IgG treatment group. CONCLUSION Intravenous injection of plasmid encoding IL-19-IgG effectively prevents the development of the left ventricular remodeling and myocardial damage in EAM rats. KEY WORDSInterleukin-19 Autoimmune myocarditis 2014-10-27 2014-12-26 * No. 81270294 No. 2013-ZQN-ZD-37 No. 2012J01415 Tel 0592-2181330 E-mail zoujun@ xmu. edu. cn 1
745 Master Mix FermantasKod Plus 10 Kod Plus buffer Not I Swa I E. coli JM109 1 TaKaRaDEPC Solarbio T B SYBR qpcr Mix Toyobo TaKaRa experimental autoimmune myocarditis EAM 2 Th1 /Th2 EAM 2. 1 pcaggs-igg Fc 19 interleukin-19 IL-19 pcaggs-il-19-igg Fc Kod Plus DNA Toyobo IL-19 2 IL-20R1 / IL-20R2 IL-20 IL-24 PCR Not I Swa I IL-10 2 IL-10 E. coli JM 109 IL-10 B 37 16 h PCR DC T PCR IL-19 IL-19 Omega IL-1β IL-6 2 g /L IL-8 CCL5 CXCL9 2. 2 EAM 3 Th1 Th2 0. 3 mol /L KCl 10 g /L Th1 Th2 IL-19 10 g /L 4 IL-19 EAM 0. 2 ml EAM + SP-IgG EAM + IL-19-IgG IL-19 9 2. 3 6 5 800 IL-19 μg 400 μl pcaggs-sp-igg Fc pcaggs-il-19-igg 80 ml /kg 15 s 24 h 3 6 RNA cd- NA cdna 0. 5 μl 20 μl PCR 1 8 Lewis 180 ~ 200 g cdna 5 μl 1 μl 2% 120 V 20 SCXK 2002-003 min IL-19 SP mrna BeckmanC1000 2. 4 17 PCR Bio-Rad7500 10% 3 ml /kg PCR ABI Cell Biosciences 14. 0 MHz M complete Freund s adjuvant left ventricular CFADifcoTrizol Invitrogen Revert Aid First Strand cdna Kit Dream Taq Green PCR Oxoid OmegaThunderbird pcaccs-sp-igg Fc 1 EAM cdna pcacggs-igg Fc Taq DNA Fermantas 1 GE Vivid7 end-diastolic internal diameter LVEDd left ventricular end-systolic internal diameterlv-
746 EDs interventricular septal thicknessnatriuretic peptide ANP brain natriuretic IVS left ventricular posterior wall thickness LVPW left ventricular fractional shortening LVFS ejection frac- tions EF 2. 5 17 RNA 2 μg cdna -3- glyceraldehyde-3-phosphate dehydrogenasegap- 5 mm DH 20 μl PCR ABI 10% 7500 PCR 95 10 HE 0 ~ 4 min 95 15 s 60 1 min 40 95 15 s 0 1 < 5% 2 60 1 min 95 15 s 60 15 s ANP BNP 5% ~ 10% 3 10% ~ IL-18 IL-1β IL-12p35 IFN-γ 20% 4 > 20% 7 2. 6 Real-time PCR atrial 1 Table 1. peptide BNP mrna Trizol RNA DEPC RNA A 260 /A 280 1. 8 ~ 2. 0 TaKaRa 1 IL-19 The primers for real-time PCR Name Sense primer Anti-sense primer IL-19 5 -ttcatttaaatggtgttcgttctctgctcagtt-3 5 -gcatcgcggccgccagacgtttcctgatgattcct -3 SP 5 -ttcatttaaatgccttcaccatgaagtccag-3 5 -gcatcgcggccgctgtctccaacagcatttcctta -3 ANP 5 -atggatttcaagaacctgctaga-3 5 -gctccaatcctgtcaatcctac-3 BNP 5 -gatgattctgctcctgcttttc-3 5 -gccatttcctctgacttttctc-3 IFN-γ 5 -gaaagacaaccaggccatcag-3 5 -tcatgaatgcatccttttttgc-3 IL-1β 5 -gctagtgtgtgatgttcccattag-3 5 -cttttccatcttcttctttgggta-3 IL-12p35 5 - agacatcacacgggacaaaac -3 5 -cacagggtcatcatcaaagaag-3 IL-18 5 -atcagaccactttggcagactt-3 5 - cttccatccttcacagataggg-3 GAPDH 5 -atcaccatcttccaggagcga-3 5 - agccttctccatggtggtgga-3 3 ± mean ± SD SPSS 16. 0 P < 0. 05 1 IL-19 EAM 24 h RT-PCR Figure 1. EAM SP IL-19 SP-IgG IL- 1 19-IgG 1 2 The mrna expression of SP and IL-19 in the liver tissues of the rats with experimental autoimmune myocarditis EAM determined by RT-PCR. SP-IgG IL-19-IgG 17 HE IgG EAM + SP-IgG 3 EAM + SP-IgG 3 EAM + IL-19-IgG 17 2 EAM + SP- EAM + SP-IgG LVEDd LVESd IgG EAM + IL-19- LVPWIVS LVEF LVFS
747 EAM + SP-IgG EAM + IL-19- IgG LVPW IVS LVEF LVFS 2 4 ANP BNP 17 RNA cdna PCR ANP BNP Figure 2. The histopathological images of the hearts with experimental autoimmune myocarditis EAM. EAM + SP-IgG ANP BNP EAM + IL-19-Ig 2 EAM EAM + SP-IgG ANP BNP Figure 3. The heart weight /body weight A and myocarditis area B in the rats with experimental autoimmune myocarditis EAM. Mean ± SD. n = 6. * P < 0. 05 ** P < 0. 01 vs EAM + SP-IgG. 3 2 Table 2. Evaluation of the heart functions in the rats with experimental autoimmune myocarditis EAM by echocardiography Mean ± SD. n = 6 Cardiac function Normal EAM + SP-IgG EAM + IL-19-IgG LVEDd mm 6. 575 ± 0. 131 7. 051 ± 0. 137 7. 090 ± 0. 219 LVESd mm 3. 990 ± 0. 115 4. 872 ± 0. 115 5. 000 ± 0. 182 LVPW mm 1. 359 ± 0. 036 1. 767 ± 0. 196 1. 265 ± 0. 068 * IVS mm 1. 350 ± 0. 049 1. 566 ± 0. 117 1. 237 ± 0. 067 * LVEF % 75. 460 ± 1. 057 52. 780 ± 4. 201 63. 420 ± 2. 034 * LVFS % 41. 000 ± 1. 067 26. 280 ± 1. 493 30. 380 ± 0. 856 * * P < 0. 05 vs EAM + SP-IgG. 4 EAM + IL-19-IgG EAM + SP-IgG Liu 6 Zhang 8 IL-18 IL-1β IL-12p35 IFN-γ EAM + IL-19-IgG EAM + SP-IgG IL-18 IL-1β IL-12p35 IFNγ 5 EAM + IL- 19-IgG PCAGGS Ig-Fc IL-19 IL-19 EAM IL-19
748 Figure 4. 4 The relative mrna expression of ANP A and BNP B in the rat myocardium of the rats with experimental autoimmune myocarditis EAM. Mean ± SD. n = 6. * P < 0. 05 ** P < 0. 01 vs EAM + SP-IgG. ANP BNP mrna Figure 5. 5 The relative mrna expression of IL-18 IL-1β IL-12p35 and IFN-γ in the myocardium of the rats with experimental autoimmune myocarditis EAM. Mean ± SD. n = 6. IL-18 IL-1β IL-12p35 IFN-γ * P < 0. 05 ** P < 0. 01 vs EAM + SP-IgG. IL-19 IL-18 IL-1β IL-12p35 Th1 /Th2 IFN-γ IL-19 IL-10 IL-10 IL-10 EAM 9 EAM EAM IL-1 IL-19-IgG IL-19-IgG EAM / B NK ANP BNP mrna IL-19 2 IL-1α
749 IL-1β 2Sabat RWallace EEndesfelder Set al. IL-19 and IL- IL-1α IL-1β 20 two novel cytokines with importance in inflammatory diseases J. Expert Opin Ther Targets200711 5 601-612. EAM 14 IL-1β 3Hsing CHChiu CJChang LYet al. IL-19 is involved IL-1β ILin the pathogenesis of endotoxic shock J. Shock2008 12 29 17-15. DC IL-12 Th1 4Azuma YTNakajima HTakeuchi T. IL-19 as a potential Th0 Th1 IFN-γ therapeutic in autoimmune and inflammatory diseases J. Th2 10 IL-18 IFN-γ Curr Pharm Des201117 343776-3780. 5. IL-19 IL-1 Th1 IL-18 IL-12 T NK 6Liu FSong YLiu D. Hydrodynamics-based transfection IFN-γ Th1 Th1 in animals by systemic administration of plasmid DNA J. IFN-γ EAM Gene Ther19996 71258-1266. EAM IL-19 7. Lewis Th J. Th2 200723 3536-539. 8Zhang GBudker VWolff JA. High levels of foreign IL-19 gene expression in hepatocytes after tail vein injections of naked plasmid DNAJ. Hum Gene Ther199910 IL-19 Azuma 101735-1737. 11 IL-19 - / - DSS 9Oral HBKotenko SVYilmaz Met al. Regulation of T cells and cytokines by the interleukin-10 IL-10 -family cytokines IL-19IL-20IL-22IL-24 and IL-26 J. Eur IL-19 J Immunol200636 2380-388. 12 10Afanasyeva MWang YKaya Zet al. Interleukin-12 receptor / STAT4 signaling is required for the development of IL-19 MAPK autoimmune myocarditis in mice by an interferon-gammaindependent pathwayj. Circulation2001104 25 IL-19 IL-19 mrna 3145-3151. 13 IL-19 11Azuma YTMatsuo YKuwamura Met al. Interleukin- CD4 + T Th2 19 protects mice from innate-mediated colonic inflammation J. Inflamm Bowel Dis201016 61017-1028. IL-19 IL-10 IL-19 T IFN-γ IL-4 IL-13 14 12Canto EGarcia Planella EZamora-Atenza Cet al. Interleukin-19 impairment in active Crohn s disease patients IL-19 J. PLoS One20149 4e93910. IL-6 TNF-α 13Cuneo AAHerrick DAutieri MV. IL-19 reduces VSMC IL-19 2 IL-20R1 /IL-20R2 activation by regulation of mrna regulatory factor HuR IL-19 and reduction of mrna stability J. J Mol Cell Cardiol IL-19 201049 4647-654. IL-19 14Jordan WJEskdale JBoniotto Met al. Human IL-19 regulates immunity through auto-induction of IL-19 and 15 production of IL-10J. Eur J Immunol200535 5 1576-1582. 15Gallagher G. Interleukin-19 multiple roles in immune 1Leuschner FKatus HAKaya Z. Autoimmune myocarditis pastpresent and future J. J Autoimmun 2009 33 3-4282-289. J. 2012 28 129-34. regulation and diseasej. Cytokine Growth Factor Rev 201021 5345-352.