23 6 2003 11 ACTA SCIENTIAE CIRCUMSTANTIAE Vol. 23,No. 6 Nov.,2003 :025322468 (2003) 0620705206 :X703 :A ERIC2PCR 1,2, 3, 2 3 (11, 030006 ; 21,, 200240 ; 31, 030024) : ERIC2PCR,. 3 d 1, 8, 35153 mgπl 132182 mgπl, 0196 mgπl 34175 mgπl,cod Cr 1044110 mgπl, 7930190 mgπl. 4 COD Cr,. 2 ERIC2PCR (C s ) 9411 % 9616 %, 1177 2134 1160 2116, ERIC2PCR,. : ; ; ERIC2PCR Analysis of the microbial community of activated sludge in different aera2 tion basins within an industrial phenol remediation system by ERIC2PCR fingerprinting GAO Pingping 1,2, ZHAO Yi 3, ZHAO Liping 2 (11Institute of Biotechnology,Shanxi University,Taiyuan 030006 ; 21School of Life Science and Biotechnology, Lab of Molecular Microbial Ecology and Genomics, Shanghai Jiao Tong University,Shanghai 200240 ; 31D2 epartment of Environmental Engineering,Taiyuan University of Technology,Taiyuan 030024) Abstract :The occurrence, settleability and activity of activated sludge in first (TJ1) and second (TJ2) aeration basin in a AB process based industrial phenol remediation system were analyzed by ERIC2PCR( Enterobacterial Repetitive Intergenic Consensus2PCR) fingerprinting com2 bined with activated sludge characterization (SV 30 MLSS SVI), and major pollutants (phenol, cyanide and COD Cr ) measurements. During the monitoring period (one sampling every three days for 8 continuous samplings, M1 M8), the concentrations of primary pollutants in the influent fluctuated from 35153 mgπl to 132182 mgπl for phenol, between 0196 mgπl to 34175 mgπl for cyanide and from 1044110 mgπl to 7930190 mgπl for COD Cr 1 The presence of a pollution shock caused by mineral oil contamination occurred at M4 monitoring stage resulted in a dramatic decrease in activated sludge settleability and COD Cr removal efficiency. The introduction of this loading shock had no significant im2 pact on the system s ability to degrade phenol and cyanide. ERIC2PCR banding patterns of activated sludge samples at 8 stages showed a mean C s value of 9411 % within TJ1 and 9616 % within TJ2, Shannon2Weaver indices of 1177 2134 in TJ1 and 1160 2116 in TJ2. Populations in the system detected by ERIC2PCR fingerprinting were thus fairly stable. The stability of the ERIC2PCR amplifiable populations in activated sludge may serve as the basis for relatively stable removal efficiency of phenol and cyanide during the monitoring period. Keywords :activated sludge ; bacterial community structure ; ERIC2PCR :2003201228 ; :2003203210 : ( 863 ) (No. SZ203201204,2001AA214131) : (1957 ),, 3 E2mail :LPZhao @mail. sjtu. edu. cn
706 23 [1,2 ],,. [3 ].,,,, [4 ]., 16S rdna (DGGEΠTGGE) [1,2,4 (RFLP) 6 ]., DNA,.,. ERIC( Enterobacterial Repetitive Intergenic Consensus, ) 126bp, [7 ]. (44bp), [8 DNA, ERIC2PCR 10 ]. ERIC2PCR,, [10,11 ]., ERIC2PCR AB. 1 111. (AB), (TJ1),,, 90 % 99 % 70 % 95 %,COD Cr 70 %. 2 (TJ2) 1,. 3 d 1, 8, M1 M8. TJ1 TJ2, TJ1 TJ2. 112 (SV 30 ), (MLSS) (SVI) [12 ]. 42 ; 2 ;COD Cr [12 ]. 113 DNA DNA DNA [13 ]. DyNA Quant TM 200 (Hoefer Pharmacia Biotech) DNA.
6 : ERIC2PCR 707 114 ERIC2PCR ERIC [7 ],, : ERIC1R 5 2ATGTA2 AGCTCCTGGGGATTCAC23 ERIC2 5 2AAGTAAGTGACTGGGGTGAGCG23. [9 ]. PCR MiniCycler TM (MJ Research Inc), PCR Promega. 115 %( WΠV) ( 115 gπml) PCR, 500 ng. UVP2 GDS8000 (Ultra2Violet Product Ltd). 115 ERIC2PCR Shannon s ( H ). : H = - ( n iπn) ln ( n i ΠN), n i, N. Sorenson (pairwise similarity coeffi2 cient, C s ) ERIC2PCR [15 ]. C s = 2 j Π( a + b) 100, a ERIC2PCR, b ERIC2PCR, j. Sorenson 0, 2 DNA Sorenson 100 %. 2 211 SV 30 SVI TJ1 TJ2 ( 1). 4 (M2 M3 M5 M7) 2,SV 30 16196 % 2919 %, SVI 98137mLΠg, 202115mLΠg. M1 M6 M8 3,SV 30 30158 %, 5519 %,M8 SVI 298122mLΠg. M4,,2,SV 30 100 %,SVI 351146mLΠg 365183 mlπg. 2 1 TJ1 TJ2 SV 30 SVI,TJ2 TJ1. 212 COD Cr TJ1 COD Cr, 104411 793019 mgπl. Fig. 1 Fluctuation of SV 30 and SVI of activated sludge in first (TJ1) and second(tj2) aeration basin during monitoring period,. M1 34175 mgπl, 3122 ; M3 M8 0196 7125 mgπl. M2, 3515 mgπl ; M8, 132182 mgπl, 3174 ; 6 4316 8019 mgπl. TJ1, TJ2 ( 2). 213 TJ1, 94189 % 99144 % ; 6612 % 9813 % ; COD Cr, 7413 %, 30 % 45 %,M4 COD Cr. TJ2 COD Cr
708 23 9512 %,8912 % 2618 % ; M4 TJ2 COD Cr, M7, M8 COD Cr 19178 %( 3). 2 TJ1 TJ2 COD Cr Fig. 2 Fluctuation of phenol,cn - and COD Cr in influent water to TJ1 and TJ2 during monitoring period 3 TJ1 TJ2 COD Cr Fig. 3 Fluctuation of removal efficiency of phenol, cyanide and COD Cr by activated sludge in TJ1 and TJ2 during monitoring period 214 2 8 DNA ERIC2PCR. TJ1 TJ2, ( 4A 4B). 8 2 ERIC2PCR,. TJ1 ERIC2 PCR C s 87 %, 100 %, C s 9411 %( 1). TJ1 M3 H (1177), 7 4 8 TJ1 TJ2 ERC2PCR Fig. 4 ERIC2PCR fingerprints of activated sludge from TJ1 and TJ2 during experiment (Lanes :1. 1 kb 1adder ;2. negative control ; 3 10. activated samples obtained from first to eight dates, A :TJ1 ;B :TJ2) 5 8 TJ1 TJ2 Fig. 5 Shannon index of diversity of the activated sludge microbial community from TJ1 and TJ2 during experiment (M1 M8,activated samples obtained from first to eight dates,a :TJ1 ;B :TJ2)
6 : ERIC2PCR 709 H 2105 2134 ( 5A). TJ2 ERIC2PCR,8 ERIC2PCR 9616 %( 1), 1160 2116 ( 5B). 1 8 TJ1 TJ2 ERIC2PCR Table 1 C s matrix values for individual activated sludge samples from TJ1 and TJ2 TJ1 C s, % M1 M2 M3 M4 M5 M6 M7 M1 M2 M3 M4 M5 M6 M7 M2 96 88 M3 92 96 88 100 M4 96 92 96 88 100 100 M5 92 88 92 96 92 96 96 96 M6 92 88 92 96 100 92 96 96 96 100 M7 92 88 92 96 100 100 92 96 96 96 100 100 M8 96 92 96 100 96 96 87 92 96 96 96 100 100 100 TJ2 3 ERIC2PCR AB 2 8.,,. M4,,2. TJ1 COD Cr, TJ2 COD Cr 2.,. Whiteley [3 ] DGGE FISH rrna,, (microbial densities). Watanabe TGGE,,, 115 gπ(l d),, 2 [6 ]., COD Cr, COD Cr, ERIC2PCR, TJ1,,.,ERIC2PCR ERIC DNA [14 ]., ERIC2PCR,,,.,
710 23,.,ERIC2PCR,. : [ 1 ] Eichner C A,Erb R W, Timmis K N, et al. Thermal gradient gel electrophoresis analysis of bioprotection from pollutant shocks in the activated sludge microbial community[j ]. Appl Environ Microbiol, 1999, 65 (1) : 102 109 [ 2 ] Marsh T L,Liu Wen2Tso,Forney L J, et al. Beginning a molecular analysis of the eukaryal community in activated sludge[j ]. Wat Sci Tech, 1998, 37 (4 5) : 455 460 [ 3 ] Whiteley A S, Bailey M J. Bacterial community structure and physiological state within an industrial phenol bioremediation system [J ]. Appl Environ Microbiol, 2000, 66 (6) : 2400 2407 [ 4 ] Wagner M, Amann R, Lemmer H. Probing activated sludge with oligonucleotides specific for proteobacteria : inadequacy of culture2 dependent methods for describing microbial community structrue[j ]. Appl Environ Microbiol, 1993, 59 (5) : 1520 1525 [ 5 ] Vainio E J, Moilanen A, Koivula T T, et al. Comparison of partial 16S rrna gene sequences obtained from activated sludge bacte2 ria. Appl Microbiol Biotechnol, 1997, 48 (1) : 73 79 [ 6 ] Watanabe K,Teramoto M, Harayama S. An outbreak of nonflocculating catabolic populations caused the breakdown of a phenol2di2 gesting activated2sludge process[j ]. Appl Environ Microbiol, 1999, 65 (7) : 2813 2819 [ 7 ] Versalovic J, Koeuth T, Lupski J R. Distribution of repetitive DNA sequence in eubacteria and application to fingerprinting of bacte2 rial genomes[j ]. Nucleic Acids Res, 1991, 19 : 6823 6831 [ 8 ] De Bruijn F J. Use of repetitive (repetitive extragenic palindromic and enterobacteria repetitive intergeneric consensus) sequence and the polymerase chain reaction to fingerprint the genomes of Rhizobium meliloti isolates and other soil bacteria[j ]. Appl Environ Mi2 crobiol, 1992, 58 (2) : 2180 2187 [ 9 ] Di Giovanni G D,Watrud L S, Seidler R J. Fingerprinting of mixed bacteria strains and BIOLOG Gram2Negative ( GN) substrate communities by enterobacterial repetitive intergenic consensus sequence2pcr ( ERIC2PCR) [J ]. Current Microbiology, 1999, 38 : 217 223 [10 ] L Zhao, P Gao, et al. ERIC2PCR as a community fingerprinting technology for identification of functional components in activated sludge for wastewater treatment in coke industry[ Z]. Proceedings of 101st Annual Meeting of American Society of Microbiology, 2001, Orlando, FL. p600 [ 11 ] G Song, G Wei, Y Cao, et al. Use of ERIC2PCR as a community fingerprinting technology in elucidation of mode of action of a new probiotic formulation for prevention and treatment of bacterial diarrhea in piglets[a]. Book of abstracts of the Asia Pacific Conference on Plant Tissue Culture & Agribiotechnology 19 23, Novemeber, 2000, Singapore G16. 166 [12 ], (, ). [M]. :, 1985. 469 472 [13 ],. DNA [J ].,2002, 22 (11) : 2015 2020 [14 ],,. MG1655 ERIC2PCR [J ].,2002, 29 (6) : 28 32 [15 ] Murray A E,Hollibaugh J T,Orrego C. Phylogenetic composition of bacterioplankton from two Califorhia estuaries compared by dena2 turing gradient gel electrophoresis of 16S rdna fragments. Appl Enriron Microbiol,1996,62 (7) :2676 2680