Chinese Journal of Applied Entomology 2011 48 4 820 825 * S - RNA 1 1 2 1 1** 1. 030006 2. 030006 Locusta migratoria manilensis Meyen GST GST 4 RNA dsrna dsrna Real time RT-PCR mrna 4 GST delta LmGSTd1 sigma LmGSTs5 dsrna 12 h mrna theta LmGSTt1 unknown LmGSTu1 24 h mrna GST RNA RNA The RNA interference efficiency of glutathione S-transferases from Locusta migratoria manilensis LIU Ting 1 QIN Guo-Hua 1 2 ZHANG Jian-Zhen 1 MA En-Bo 1** 1. Institute of Applied Biology Shanxi University Taiyuan 030006 China 2. College of Environment and Resource Shanxi University Taiyuan 030006 China Abstract The migratory locust Locusta migratoria manilensis Meyen Orthoptera Acridoidea is one of the most important pests in our country. Resistance of this locust to some insecticides has been detected and the resistance mechanism hypothesized to involve glutathione S-transferases GST. In this study double-stranded RNA of four different classes of GST was synthesized using specific gene primers and injected into the 2 nd instar nymphs of L. m. manilensis. The effects of silencing time on target GSTs mrna expression was assayed by real time RT-PCR. The results show that the expression of LmGSTd1 and LmGSTs5 were reduced significantly 12 h after injection whereas LmGSTt1 and LmGSTu1 were reduced significantly 24 h after injection. These results provide a foundation for further study of GST function and mechanisms in locusts. Key words glutathione S-transferases GSTs Locusta migratoria manilensis RNAi time effect RNA RNA interference RNAi 1999 Zamore et al. 2000 RNA double-stranded RNA 1995 dsrna dsrna Caenorhabditis elegans RNA Dicer Guo and Kemphues 1995 21 ~ 25 nt RNA sirna RNA sirna mrna Misquitta and Paterson Mao 2007 * 30810103907 30870302 201003656 20090451359 ** E-mail maenbo2003@ sxu. edu. cn 2011-05-05 2011-05-12
4 S - RNA 821 dsrna GST GST RNA RNAi 1 Locusta migratoria manilensis Meyen 1. 1 1999 L D = 14 10 30 ± 2 2004 60% S- glutathione S-transferases GSTs Ma et al. 2004 Yang et al. 2009 GSTs RNA RNAiso TM Plu DNase I Ⅱ RNase Free Takara RevertAid TM H reduced glutathione GSH Minus M-MuLV Fermentas 2 2003 Taq PCR MasterMix SYBR Premix 2009 GSTs Ex Taq TM II TaKaRa Wizard SV Gel DDT and PCR Clean-Up System T7 RiboMAX TM GSTs Express RNAi System Promega 2003 2009 1. 2 10 GST delta sigma theta unknown 4 Qin et al. 2011 primer Express 3. 0 GST RNA 4 dsrna S - 12 24 48 72 96 h GST mrna 1 Table 1 dsrna Primers used for expression analysis and dsrna synthesis of GSTs GenBank Gene Primers Sequence 5'-3' HM131834 LmGSTd1 ds-f TAATACGACTCACTATAGGGGCAAAGAAGAGAGCATTGGTGA ds-r TAATACGACTCACTATAGGGGCTCCTGCGTGATTAGTTTCTTC RT-F ACAGATGAAGCCAGAGTA RT-R TCCTTAGGGTAAAGTGAGT HM131840 LmGSTs5 ds-f TAATACGACTCACTATAGGGACATGGCAGTTGACACAATATCAG ds-r TAATACGACTCACTATAGGGTGGTCTCTTGCTAATCCACTCCTT RT-F GGGAAGACGACGTGCAGTCT RT-R CTGCAGATCTTCCCAGTCATTG HM131843 LmGSTt1 ds-f TAATACGACTCACTATAGGGTGGCAAATGACATCCCTTAT ds-r TAATACGACTCACTATAGGGTGGCAAATGACATCCCTTAT RT-F CCAGAACAGTGGCTAGGCGGGAACG RT-R GTGGGACACCTCCATACTT HM131835 LmGSTu1 ds-f TAATACGACTCACTATAGGGCGCCTGGTCCGTTTAGTG ds-r TAATACGACTCACTATAGGGTCCAGCCCTTCGTTCACTT β-actin RT-F GAACGAAGGGCTGGAAAC RT-R GAGCGATGACAGGGAGAT
822 Chinese Journal of Applied Entomology 48 1. 3 2 1. 4 1. 3. 1 dsrna 12 h β-actin 1 β-actin dsrna SPSS15. 0 1 ± n = 3 DNA PCR Fisher s LSD P < 0. 05 95 3 min 95 30 s 55 30 s 72 30 s 25 72 10 min PCR Wizard SV Gel and PCR Clean-Up System Promega 2 PCR dsrna dsrna T7 RiboMAX TM Express RNAi System Promega dsrna 1. 5% Molecular Real-time qpcr GST dsrna mrna LmGSTd1 dsrna 12 h mrna mrna 7. 33% 48 h Devices Menlo Park CA USA mrna 80% 1. 5 μg / μl - 80 1 LmGSTd1 LmGSTs5 1. 3. 2 dsrna 2 dsrna 12 h mrna 3 7. 9% 96 h 2 LmGSTt1 LmGSTu1 2 3 dsrna 12 h dsrna 3 μg 50 24 h mrna 1. 1 12 3 4 24 48 72 96 h 3 3 3-80 RNAi RNA mrna 1. 3. 3 cdna RNAiso TM Plus Takara dsrna 21 ~ 23 nt sirna RNA DNase I RNase Free RNA mrna RNA RevertAid TM H Minus M-MuLV 0. 5 μg RNAi cdna 1. 3. 4 PCR Napoli et al. 1990 mrna cdna RNAi 1 RNAi PCR SYBR Green I ABI Prism 7300 PCR mrna 95 10 s 95 5 s 55 20 s 72 31 Fire et al. 1998 2 RNAi s 40 95 15 s 60 1 min 95 15 s dsrna ABI Prism 7300 SDS 1. 1 Sequence detector system mrna 3 RNAi 4 3 RNAi
4 S - RNA 823 Fig. 1 1 LmGSTd1 Fig. 3 Silencing effects of LmGSTd1 at different time ± 12 h 1 / β-actin n = 3 Fisher s LSD P < 0. 05 Averaged data from three independent experiments are given together with SE. Mean expression in each groups is shown as a fold increased compared to mean expression in control group at 12 h which has been ascribed an arbitrary value of 1 taget gene / β-actin. Different letters represents significant difference at 0. 05 level. Fisher s LSD multiple comparison test. The same below. 3 LmGSTt1 Silencing effects of LmGSTt1 at different time Fig. 4 4 LmGSTu1 Silencing effects of LmGSTu1 at different time RNAi dsrna dsrna RNAi RNAi dsrna 2 LmGSTs5 Fig. 2 Silencing effects of LmGSTs5 at different time RNAi dsrna Zhuang et al. 2008 Montgomery et al. 1998 RNAi
824 Chinese Journal of Applied Entomology 48 Arakane et al. 2005 3 μg 2 Cell 81 4 611 620. Levin DM Breuer LN Zhuang S Anderson SA Nardi JB Kanost MR 2005. A hemocyte-specific integrin required for hemocytic encapsulation in the tobacco hornworm RNAi Manduca sexta. Insect Biochem. Mol. Biol. 35 5 369 RNAi dsrna 380. 2003. GST. 23 2 170 174. 2 3 Ma EB He YP Zhu KY 2004. Comparative studies of acetylcholinesterases purified from two field populations of the oriental migratory locusta Locusta migratoria 2 3 manilensis implications of insecticide resistance. Pest Biochem. Physiol. 78 1 67 77. RNAi Mao YB Cai WJ Wang JW Hong GJ Tao XY Wang LJ RNAi Huang YP Chen XY 2007. Silencing a cotton bollworm Levin et al. 2005 P450 monooxygenase gene by plant-mediated RNAi impairs RNAi larval tolerance of gossypol. Nature Biotechnology 25 mrna 11 1307 1313. Misquitta L Paterson BM 1999. Targeted disruption of gene RNAi function in Drosophila by RNA interference RNAi a role GST for nautilus in embryonic somatic muscle formation. Proc. delta sigma LmGSTd1 Natl. Acad. Sci. USA 96 4 1451 1456. Montgomery MK Xu SQ Fire A 1998. RNA as a target of LmGSTs5 12 h theta unknown double-stranded RNA-mediated genetic interference in LmGSTt1 LmGSTu1 24 h Caenorhabditis elegans. Proc. Natl. Acad. Sci. USA 95 GST 26 15502 15507. Napoli C Lemieux C Jorgensen R 1990. Introduction of a GST chimeric chalcone synthase gene into petunia results in GST reversible co-suppression of homologous gene in trans. Plant Cell 2 4 279 289. RNAi Qin G Jia M Liu T Xuan T Yan Zhu K Guo Y Ma E RNA Zhang J 2011. Identification and characterisation of ten glutathione S-transferase genes from oriental migratory locust Locusta migratoria manilensis Meyen. Pest References Manag. Sci. 67 6 697 704. 2009. S - Arakane Y Muthukrishnan S Kramer KJ 2005. The. 46 3 480 484. Tribolium chitin synthase genes TcCHS1 and TcCHS2 are Yang ML Zhang JZ Zhu KY Xuan T Liu XJ Guo YP specialized for synthesis of epidermal cuticle and midgut Ma EB 2009. Mechanisms of organophosphate resistance peritrophic matrix. Insect Mol. Biol. 14 5 453 463. in a field population of oriental migratory locust Locusta Fire A Xu S Montgomery M Kostas S 1998. Potent and migratoria manilensis Meyen. Arch. Insect Biochem. specific genetic interference mediated by double-stranded RNA in Caenorhabditis elegans. Nature 391 806 811. Physiol. 71 1 3 15. Zamore PD Tuschl T Sharp PA Bartel DP 2000. RNAi Guo S Kemphues KJ 1995. par-1 a gene required for Double-stranded RNA directs the ATP-dependent cleavage establishing polarity in C. elegans embryos encodes a of mrna at 21 to 23 nucleotide intervals. Cell 101 1 putative Ser / Thr kinase that is asymmetrically distributed. 25 33.
4 S - RNA 825 1999.. subunits of integrin are involved in cell-mediated responses. 3 558. of the Manduca immune system. Dev. Comp. Immunol. Zhuang SF Lisha K James BN 2008. Multiple alpha 32 4 365 379.