http / / cjbmb. bjmu. edu. cn Chinese Journal of Biochemistry and Molecular Biology RT- PCR fat-1 3T3

Σχετικά έγγραφα
Αξιοποίηση Φυσικών Αντιοξειδωτικών στην Εκτροφή των Αγροτικών

α 1 2- Cloning and Expression of alpha 1 2-fucosyltransferase in E. coli BIOTECHNOLOGY BULLETIN

Optimizing Microwave-assisted Extraction Process for Paprika Red Pigments Using Response Surface Methodology

Supporting Information. Asymmetric Binary-acid Catalysis with Chiral. Phosphoric Acid and MgF 2 : Catalytic

[11].,, , 316 6, ,., 15.5%, 9.8%, 2006., IDF,, ,500, 2,830.,, ,200.,,, β, [12]. 90% 2,,,,, [13-15].,, [13,

Antimicrobial Ability of Limonene, a Natural and Active Monoterpene

IL - 13 /IL - 18 ELISA PCR RT - PCR. IL - 13 IL - 18 mrna. 13 IL - 18 mrna IL - 13 /IL Th1 /Th2

Comparison of HPLC fingerprint between enzymatic Calculus bovis and natural Calculus bovis

Gro wth Properties of Typical Water Bloom Algae in Reclaimed Water

Electronic Supplementary Information (ESI)

( ) , ) , ; kg 1) 80 % kg. Vol. 28,No. 1 Jan.,2006 RESOURCES SCIENCE : (2006) ,2 ,,,, ; ;

Identification of Fish Species using DNA Method

TGFp FSH INH INH

Basic & Clinical Medicine PLGA MUC1 MUC1 IC 50 MUC1 +

Shiraia sp. Slf14 III

Μελέτη της έκφρασης του ογκοκατασταλτικού γονιδίου Cyld στον καρκίνο του μαστού

Emulsifying Properties of Egg Yolk as a Function of Diacylglycerol Oil

Comparison of nutrient components in muscle of wild and farmed groups of Myxocyprinus asiaticus

Mitomycin C application for the prevention of postoperative synechiae formation at the anterior commissure.

0. 35g kg ~ 2. 0cm 10min. Nar- 15μL 6mm

Studies on the Binding Mechanism of Several Antibiotics and Human Serum Albumin

GDNF 220YL) 2,52. (glial cell line2de2. 015d 15d rived neurotrophic factor GDNF) 1993 Lin B49 (L15) (FBS) (poly2l2lysin, pll) (laminin, LN) GDNF GDNF

ΜΟΡΙΑΚΕΣ ΜΕΘΟΔΟΙ ΚΡΙΤΗΡΙΑ ΕΠΙΛΟΓΗΣ ΑΞΙΟΛΟΓΗΣΗ

BGP TRACP-5b BGP TRACP-5b P 0.05

Copper-catalyzed formal O-H insertion reaction of α-diazo-1,3-dicarb- onyl compounds to carboxylic acids with the assistance of isocyanide

*,* + -+ on Bedrock Bath. Hideyuki O, Shoichi O, Takao O, Kumiko Y, Yoshinao K and Tsuneaki G

,HLA2B2704,, The Technique of Producing HLA2B2704 Gene Transgenic Mice. Chinese Journal of Biochemistry and Molecular Biology HLA2 B2704 ,1,2 Q33,Q78

Comparison of carbon-sulfur and carbon-amine bond in therapeutic drug: -S-aromatic heterocyclic podophyllum derivatives display antitumor activity

ΤΕΧΝΟΛΟΓΙΚΟ ΠΑΝΕΠΙΣΤΗΜΙΟ ΚΥΠΡΟΥ ΣΧΟΛΗ ΕΠΙΣΤΗΜΩΝ ΥΓΕΙΑΣ ΤΜΗΜΑ ΝΟΣΗΛΕΥΤΙΚΗΣ ΠΤΥΧΙΑΚΗ ΕΡΓΑΣΙΑ ΕΠΗΡΕΑΖΕΙ ΤΗΝ ΠΡΟΛΗΨΗ ΚΑΡΚΙΝΟΥ ΤΟΥ ΜΑΣΤΟΥ

HIV HIV HIV HIV AIDS 3 :.1 /-,**1 +332

* /+* *,3- +**+ + ** , +1 - ect of a Dietary Education Program for Kindergarten Children and their Mothers

Survivin sirna. Inhibitory effect of small interference RNA targeting survivin nanospheres on human pancreatic carcinoma BXPC-3 cell growth

ΙΩΑΝΝΗ ΑΘ. ΠΑΠΑΪΩΑΝΝΟΥ

Effects of soothing liver and invigorating spleen recipes of TCM on hepatic inflammatory cytokines of rats with nonalcoholic steatosishepatitis

Cellular Physiology and Biochemistry

Correction of chromatic aberration for human eyes with diffractive-refractive hybrid elements

Inhibition of mushroom tyrosinase by flavonoid from Sorbus tianschanica Ruper in Xinjiang

1 h, , CaCl 2. pelamis) 58.1%, (Headspace solid -phase microextraction and gas chromatography -mass spectrometry,hs -SPME - Vol. 15 No.

ACTA CHINESE MEDICINE. diabetic nephropathies DN 24. urine protein quantitation in 24 hours 24hUTP serum creatinine Scr

Influence of Flow Rate on Nitrate Removal in Flow Process

Nguyen Hien Trang* **

Science of Sericulture

Octretide joint proton pump inhibitors in treating non-variceal gastrointestinal bleeding a Metaanalysis

ΑΡΙΣΤΟΤΕΛΕΙΟ ΠΑΝΕΠΙΣΤΗΜΙΟ ΘΕΣΣΑΛΟΝΙΚΗΣ ΤΜΗΜΑ ΟΔΟΝΤΙΑΤΡΙΚΗΣ ΕΡΓΑΣΤΗΡΙΟ ΟΔΟΝΤΙΚΗΣ ΚΑΙ ΑΝΩΤΕΡΑΣ ΠΡΟΣΘΕΤΙΚΗΣ

ΤΕΧΝΟΛΟΓΙΚΟ ΠΑΝΕΠΙΣΤΗΜΙΟ ΚΥΠΡΟΥ ΣΧΟΛΗ ΓΕΩΠΟΝΙΚΩΝ ΕΠΙΣΤΗΜΩΝ ΒΙΟΤΕΧΝΟΛΟΓΙΑΣ ΚΑΙ ΕΠΙΣΤΗΜΗΣ ΤΡΟΦΙΜΩΝ. Πτυχιακή εργασία

PE CVVH PE+HP HP+CVVH HP+CVVH+PE CVVH. ENLAV of HCO - 3 ENLAV-HCO ± μmol /L HP+PE HP+CVVH HP+CVVH+PE

Σχέση στεφανιαίας νόσου και άγχους - κατάθλιψης

8Q5SAC) 8Q5SAC UV2Vis 8500 ( ) ; PHS23C ) ;721 ( ) :1 4. ;8Q5SAC : molπl ;Britton2Robinson Q5SAC BSA Britton2Robinson,

CPT. Tsuchiya. beta. quantitative RT PCR QIAGEN IGFBP. Fect Transfection Reagent sirna. RT PCR RNA Affymetrix GeneChip Expression Array

!!Διατροφή!και!αθηροσκλήρωση!!ίσως!το! καλύτερο!φάρμακο

30s 56 60s 72 60s dntp cm s s s 23

(1) A lecturer at the University College of Applied Sciences in Gaza. Gaza, Palestine, P.O. Box (1514).

Rapid determination of soluble reactive silicate in seawater by flow injection analysis with spectrophotometric detection and its application

, SLC26A4 HEK 293. The construction of wild-type SLC26A4 gene expression vector and the expression in HEK293 cells

Table S1: Inpatient Diet Composition

ΙΠΛΩΜΑΤΙΚΗ ΕΡΓΑΣΙΑ. ΘΕΜΑ: «ιερεύνηση της σχέσης µεταξύ φωνηµικής επίγνωσης και ορθογραφικής δεξιότητας σε παιδιά προσχολικής ηλικίας»

ΘΕΜΑ: «ΤΑ ΩΜΕΓΑ-3 ΛΙΠΑΡΑ ΟΞΕΑ ΣΤΗΝ ΠΑΡΑ ΟΣΙΑΚΗ ΚΑΙ ΣΥΓΧΡΟΝΗ ΙΑΤΡΟΦΗ. Η ΣΗΜΑΣΙΑ ΤΟΥΣ ΓΙΑ ΤΗΝ ΥΓΕΙΑ»

c Key words: cultivation of blood, two-sets blood culture, detection rate of germ Vol. 18 No

The toxicity of three chitin synthesis inhibitors to Calliptamus italicus Othoptera Acridoidea

(Fenneropenaeus chinensis)

Comparative Study on Determinations of BTEX in Soils from Industrial Contaminated Sites

Supporting Information

ER-Tree (Extended R*-Tree)

Protease-catalysed Direct Asymmetric Mannich Reaction in Organic Solvent

Study on the Strengthen Method of Masonry Structure by Steel Truss for Collapse Prevention

LUO, Hong2Qun LIU, Shao2Pu Ξ LI, Nian2Bing

College of Life Science, Dalian Nationalities University, Dalian , PR China.

Γεωπονικό Πανεπιςτήμιο Αθηνών Τμήμα Αξιοποίηςησ Φυςικών Πόρων και Γεωργικήσ Μηχανικήσ

ΚΕΡΚΙΔΙΚΗ ΚΑΙ ΜΗΡΙΑΙΑ ΠΡΟΣΠΕΛΑΣΗ ΣΕ ΣΤΕΦΑΝΙΟΓΡΑΦΙΕΣ ΚΑΙ ΑΓΓΕΙΟΠΛΑΣΤΙΚΕΣ. ΜΙΑ ΣΥΓΚΡΙΤΙΚΗ ΜΕΛΕΤΗ

Nucleotide Sequence of Cloned cd NA for alpha Subunit of Goat Follicle Stimulating Hormone

ΤΕΧΝΟΛΟΓΙΚΟ ΠΑΝΕΠΙΣΤΗΜΙΟ ΚΥΠΡΟΥ ΣΧΟΛΗ ΓΕΩΤΕΧΝΙΚΩΝ ΕΠΙΣΤΗΜΩΝ ΚΑΙ ΔΙΑΧΕΙΡΙΣΗ ΠΕΡΙΒΑΛΛΟΝΤΟΣ. Πτυχιακή διατριβή

Accumulation of Soil Arsenic by Panax notoginseng and Its Associated Health Risk

Dietary success of a new key fish in an overfished ecosystem: evidence from fatty acid and stable isotope signatures

Resurvey of Possible Seismic Fissures in the Old-Edo River in Tokyo

In vitro και in vivo φαρμακοκινητική ανάλυση των παραγώγων ανθρακινόνης σε φυτικά σκευάσματα

Congruence Classes of Invertible Matrices of Order 3 over F 2

Supporting Information

Reaction of a Platinum Electrode for the Measurement of Redox Potential of Paddy Soil

Το Βιολογικό Ρολόι: Θεµελιώδης Ρυθµιστής της Φυσιολογίας των Οργανισµών

http / / cjbmb. bjmu. edu. cn Chinese Journal of Biochemistry and Molecular Biology H 2 O 2 AKT2 TUNEL DNA ladder AKT2 sirna PI3K / AKT

Μαρία Κατσιφοδήμου. Ο ρόλος της έκκρισης HLA-G από τα ανθρώπινα έμβρυα στην επιτυχία της εξωσωματικής γονιμοποίησης. Μεταπτυχιακή Διπλωματική Εργασία

http / / cjbmb. bjmu. edu. cn Chinese Journal of Biochemistry and Molecular Biology human telomerase reverse transcriptase htert

Supplementary information:

MSM Men who have Sex with Men HIV -

Autoxidation of Commercial Edible Oils and Emulsified Liquid Type Dressing by the Simple Method for the Determination of Peroxide Value

Ποιοτική Αξιολόγηση ενός Προγράμματος Διδασκαλίας Δεξιοτήτων Ζωής στη Φυσική Αγωγή

Analysis on the Ratio of Flesh Content and Nutritional. Quality of Esox lucius

ΤΕΧΝΟΛΟΓΙΚΟ ΠΑΝΕΠΙΣΤΗΜΙΟ ΚΥΠΡΟΥ ΣΧΟΛΗ ΕΠΙΣΤΗΜΩΝ ΥΓΕΙΑΣ. Πτυχιακή εργασία Η ΚΑΤΑΘΛΙΨΗ ΣΕ ΕΦΗΒΟΥΣ ΜΕ ΣΑΚΧΑΡΩΔΗ ΔΙΑΒΗΤΗ ΤΥΠΟΥ 1

ΓΕΩΠΟΝΙΚΟ ΠΑΝΕΠΙΣΤΗΜΙΟ ΑΘΗΝΩΝ

ΤΕΧΝΟΛΟΓΙΚΟ ΠΑΝΕΠΙΣΤΗΜΙΟ ΚΥΠΡΟΥ ΣΧΟΛΗ ΕΠΙΣΤΗΜΩΝ ΥΓΕΙΑΣ

ΑΓΓΛΙΚΑ Ι. Ενότητα 7α: Impact of the Internet on Economic Education. Ζωή Κανταρίδου Τμήμα Εφαρμοσμένης Πληροφορικής

Ο νοσηλευτικός ρόλος στην πρόληψη του μελανώματος

A strategy for the identification of combinatorial bioactive compounds. contributing to the holistic effect of herbal medicines

Οι επιδόσεις Ελλήνων στο Mini Mental State Examination με βάση την ηλικία και τη νοητική κατάσταση από την παιδική στην τρίτη ηλικία.

Journal of Ningxia Medical University. Annexin P19 mrna P < AnnexinA2 P19 mrna. AnnexinA2 P19 mrna. PCR 1.

, Litrrow. Maxwell. Helmholtz Fredholm, . 40 Maystre [4 ], Goray [5 ], Kleemann [6 ] PACC: 4210, 4110H

Ο Παιδίατρος μπροστά στην επιλογή βρεφικού γάλακτος

Biapenem BIPM Lot No g mg

Extract Isolation Purification and Identification of Polysaccharides from Exocarp of Unripe Fruits of Juglans mandshurica

Development of the Nursing Program for Rehabilitation of Woman Diagnosed with Breast Cancer

Transcript:

ISSN 1007-7626 CN 11-3870 / Q http / / cjbmb bjmu edu cn Chinese Journal of Biochemistry and Molecular Biology 2011 8 27 8 755 ~ 760 ω-3 fat-1 1 2 1 * 1 1 1 2 1 266021 2 266109 ω-6pufas / ω-3pufas ω- 3PUFAs ω-6pufas ω-3pufas ω-3 Caenorhabditis elegans ω-3 fat-l cdna pegfpc1-fat-1 RT- PCR pegfpc1-fat-1 ω-6pufas / ω-3pufas MTT P < 0 05 fat-1 ω-6pufas ω-6pufas ω-3pufas 3T3 ω-3 Q812 Overexpression of ω-3 Fatty Acid Dehydrogenase Gene Protects Mouse Embryonic Fibrocytes from ω-6 PUFAs-induced Apoptosis 1 LI Fang-Fang 2 GE Yin-Lin 1 * XUE Mei-Lan 1 ZHANG Jin-Yu 1 LI Quan 1 SHAN Hu 2 1 Department of Biochemistry and Molecular Biology Medical School of Qingdao University Qingdao 2 School of Animal Science and Veterinary Medicine Qingdao Agricultural University Qingdao 266021 China 266109 China Abstract ω-3 polyunsaturated fatty acids ω-3pufas are important for the normal function of mammals However it is difficult to gain ω-3pufas in human body and there is no ω-3pufas dehydrogenase in vivo to catalyze ω-6pufas into ω-3pufas But the expressed product of fat-1 gene from Caenorhabditis elegan is ω-3 PUFAs dehydrogenase Hence to express fat-1 gene in mouse embryonic fibrocyte is the aim of this study First the eukaryotic expression vector pegfpc1-fat-1 containing fat-1 gene cdna was constructed and transfected into mouse embryonic fibrocyte Then the expression level was detected by RT-PCR and Laser Scanning Confocal Microscope the change of cellular ω-6pufas / ω-3pufas ratio was examined by gas chromatography the inhibiting rate of cells proliferation was observed by MTT method and cell apoptosis was evaluated by flow cytometry Results showed that the cells proliferation rate was higher and cells apoptosis magnitude was lower than those in the control cells In conclusion fat-1 gene could significantly decrease the ratio of cellular ω-6pufas / ω-3pufas and inhibit apoptosis of the 3T3 cell It shows strong cell-protective effects on mouse embryonic fibrocyte 2011-03-15 2011-06-13 No 30671079 No 20061065003 * Tel 0532-82991209 E-mail geyinlin@ 126 com Received March 15 2011 Accepted June 13 2011 Supported by National Natural Science Foundation of China No 30671079 and Foundation from Ministry of Education No 20061065003 * Corresponding author Tel 0532-82991209 E-mail geyinlin@ 126 com

756 27 Key words apoptosis ω-3 polyunsaturated fatty acids dehydrogenase gene expression embryo fibroblast cell PUFAs 6PUFAs 20 4ω-6PUFAs Sigma 1 2 pegfpc1-fat-1 fat-1 cdna WBGene00001393 PUFAs ω-6pufas ω-3pufas 1 2 ω-6pufas 5'-GGGGTACCGCCACCATGGTCGCTCAT TCCT-3' KpnⅠ 5'-CGCGGATCCTCCCTTGGCCTTTGCCTT- 3 4 ω-3pufas 3' BamHⅠ pcaggs-fat-1 PCR fat-1 5 6 cdna PCR ω-6pufas ω-3pufas 4 1 ~ 6 KpnⅠ / BamHⅠ 1 10 1 ~ 30 1 ω- pegfpc1 3PUFAs TOP10 Kanamycin 7 8 ω-6pufas ω-3pufas TaKaRa - 70 ω-3 ω-3pufas 1 3 9 10 DMEM 5 10 5 Caenorhabditis elegans ω-3 24 h 70% 96 fat-1 ω-3 300 ng pegfpc1-fat-1 0 09 μl Xfect ω-6pufas Polymer 24 2 0 μg pegfpc1-fat-1 ω-3pufas fat-1 0 6 μl Xfect Polymer 6 6 μg ω- pegfpc1-fat-1 1 8 μl Xfect Polymer 6PUFAs ω-3pufas pegfpc1 Xfect Polymer 10 s 11 12 fat-1 10 min DNA-Polymer pegfpc1-fat-1 37 5% CO 2 4 h RT-PCR 48 h fat-l ω-6pufas ω-3pufas MTT 1 4 pegfpc1 EGFP 488 nm RT- 1 PCR RNAiso Plus RNA 1 1 fat-1 cdna pcaggs-fat- 1 13 Kit 42 30 min cdna PrimeScript RT-PCR Kit β-actin 5'-CCAAGGCCAACCGCGAGA AGATGAC-3' 5'-AGGGTACATGGTGGTG CCGCCAGAC-3' 490 bp Fat-1 cdna ATG 630 bp TaKaRa Alexa Fluor 488 annexin V and PI for Flow Cytometry kit Invitrogen Xfect Polymer Clontech 75% RNase-free RNA PrimeScript RT-PCR Gibco 5'-GGTTCCCAGTGTACACTCTGTTCGGTTTCTGTGAT DNA Omega 18 2ω- G-3' fat-1 1209 bp 5'-

8 ω-3 fat-1 757 CGCGGATCCTCCCTTGGCCTTTGC CTT-3' 579 bp 94 3 min 94 30 s 55 30 s 72 1 min 30 1 5 48 h 0 01% BHT 0 5 mol / L KOH 1 ml 80 2 h 14% BF3 1 ml 80 1 h Fig 1 The KpnⅠ / BamHⅠ digestion of pegfpc1-fat-1 0 2 ml The Kpn Ⅰ / BamH Ⅰ digested plasmid pegfpc1 and fat-1 PUFAs gene were ligated by T4 DNA ligase at 4 for 16 hours Then 1 6 MTT ligation mixture was transformed into TOP10 competent cells 1 3 A The recombinant plasmid pegfpc1-fat-1 extracted from the 60 μmol / L 18 2 ω-6pufas Linoleic acid positive clone was identified by KpnⅠ / BamHⅠ digestion M 1 kb DNA ladder 1 2 Kpn I / BamHI digestion of pegfpc1-20 4 ω-6pufas arachidonic acid B fat-1 C pegfpc1 60 μmol / L 18 2 20 4ω-6PUFAs D pegfpc1-fat-1 60 μmol / L 18 2 20 4ω-6PUFAs 24 ~ 30 48 h MTT 5 mg / ml 20 μl 4 h 150 μl fat-1 DMSO 10 min 490 nm SPSS 1 7 48 h PBS 1 1 AnnexinV Fig 2 3 1 10 6 / ml 100 μl Alexa FluorR 488 annexinv 5 μl 100 μg / ml PI 1 μl 15 min 400 μl 1 annexin- 2 2 1 pegfpc1-fat-1 PCR KpnⅠ / BamHⅠ Fig 1 Fig 2 RT-PCR identification of fat-1 transcript levels DNAMAN GenBank After transfection 24 hours the total cellular RNA was fat-1 cdna extracted by RNAiso Plus and chloroform then the total TaKaRa RNA was reverse transcript into cdna and the following SJQ1031 RT-PCR was carried out at 94 3 min 94 30 s 2 2 Fat-1 55 30 s 72 1 min 30 cycles M 100 bp plus 48 h RT-PCR DNA ladder 1 RT-PCR products using pegfpc1 as pegfpc1-fat-1 fat-1 pegfpc1 fat-1 488 nm pegfpc1-fat-1 pegfpc1 pegfp-fat-1 template 2 3 RT-PCR products using pegfpc1-fat-1 as template

758 27 2 3 ω-6pufas / ω-3pufas 24 h 48 h 72 h ω-6pufas / ω-3pufas 14 24 h 48 h 72 h fat-1 ω- 6PUFAs ω-3pufas 48 h ω-6 PUFAs / ω-3 PUFAs 4 76 1 8 96 1 72 h ω-6 PUFAs / ω-3 PUFAs 4 84 16 99 1 Fig 4 Cell proliferation assessment by MTT method P < 0 05 72 h Mouse embryonic fibroblasts were transfected by pegfpc1 Table 1 fat-1 or pegfpc1-fat-1 with 60 μmol / L 18 2 ω-6 PUFAs ω-6pufas linoleic acid and 60 μmol / L 20 4 ω-6 PUFAs ω-3pufas ω-6pufas / arachidonic acid in the culture medium After ω-3pufas transfection 48 hours MTT method was used to test the 2 4 cell viability Ctrl cells without any treatment LA MTT 60 Linoleic acid AA arachidonic acid V empty vector μmol / L 18 2 ω-6 PUFAs linoleic acid 20 transfection Fat-1 pegfpc1-fat1 transfection 4 ω-6 PUFAs arachidonic acid 48 h pegfpc1-fat-1 490 nm 0 982 ± 0 10 ω-6 PUFAs pegfpc1 490 nm 0 795 ± ω-3 PUFAs 3T3 0 17 OD = x 珋 ± s fat-1 P < 2 5 0 01 fat-1 ω-6pufas Table 1 4 8 h AnnexinV -Alex Fluor4 8 8 / PI Gas chromatography analysis of cellular PUFAs after transfection 72 hours x 珔 ± s n = 3 Number Peak retention time min Long chain fatty acids pegfpc1 pegfpc1-fat-1 1 11 892 14 0 2 72 ± 0 19 2 47 ± 0 13 2 14 125 15 0 0 30 ± 0 11 0 30 ± 0 02 3 16 550 16 0 24 25 ± 0 40 23 5 ± 0 42 4 17 089 16 1ω9 2 00 ± 1 18 2 21 ± 1 04 5 17 233 16 1ω7 3 26 ± 1 65 3 90 ± 1 70 6 17 531 16 1ω5 0 23 ± 0 05 0 27 ± 0 02 7 19 038 17 0 0 48 ± 0 13 0 49 ± 0 07 8 21 596 18 0 18 65 ± 0 29 17 92 ± 1 48 9 22 145 18 1ω9 21 30 ± 1 70 23 89 ± 0 02 10 22 317 18 1ω7 6 00 ± 0 51 6 39 ± 0 53 11 23 340 18 2ω6 5 58 ± 0 76 4 26 ± 1 17 12 24 155 18 3ω3 0 35 ± 0 06 0 39 ± 0 09 12 27 522 20 1ω9 0 42 ± 0 01 0 57 ± 0 07 13 27 796 20 1ω7 0 29 ± 0 07 0 32 ± 0 02 14 29 206 20 2ω6 0 50 ± 0 21 0 52 ± 0 09 15 30 185 20 3ω6 1 47 ± 0 13 1 31 ± 0 09 16 31 117 20 4ω6 10 01 ± 2 82 9 32 ± 2 40 17 33 983 20 5ω3EPA 0 39 ± 0 10 0 90 ± 0 12 18 48 514 22 6ω3DHA 1 77 ± 1 14 1 89 ± 0 53 Total ω-6 PUFAs / ω-3 PUFAs 6 99 4 84 Mouse embryonic fibroblasts were transfected by pegfpc1 and pegfpc1-fat-1 with 10 μmol / L Linoleic acid and 10 μmol / L Arachidonic acid After transfection 24 48 72 hours total cellular fatty acids were extracted and gas chromatography was used to examine the PUFAs composition

8 ω-3 fat-1 759 Fig 3 Fluorescence photos of mouse embryonic fibroblasts after transfection 48 hours 200 After transfection 48 hours the expressed protein level was detected by Laser Scanning Confocal Microscope at the 488 nm exciting light A Normal mouse embryonic fibroblasts without transfection B and D Mouse embryonic fibroblastss transfected by pegfpc1 C and E Mouse embryonic fibroblasts transfected by pegfpc1-fat-1 Fig 5 Representative of flow cytometry analysis of cell apoptosis After transfection 48 hours the mouse embryonic fibroblastsce were harvested and stained by the dyestuff PI and annexinv then the stained cells were analyzed by flow cytometry to measure fluorescence intensity of live cells apoptosis cells and the dead cells A Normal cells B Cells transfected by pegfpc1 C Cells transfected by pegfpc1-fat-1 Alexa FluorR 488-/ PI- Alexa FluorR 488 + / PI + Alexa FluorR 488 + / PI- Fig 5 DNA pegfpc1 13 9 ± 4 6% pegfpc1-fat-1 8 1 ± ω-3pufas 1 8% OD = xs P 珋 < 0 05 3 PUFAs 15 Fat-1 ω- 6PUFAs ω-3pufas ω-3pufas

760 27 16 17 EPA DHA 18 19 ω-3pufas ω- studies J 3PUFAs 20 9 Patil S Nag A fat-1 fat-1 ω-3pufas ω-6pufas ω-3pufas ω-6pufas / ω-3pufas ω- 5 477-484 6PUFAs fat-1 USA 2001 98 7 4050-4054 21 12 Ge Y L Chen Z H Kang Z B fat-1 ES 13 J fat-1 fat-1 vitro J Chin J Biochem Mol Biol 14 Ge Y L Wang X Y Chen Z H ω-3pufas ω- 6PUFAs ω-3pufas References 1 Minihane A M Khan S Leigh-Firbank E C et al ApoE polymorphism and fish oil supplementation in subjects with an atherogenic lipoprotein phenotype J Arterioscler Thromb Vasc Biol 2000 20 8 1990-1997 2 Manfred Schwab N3 fatty acids Encyclopedia of Cancer M Springer-Verlag Berlin Heidelberg New York 2008 3 Bourre J M E Dumont O L Piciotti M J et al Comparison of vegetable and fish oil in the provision of n-3 polyunsaturated fatty acids for nervous tissue and selected organs J J Nutr Biochem 1997 8 8 472-478 4 Williams C M Moore F Morgan L et al Effects of n-3 fatty acids on postprandial triglyceride and hormone concentrations in normal subjects J Br J Nutr 1992 68 1 655-666 5 Sahena F Zaidul I S M Jinap S et al PUFAs in fish extraction fractionation importance in health J Comprehensive Rev Food Sci 2009 8 2 59-74 6 Simopoulos A P Essential fatty acids in health and chronic disease J Am J Clin Nutr 1999 70 suppl 560S-569S 7 Minihane A M Brady L M Lovegrove S S et al Lack of effect of dietary n-6 n-3 PUFA ratio on plasma lipids and markers of insulin responses in Indian Asians living in the UK J Eur J Nutr 2005 44 1 26-32 8 Harris W S N-3 fatty acids and serum lipoproteins human Am J Clin Nutr 1997 65 suppl 1645S-1654S Production of PUFA concentrates from poultry and fish processing waste J J Am Oil Chem Soc 2010 88 4 589-593 10 Guil-Guerrero J L Belarbi E H Purification process for cod liver oil polyunsaturated fatty acids J J Am Oil Chem Soc 2001 78 11 Kang Z B Ge Y L Chen Z H et al Adenoviral gene transfer of Caenorhabditis elegans n-3 fatty acid desatuarse optimize fattty acid composition in mammalian cells J Proc Natl Acad Sci et al Effects of adenoviral gene transfer of C elegans n-3 fatty acid desaturase on the lipid profile and growth of human breast cancer cells J Anticancer Res 2002 22 2A 537-543 ω6 Ge Y L Geng F S Zhang J Y et al Expression of ω6 fatty acid desaturase has an inhibition effects on breast cancer cells in 2005 21 3 329-333 et al Gene transfer of the Caenorhabditis elegans n-3 fatty acid desaturase inhibits neuronal apoptosis J J Neurochem 2002 82 6 1360-1366 15 Sawyer M B Field C J Possible mechanisms of ω-3 PUFA antitumour action J Diet Cancer 2010 1 3-38 16 Terry P D Rohan T E Wolk A In takes of fish and marine fatty acids and the risks of cancers of the breast and prostate and of other hormone-related cancers a review of the epidemiologic evidence J Am J Clin Nutr 2003 77 3 532-543 17 Yam D Peled A Shinitzky M Supperssion of tumor growth and metastasis by dietary fish oil combined with vitamins E and C and cisplatin J Cancer Chemother Pharmacol 2001 47 1 34-40 18 SanGiovanni J P Chew E Y et al The role of omega-3 long chain polyunsaturated fatty acids in health and disease of the retina J Prog Retin Eye Res 2005 24 1 87-138 19 Carlson S E Cooke R J Werkman S H et al First year growth of preterm infants fed standard compared to marine oil n-3 supplemented formula J Lipids 1992 27 11 901-907 20 Griffin B A Zampelas A Influence of dietary fatty acids on the atherogenic lipoprotein phenotype J Nutr Res Rev 1995 8 1 1-26 21 Pohlmeier W E Hovey R C Van Eenennaam A L Reproductive abnormalities in mice expressing omega-3 fatty acid desaturase in their mammary glands J Transgenic Res 2011 20 2 283-292