Chinese Journal of Pathophysiology 2010 26 9 1695-1699 1695 1000-4718 2010 09-1695 - 05 T Kv1. 3 * 1 2 2 3 2 1 2 361000 3 350108 AS T Kv Kv1. 3 AS T T Kv1. 3 mrna 1 AS T T 74. 93% ± 2. 15% vs 67. 80% ± 2. 54% P < 0. 05 2 A ConA AS T 1. 1321 ± 0. 1750 vs 0. 7971 ± 0. 0955 P < 0. 05 3 AS T ConA H = 82P < 0. 05 4 AS T 48 h 24 h IL - 2 TNF - α 5 AS T Kv1. 3 mrna 3. 670 ± 1. 579 vs 1 AS T T Kv1. 3 mrna Kv1. 3 T AS T R543. 5 A doi 10. 3969 /j. issn. 1000-4718. 2010. 09. 007 Role of Kv1. 3 channel of T lymphocytes in the formation of atherosclerosis in rat spleen LI Mei - juan 1 GONG Yan 2 XIAO Guo - sheng 2 LI Gui - yang 3 WANG Yan 2 1 Medical College of Xiamen UniversityXiamen 361000China 2 Heart CenterZhongshan Hospital of Xiamen University Xiamen 361000China 3 Fujian Medical UniversityFuzhou 350108China. E - mail wy@ medmail. com. cn ABSTRACTAIM To investigate the function of voltage - gated potassium channel Kv1. 3 and its possible role in T lymphocytes in the formation of atherosclerosis AS in rat spleen. METHODS The rat atherosclerosis model was established by feeding high - fat diet. The proportion of lymphocytes was determined by flow cytometry. The T lymphocytes were separated using immunomagnetic bead. The mrna expression of Kv1. 3 in T lymphocytes was detected. The concentrations of intracellular calcium and cytokines were also measured. RESULTS 1 The proportion of T lymphocytes in AS group was significantly higher than that in control group 74. 93% ± 2. 15% vs 67. 80% ± 2. 54% P < 0. 05. 2 After stimulated with concanavalin A ConA the proliferation of T lymphocytes in AS group was significantly higher than that in control group 1. 1321 ± 0. 1750 vs 0. 7971 ± 0. 0955P < 0. 05. 3 After stimulated with ConA the concentration of intracellular calcium in AS group was higher than that in control group. 4 In AS group the releases of cytokines of IL - 2 and TNF - α in AS group were significantly higher when stimulated with ConA for 48 h than that for 24 h. 5 The mrna expression of Kv1. 3 in T lymphocytes was greatly higher in AS group than that in control group 3. 670 ± 1. 579 vs 1. CONCLUSION In AS ratsthe increase in T lymphocytes as well as the augmentation of Kv1. 3 mrna expression in the cells suggest that up - regulation of Kv1. 3 mrna expression in T lymphocytes may be involved in the mechanism of atherosclerotic formation in rat spleen. KEY WORDSAtherosclerosis T - lymphocytes Potassium channels voltage - gated T atherosclerosis AS 2010-01 - 17 2010-04 - 30 * No. 30871045 Tel 0592-2292320 E - mail wy@ medmail. com. cn
1696 T anti - CD8 10 μl 100 mg /L anti - CD3 1. 25 μl AS 200 mg /L mouse IgG3 10 μl 10 μl /test mouse 1 2 votage dependent K + channel Kv T 3 4 Kvl. 3 T 2. 3 T magcellect rat 5 6 T T - cell isolation kit MACS Mag- Kvl. 3 AS Cellect rat T - cell isolation kit T 1 10 9 cells /L anti - CD4 an- AS T Kv1. 3 IgG1 T Kv1. 3 AS 1 1. 1 4-8 Wistar 40 lect Rat T - cell isolation kit R&D fluo - 3AM RevertAid TM first strand cdna synthesis kit Fermentas 2 2 T RNA RevertAid TM first strand cdna syn- 2. 1 AS thesis kit cdna ABI7500 RT - PCR qrt - PCR Kv 10% 1. 3 5 - TCGTGTCAGTGCTGGTCATTCTC 3 5 μm HE - TTGGCAGCCTCAAACACGTC GAPDH 5-2. 2 GAAGACGCCAGTA 2 T EZ - Sep TM mouse 1 Kv1. 3 mrna CT 1 10 9 cells /L 3 anti - CD4 2. 5 μl 100 mg /L IgG1 10 μl 10 μl /test ti - CD8 anti - CD3 mouse IgG3 mouse 2. 4 T AS T 10% RPMI - 1640 96 A concanavalina ConA - ConA 200 ± 12 g ConA + 5 g /L 37 5% 2 10 CO 2 48h MTT 5 g /L + 30 4 h DMSO 3% 0. 5% 0. 2% 5% 10% 81. 3% 2. 5 confocal T + D 3 Ca 2 + D 3 6 10 5 U /kg 16 AS T 1 10 9 cells /L Flou - 3 /AM 5 μmol /L 1. 2 30 min 2 T 10% RPMI - 1640 EZ - Sep TM mouse 1 Dakewe anti - ConA 5 mg /L CaCl 2 2. 0 mmol /L CD3 mouse IgG3 ebioscience anti - CD4 mouse IgG1 ConA CaCl 2 1 37 5% CO 2 48 h anti - CD8 mouse IgG1 10 6 Invitrogen CD4 + T MagCel- 2. 6 RT - PCR AS T Kv1. 3 mrna GGCACAGTCAAGGCTGAGAATG 3 - ATGGTGGT- ± x 珋 ± s
1697 t SPSS 15. 0 1 AS HE vascular smooth muscle cellsvsmcs AS VSMCs Figure 2. Comparison of serum TC and LDL total cholesterol AS 1 and low - density lipoprotein between AS and control group. x 珋 ± s. n = 30. * P < 0. 05 vs control group. 2 AS Figure 1. Pathologic change in rat aorta after being feeding with fat diet HE staining 100. A rat aorta in control group B rat aorta in AS group. 1 Figure 3. Comparison of T lymphocyte proportion in rat spleen between AS and control group. A proportion 2 AS total cholesterol TC triglyceride TG of T cell in control rat spleen B proportion of AS - T cell in AS rat spleen. Proportion of low - density lipoproteinldl T lymphocyte in AS group was significantly high density lipoprotein HDL higher than that in control group. AS TC LDL 3 T P < 0. 05 AS TG HDL 2 3 AS T AS T 3 AS T T 85% 4 4 ConA AS T 48 h AS T ConA AS P < 0. 05 Figure 4. Proportion of T lymphocyte in AS rat spleen after being separated by immunomagnetic ConA 48 h 2 bead. AS P < 0. 05 1 4 T
1698 1 Table 1. AS T TNF - α ConA After being stimulated by concanavalin A ConA the proliferation of T lymphocyte in AS group and control group A. x 珋 ± s Group ConA - ConA + Control n = 6 0. 2013 ± 0. 0164 0. 7971 ± 0. 0955 AS n = 9 0. 2965 ± 0. 0233 * 1. 1321 ± 0. 1750 * * P < 0. 05 vs control. 5 ConA AS T ConA AS T H = 61. 5 P < 0. 05 ConA Figure 6. Cytokine secretion in supernatant of T lymphocyte in different time after being stimulated by ConA. T x 珋 ± s. n = 18. * P < 0. 05 vs 24 h group. H = 82 P < 6 0. 05 5 48 h 24 h P < 0. 05 6 ConA AS 7 AS Kv1. 3 qpcr AS T Kv1. 3 mrna P < 0. 05 2 Table 2. Group 2 AS Kv1. 3 mrna Comparison of Kv1. 3 mrna expression in T lymphocytes of rat spleen between AS and control group x 珋 ± s ΔCT ΔΔCT CT Kv1. 3 - CT GAPDH ΔCT AS - ΔCT control 2 - ΔΔCT Control n = 7 7. 576 ± 1. 038 1 AS n = 13 5. 910 ± 0. 785-2. 123 ± 0. 556 3. 670 ± 1. 579 * * P < 0. 05 vs control. Figure 5. Comparison of intracellular calcium concentration between AS and control group. After being stimulated by ConAthe intracellular calcium concentration in AS group was significantly higher than that in the control group. AS AS oxidized low - density lipoprotein ox - LDL 60 β 2 I a 7 ox - LDL ox - LDL AS TGF - β 1 + CD4 + Th3 8 5 AS T ConA AS T 6 ConA T AS T ConA T 0 h 24 h 48 h T IL - 10 IL - 2 T 3
1699 Kv1. 3 channels in vascular smooth muscle cellsj. Smooth Kv1. 3 Muscle Res200844 2 65-81. 9 T 10 Kv1. 3 4. J. 200925 3 467-471. IL - 2 IL - 10 TNF - α TFG - β 1 5Beeton CWulff HSingh Set al. A novel fluoreseent 9 11 12 toxin to detect and investigate Kvl. 3 channel up - regula- in chronieally activated T lymphocytes J. J Biol T tion AS IL - 2 Chem2003278 11 9928-9937. TNF - α 6Jackson WF. Potassium channels in the peripheral microcirculation J. Microcirculation2005 12 1 113 - IL - 10 AS AS 127. 7Milioti NBermudez - Fajardo APenichet MLet al. IL - 2 TNF - α Antigen - induced immunomodulation in the pathogenesis IL - 10 of atherosclerosisj. Clin Dev Immunol20082008 723539. IL - 10 AS 13 AS IL - 10 48 h helper 3 - dependent autoimmune responses in atherosclerotic micej. Atherosclerosis2009204 2 381 - Kv1. 3 387. T 9Panyi GVarga ZGaspar R. Ion channels and lymphocyte activation J. Immunol Lett200492 1-2 55 Kv1. 3 T T 10 14-56. 10Wulff HCalabresi PAAllie Ret al. The voltage - gated Kv1. 3 K + channel in effector memory T cells as T Kv1. 3 Kv1. 3 new target for MSJ. J Clin Invest2003111 11 AS Kv1. 3 1703-1713. 15 AS 11Krasznai Z. Ion channels in T cells from molecular phar- T 16 macology to Kv1. 3 AS Warsz 200553 2 127-135. AS T AS 12Panyi GVamosi GBodnar Aet al. Looking through T Kv1. 3 mrna ion channels recharged concepts in T - cell signaling J. Trends Immunol200425 11 565-569. T 13Fernandez RPKaski JC. Interleukin - 10 and coronary IL - 2 TNF - α disease J. Rev Esp Cardiol200255 7 738-750. T Kv1. 3 14Beeton CWulff HStandifer NEet al. Kv1. 3 channels are a therapeutic target for T cell - mediated autoimmune Kv1. 3 AS diseases J. Proc Natl Acad Sci USA2006103 46 17414-17419. 1Sherer YShoenfeld Y. Mechanisms of disease atherosclerosis in autoimmune disease J. Nat Clin Pract Rheumatol20062 2 99-106. 2Roman MJSalmon JE. Cardiovascular manifestations of rheumatologic diseases J. Circulation 2007 116 20 2346-2355. 3 Ko EAHan JJung IDet alphysiological roles of K + 8Zhou XH Johnston TP Johansson Det al. Hypercholesterolemia leads to elevated TGF - beta 1 activity and T therapy J. Arch Immunol Ther Exp 15Guo LFZhang CTWu Jet al. T - lymphocyte voltage depedent K + channel is upregulated in patients with acute coronary syndromej. Zhonghua Xin Xue Guan Bing Za Zhi200735 9 821. 16De Palma RDel Galdo FAbbate Get al. Patients with acute coronary syndrome show oligoclonal T - cell recruitment within unstable plaque evidence for a localintracoronary immunologic mechanism J. Circulation2006 113 5 640-646.