ISSN 100727626 CN 1123870ΠQ Chinese Journal of Biochemistry and Molecular Biology 2009 6 25 (6) :542 548 2 MCF27 ( PPAR ) 3,, (, 450001) (PPAR ) 2 MCF27, MTT Western PPAR, RT2PCR mrna PPAR P21 WAF1ΠCIP1 COX22 P27., 2 MCF27, 2 ; 2 mrna PPAR, 2 PPAR P21 WAF1ΠCIP1 COX22 mrna ; PPAR GW9662 ( GSH) 2., PPAR 2 MCF27. 2 ; MCF27 ; (PPAR ) Q562 ;O62914 2Carotene Inhibits Cell Viability and Up2regulates Peroxisome Proliferator2 activated Receptor ( PPAR ) Expression in MCF27 Breast Cancer Cells HUANGJin2Yong 3, ZHANG Xia, ZHAO Wen2En ( Bioengineering Department, Zhengzhou University, Zhengzhou 450001, China) Abstract Whether the function of carotenoids on breast cell growth is mediated by peroxisome proliferator2 activated receptor (PPAR ) signaling pathway remained largely unknown. We tested the PPAR expression for the inhibition of MCF27 human breast cancer cells under the treatments of 2carotene. The cell viability was determined by MTT assay, PPAR protein expression was analyzed by Western blotting and the mrna levels of PPAR, P21 WAF1ΠCIP1, COX22, and P27 were evaluated by RT2PCR. The results showed that 2carotene inhibited the proliferation of MCF27 cells in a dose2 and time2dependent manner. 2Carotene exposure significantly up2regulated the PPAR mrna level and protein expression in time2dependently. 2Carotene was also able to modulate P21 WAF1ΠCIP1 and COX22 mrna levels dependent to PPAR. Pre2incubation with PPAR antagonist GW9662 and reduced glutathione ( GSH) partly rescued the loss of cells. It suggested that the enhancement of PPAR expression and the modulation of intercellular redox status may be a cause of MCF27 cell growth inhibition by 2carotene. Key words 2carotene ; human breast cancer MCF27 cells ; peroxisome proliferator2activated receptor (PPAR ), 120, 50.,.,., 2, [1 ]. Tamimi [2 ], : 2008212201 ; :2009201222 (No. 30470423) 3 Tel :0371267781573 ; E2mail :jinyhuang @zzu. edu. cn Received :December 1,2008 ;Accepted :January 22,2009 Supported by National Natural Science Foundation of China (No. 30470423) 3 Corresponding author Tel :0371267781573 ; E2mail :jinyhuang @zzu. edu. cn
6 : 2 MCF27 (PPAR ) 543 25 % 35 %. [3 ], 2 2 2. Shultz [4 ] Prakash [5 ] 2 ( ER + ) MCF27, 2 MCF27. [6 ], 2 MCF27, Bcl22.. ( PPAR ),,..,PPAR 1. 2 2, [7210 ], PPAR [11 ]., PPAR 152 2 2 12,14 2 J2 (15dPGJ2),.,PPAR [12215 ].,PPAR. Takahashi [16 ] PPAR, (100 molπl) PPAR, PPAR, (100 molπl) 2 2 PPAR. Sharoni [17 ],, 2 PPAR MCF27 PPAR (PPARE), PPAR 15dPGJ2. Hosokawa [18 ], ( ) DNA, 318 molπl 10 molπl Caco22, 2, PPAR,. 2 PPAR, PPAR? PPAR,?. 2 MCF27 PPAR,. 1 1. 1 DMEM Gibco BRL ; ( FCS) PAA ; (MTT) Amresco ; HEPES GW9662 GSH EDTA Sigma ; PPAR Santa Cruz ; 2 Roche ; ( Trizol ) RT2PCR Invitrogen ; PPAR P21 P27 COX22 ( ER + ) MCF2 7 ( ) DMEM( 415 gπl), 10 % 100 UΠml 100 mgπl,37 5 % CO 2, 3 d. 2 (THF), - 20. 2, THF 015 % ( VΠV ), THF 2. d. GW9662 (, 0. 1 %, VΠV ), GW9662 2 h 2, 3 d, d. 1. 3 MTT [19 ],., 215 gπl, 10 4 Π 96,., 2 Π GW9662 Π GSH,, d, 4,, MTT 0. 5 gπl, 4 h,, 150 l DMSO, 595 nm,. 1. 4 PPAR PPAR Western, PPAR, 1 1 000, IgG, 1 5 000. NH Image.
544 25 1. 5 PPAR mrna 50 molπl 2 Π GW9662, Trizol RNA, 2 g RNA, RT2PCR. 94 5 min, 94 45 s, 45 s ( COX22 57, P21 WAF1ΠCIP1 P27 kipl 59 72 ), 1 min,30, 72 10 min. Table 1 PCR amplification primers Primer Sequences LengthΠbp PPAR COX22 P21 WAF1ΠCIP1 P27 kipl Upstream :5 2TCTGGCCCACCAACTTTGGG23 Downstream :5 2CTTCACAAGCATGAACTCCA23 360 Upstream :5 2GGTCTGGTGC CTGGTCTGATGATG23 Downstream :5 2GTCCTTTCAAGGAATGGTGC23 724 Upstream :5 2GCCGAAGTCAGTTCCTTGTGGA23 Downstream :5 2GTGGGCGGATTAGGGCTT23 579 Upstream :5 2AGGAGAGCCAGGATGTCAGC23 Downstream :5 2ACCGGCATTTGGGGAGCCGT23 235 PCR Taq Platinum DNA polymerase, PCR ( MJ Research PTC2200 Peltier Thermor Cycler). 10 l 2 gπl,. 1. 6 Origin program ( Origin 715, Origin Lab Corporation Massachusetts), one2way ANOVA. 2 2. 1 2 MCF27 Table 2, 2 MCF27. 20 molπl 50 molπl 2 72 h, 70 % 50 %. 50 molπl 2, 24 h 96 h, 71 % 42 %. Table 2 Effect of 2carotene on viability of MCF27 cells 2CaroteneΠ mol L - 1 0 hour 24 hours 48 hours 72 hours 96 hours 0 100. 00 100. 00 100. 00 100. 00 100. 00 1 99. 21 7. 32 99. 02 6. 37 97. 39 4. 86 96. 50 6. 51 96. 08 7. 84 10 98. 98 6. 81 92. 25 6. 77 83. 49 7. 59 80. 50 6. 42 77. 67 7. 23 20 102,31 6. 42 81. 19 5. 57 76. 34 8. 12 71. 00 5. 12 64. 76 6. 33 50 99. 74 4. 45 72. 25 5. 64 63. 50 6. 88 51. 08 6. 66 43. 50 7. 99 100 97. 56 8. 94 61. 27 4. 76 47. 17 5. 89 39. 50 7. 17 37. 64 8. 81 Data are expressed as means SEM 2. 2 2 PPAR mrna 2 PPAR, mrna PPAR. Fig. 1 Fig. 2 Table 3 Table 4, 2, PPAR mrna, 50 molπl 2 72 h, PPAR mrna 117 315. PPAR GW9662 (5 molπl), 2 PPAR. Table 3 Effect of 2carotence on the PPAR mrna level Treatment Control BC(24 hours) BC(48 hours) BC(72 hours) BC(72hours) + GW GW PPAR mrna level 1 1. 053 0. 089 1. 440 0. 016 3 1. 731 0. 085 3 3 1. 221 0. 063 3 1. 230 0. 044 BC represents saaple treated with 50 molπl 2carotene. GW( GW9662), an inhibitor to PPAR,was used by 5 molπl. Data are expressed as
6 : 2 MCF27 (PPAR ) 545 Fig. 1 Effect of 2carotence on the PPAR mrna level ( GW9662), an inhibitor to PPAR, was used by 5 molπl. At indicated time after BC andπor GW treatment, total RNA was prepared from cells and subjected to RT2PCR. 2Actin was used as an internal control. The results showed that 2carotene exposure significantly up2regulated PPAR mrna level in time2 dependent manner. PPAR mrna level raised by 017 times compared with the control group after treated with 50 molπl 2 carotene for 72 hours. But after pretreated with GW9662, this up2regulation effect can be significantly weakened. Data are expressed as means SEM, n = 5 Fig. 2 Effect of 2carotene on the PPAR protein level (GW9662), an inhibitor to PPAR, was used by 5 molπl. Whole cell lysates were prepared at indicated time after BC andπ or GW treatment and subjected to immuoblotting. 2Actin was used as an internal control. The results showed that 2carotene exposure significantly up2regulated PPAR protein expression in time2dependent manner. PPAR protein level raised by 215 times compared with the control group after treated with 50 molπl 2carotene for 72 hours. But after pretreated with GW9662, this up2regulation effect can be significantly weakened. Data are expressed as means SEM, n = 5 Table 4 Effect of 2carotene on the PPAR protein level Treatment Control BC(24 hours) BC(48 hours) BC(72hours) BC(72hours) + GW GW PPAR protein level 1 1. 290 0. 1249 2. 724 0. 591 3 3 3. 560 0. 808 3 3 1. 221 0. 034 3 3 1. 554 0. 088 BC represents saaple treated with 50 molπl 2carotene. GW( GW9662), an inhibitor to PPAR,was used by 5 molπl. Data are expressed as 2 MCF27,, PPAR GW9662 Π GSH 2, Table 5. 5 molπl GW9662 2, 10 molπl GW9662 2. GSH 2, 200 molπl GSH, 50 % 70 %, 5 molπl GW9662 GSH. 2. 3 2 COX22, P21 P27 Table 5 Effect of 2carotene andπor GW9662 andπor GSH on viability of MCF27 cell Treatment mrna PPAR COX22, P21 WAF1ΠCIPl P27, Fig. 3 Fig. 4 Table 6 Table 7, 2 COX22, P21 WAF1ΠCIP1 cπ mol L - 1 Cell viability( %) P value Control 0 100. 00 GW 10 96. 40 6. 44 GSH 200 98. 50 6. 52 BC 50 51. 10 6. 68 3 3 < 0. 01 BC + GW 50 + 5 63. 58 6. 75 3 3 # < 0. 01, < 0. 05 BC + GW 50 + 10 48. 75 6. 26 3 3 < 0. 01 BC + GSH 50 + 100 61. 25 6. 58 3 3 < 0. 01 BC + GSH 50 + 200 73. 56 5. 65 3 # < 0. 05, < 0. 05 BC + GW + GSH 50 + 5 + 200 82. 35 6. 15 # # < 0. 01 BC + GW + GSH 50 + 10 + 200 75. 55 5. 86 3 3 # < 0. 01, < 0. 05 BC, 2carotene ; GW, GW9662 ; GSH,reduced glutathione. Data are expressed as control group ; # P < 0105, # # P < 0101 versus 2carotene2treated group 3 P < 0105, 33 P < 0101 versus
546 25 Table 6 Effect of 2carotene on the COX22 mrna level Treatment Control BC(24 hours) BC(48 hours) BC(72 hours) BC(72hours) + GW GW COX22 mrna level 1 1. 025 0. 019 0. 859 0. 034 0. 430 0. 054 3 3 1. 156 0. 036 3 3 0. 977 0. 014 BC represents saaple treated with 50 molπl 2carotene. GW( GW9662), an inhibitor to PPAR,was used by 5 molπl. Data are expressed as Table 7 Effect of 2carotene on the P21 WAF1ΠCIPl mrna level Treatment Control BC(24 hours) BC(48 hours) BC(72 hours) BC(72 hours) + GW GW P21 mrna level 1 0. 971 0. 053 1. 211 0. 069 3 2. 009 0. 119 3 3 1. 196 0. 039 3 3 1. 443 0. 063 3 BC represents saaple treated with 50 molπl 2carotene. GW( GW9662), an inhibitor to PPAR, was used by 5 molπl. Data are expressed as Fig. 3 Effect of 2carotene on the COX22 mrna level ( GW9662),an inhibitor to PPAR, was used by 5 molπl. At indicated time after BC andπor GW treatment, total RNA was prepared from cells and subjected to RT2PCR. 2Actin was used as an internal control. The results showed that 2carotene exposure significantly modulated COX22 mrna level in time2 dependent manner. COX22 mrna level decreased about 60 % compared with the control group after treated with 50 molπl 2 carotene for 72 hours. But after pretreated with GW9662, this modulation effect can be significantly weakened. expressed as means SEM, n = 5 Data are Fig. 4 Effect of 2carotene on the P21 WAF1ΠCIPl mrna level (GW9662),an inhibiter to PPAR was used by 5 molπl. At indicated time after BC andπor GW treatment, total RNA was prepared from cells and subjected to RT2PCR. 2Actin was used as an internal control. The results showed that 2carotene exposure significantly up2regulated P21 mrna level in time2 dependent manner. P21 mrna level raised by one times compared with the control group after treated with 50 moπl 2 carotene for 72 hours. But after pretreated with GW9662, this up2regulation effect can be significantly weakened. Data are expressed as means SEM, n = 5, PPAR GW9662 (5 molπl) 2 COX22 P21 WAF1ΠCIPl. 2 P27 ( ). 3 Peto [20 ] 2,., 2, [21,22 ]., 2., 2. [23 ]., MCF27 2 PPAR. PPAR, [11 ]. [24 ], PPAR, E2FΠDP DNA, P21, D1 PI32 [25 ].,PPAR PPAR, Bcl2XLΠ Bcl22 [25 ] [26 ]. 2 PPAR,Takahashi [16 ],100 moiπl 2 24 h, PPAR,. Sharoni [17 ] 2 PPAR. mrna, 2 PPAR.
6 : 2 MCF27 (PPAR ) 547 2 PPAR, PPAR?,. PPAR GW9662 2 PPAR,5 molπl GW9662, 2 MCF27 PPAR. Seargent [27 ] MCF27 MDA2MB2231 MDA2 MB2468,10 molπl GW9662,, 2. K562,8 molπl GW9662 ( )., P 21 WAF1ΠCIP1 PPAR [28 ]. P21 2 [29 ]. 2 PPAR P21?, 2 P21, 2 [30 ]., GSH 2, 2,., 2 P21 PPAR GW9662, GW9662.,PPAR COX22 [31 ]., 2 COX22 [32 ]., 2 COX22 mrna,ppar GW9662., 2 PPAR P21 COX22. 2,,. Palozza [23,33 ], 2, 2,,,, DNA. GSH 2, 2,.,, 2 MCF27,., 2 PPAR,GW9662, 2. 2 PPAR PPAR MCF27, PPAR 2. GW9662 GSH 2 MCF27, GW9662 GSH., PPAR. ( References) [ 1 ] Riboli E, Norat T. Epidemiologic evidence of the protective effect of fruit and vegetables on cancer risk[j ]. Am J Clin Nutr, 2003, 78 (3Suppl) :559s2569s [ 2 ] Tamimi R M, Hankinson S E, Campos H, et al. Plasma carotenoids, retinol, and tocopherols and risk of breast cancer [J ]. Am J Epidemiol, 2005,161(2) :1532160 [ 3 ] Toniolo P, Van Kappel A L, Akhmedkhanov A, et al. Serum Carotenoids and Breast Cancer [ J ]. Am J Epidemiol, 2001, 153 (12) :114221147 [ 4 ] Shultz T D, Chew B P, Seaman W R, et al. Inhibitory effect of conjugated dienoic derivatives of linoleic acid and beta2carotene on the in vitro growth of human cancer cells[j ]. Cancer Lett, 1992, 63 (2) :1252133 [ 5 ] Prakash P, Russell R M, Krinsky N I. In vitro inhibition of proliferation of estrogen2dependent and estrogen2independent human breast cancer cells treated with carotenoids or retinoids[j ]. J Nutr, 2001, 131 (5) :157421580 [ 6 ],,. Bcl22 [J ]. (Li Zhong, Wang Ying2Ming, Mo Bao2Qing. The effects of carotenoids on the proliferation of human breast cancer cell and gene expression of bcl22 [J ]. Chin J Prev Med), 2002,36 (4) :2542257 [ 7 ] Theocharis S, Kanelli H, Politi E, et al. Expression of peroxisome proliferator activated receptor2gamma in non2small cell lung carcinoma: correlation with histological type and grade [ J ]. Lung Cancer, 2002, 36 (3) :2492255 [ 8 ] Pandhare J, Cooper S K, Phang J M. Proline oxidase, a proapoptotic gene, is induced by troglitazone : evidence for both peroxisome proliferator2actived receptor gamma2dependent and 2independent mechanisms[j ]. J Biol Chem, 2006, 281 (4) :204422052 [ 9 ] Lu J, Imamura K, Nomura S, et al. Chemopreventive effect of peroxisome proliferator2activated receptor gamma on gastric carcinogenesis in mice[j ]. Cancer Res, 2005, 65 (11) :476924774 [10 ] Knight B, Yeap B B, Yeoh G C, et al. Inhibition of adult liver progenitor ( oval ) cell growth and wiability by an agonist of the peroxisome proliferator activated receptor ( PPAR) family member
548 25 {gamma},but not {alpha} or {delta} [J ]. Carcinogenesis, 2005, 26 (10) :178221792 [11 ] Mueller E, Sarraf P, Tontonoz P, et al. Terminal differentiation of human breast cancer through PPAR gamma [J ]. Mol Cell, 1998, 1 (3) :4652470 [12 ] Lea M A, Sura M, Desbordes C. Inhibition of cell proliferation by potential perpxisome proliferator2acivated receptor ( PPAR) gamma agonists and antagonists[j ]. Anticancer Res, 2004, 24 (5A) :27652 2771 [13 ] Xin X, Yang S, Kowalski J, et al. Peroxisome proliferation2activated receptor [ gamma ] ligands are potent inhibitors of angiogenesis in vitro and in vivo[j ].J Biol Chem, 1999, 274 (13) : 911629121 [14 ] Yoshizumi T, Ohta T, Ninomiya I, et al. Thiazolidinedione, a peroxisome proliferator2 activated receptor2gamma ligand, inhibits growth and metastasis of HT229 human colon cancer cells through differentiation2promoting effects[j ]. Int J Oncol, 2004, 25(3) :6312 639 [15 ] Lu M, Kwan T, Yu C, et al. Peroxisome proliferator2activated receptor { gamma } agonists promote TRAIL2induced apoptosis by reducing survivin levels via cyclin D3 repression and cell cycle arrest [J ]. J Biol Chem, 2005, 280(12) :674226751 [16 ] Takahashi N, Kawada T, Goto T, et al. Dual action of isoprenols from herbal medicines on both PPAR [gamma ] and PPAR[alpha ] in 3T32L1 adipocytes and HepG2 hepatocytes [J ]. FEBS Lett, 2002, 514(223) :3152322 [17 ] Sharoni Y, Danilenko M, Dubi N, et al. Carotenoids and transcription[j ]. Arch Biochem Biophys, 2004, 430 (1) :89296 [18 ] Hosokawa M, Kudo M, Maeda H, et al. Fucoxanthin induces apoptosis and enhances the antiproliferative effect of the PPAR [gamma ] ligand, troglitazone, on colon cancer cells [J ]. Biochim Biophys Acta, 2004, 1675 (123) :1132119 [19 ] Mosmann T. Rapid colorimetric assay for cellular growth and survival : application to proliferation and cytotoxicity assays [ J ]. J Immunol Methods, 1983, 65 (122) :55263 [20 ] Peto R, Doll R, Buckley J D, et al. Can dietary beta2carotene materially reduce human cancer rates [ J ]. Nature, 1981, 290 (5803) :2012208 [21 ] The Alpha2Tocopherol, Beta Carotene Cancer Prevebtion Study Group. The effect of vitamin E and beta carotene on the incidence of lung cancer and other cancers in male smokers [J ]. New Eng J Med, 1994, 330 (15) :102921035 [22 ] Omenn G S, Goodman G E, Thornquist M D, et al. Effects of a combination of carotene and vitamin A on lung cancer and cardiovascular disease[j ]. New Eng J Med, 1996, 334 (18) :11502 1155 [23 ] McEligot A J, Yang S, Meyskens F LJr, et al. Redox regulation by intrinsic species and extrinsic nutrients in normal and cancer cells [J ]. Annu Rew Nutr, 2005, 25 : 2612295 [24 ] Yin F, Wakino S, Liu Z, et al. Troglitazone inhibits growth of MCF2 7 breast carcinoma cells by targeting Gl cell cycle regulators [ J ]. Biochem Biophys Res Commun, 2001, 286 (5) : 9162922 [25 ] Shiau C W, Yang C C, Kulp S K, et al. Thiazolidenediones mediate apoptosis in prostate cancer cells in part through inhibition of Bcl2XLΠ Bcl22 functions independently of PPARgamma [ J ]. Cancer Res, 2005, 65 (4) :156121569 [26 ] Pignatelli M, Sanchez2Rodriguez J, Santos A, et al. 152deoxy2Delta2 12, 142prostaglandin J2 induces programmed cell death of breast cancer cells by a pleiotropic mechanism[j ]. Carcinogenesis, 2005, 26(1) :81292 [27 ] Seargent J M, Yates E A, Gill J H. GW9662, a potent antagonist of PPAR (, inhibits growth of breast tumor cells and promotes rhe anticancer effects of the PPAR ( agonist rosiglitazone, independently of PPAR( activation[j ]. Br J Pharmacol, 2004, 143(8) :9332937 [28 ] Jarvis M C, Gray T J, Palmer C N. Both PPAR gamma and PPAR delta influence sulfide2mediated P21 WAF1ΠCIPI upregulation in a human prostate epithelial cell line [J ]. Oncogene, 2005, 24 ( 55) : 82112 8215 [29 ] Stivala L A, Savio M, Quarta S, et al. The antiproliferative effect of 2carotene requires p21waflπcipl in normal human fibroblasts[j ]. Eur J Biochem, 2000, 267(8) : 229022296 [30 ] Palozza P, Serini S, Torsello A, et al. Regulation of cell cycle progression and apoptosis by 2carotene in undifferentiated and differentiated HL260 leukemia cells : possible involvement of a redox mechanism[j ]. Int J Cancer, 2002, 97 (5) :5932600 [31 ] Yang W L, Frucht H. Activation of the PPAR pathway induces apoptosis and COX22 inhibition in HT229 human colon cancer cells [J ]. Carcinogenesis, 2001, 22(9) : 137921383 [32 ] Palozza P, Serini S, Maggiano N, et al. 2Carotene downregulates the steady2state and heregulin2 2induced COX22 pathways in colon cancer cells[j ]. J Nutr, 2005, 135(1) :1292136 [33 ] Palozza P, Calviello G, Serini S, et al. 2Carotene at high concentrations induces apoptosis by enhancing oxy2radical production in human adenocarcinoma cells[j ]. Free Radic Biol Med, 2001, 30 (9) :100021007