31 3 Vol 31 No 3 2012 8 JOURNAL OF OCEANOGRAPHY IN TAIWAN STRAIT Aug 2012 AFLP 1 1 2 1 1 361005 2 361005 dntp Taq Mg 2 + 300 ng DNA 5U PstI 5U MseI 4 h 16 10 50 AFLP AFLP 64 12 AFLP DOI 10 3969 /J ISSN 1000-8160 2012 03 020 Q178 53 B 1000-8160 2012 03-0440-06 Litopenaeus vannamei PCR RFLP PCR RFLP PCR AFLP 1992 AFLP 1 1 1 Litopenaeus vannamei 1 2 Taq DNA polymerase Takara PstI MseI T4 DNA ligase NEB λdna amplified fragment length polymorphism AFLP /HindIII Tiangen 100 bp DNA ladder Fermentas RNase Fermentas K PCR DNA 1-3 Tiangen AFLP DNA 1 2011-07-29 NYCYTX-46 1983 ~ E-mail wwysjtu@ yahoo cn 1981 ~ E-mail ruanlingwei@ yahoo com cn
3 AFLP 441 1 Tab 1 AFLP Primer list of AFLP PstI MseI 1 CTCGTAGACTGCGTACATGCA GACGATGAGTCCTGAG 2 TGTACGCAGTCTAC TACTCAGGACTCAT GACTGCGTACATGCAGA GATGAGTCCTGAGTAAC 1 GACTGCGTACATGCAGATA GATGAGTCCTGAGTAACAA 2 GACTGCGTACATGCAGATC GATGAGTCCTGAGTAACAT 3 GACTGCGTACATGCAGAAG GATGAGTCCTGAGTAACAG 4 GACTGCGTACATGCAGACG GATGAGTCCTGAGTAACAC 5 GACTGCGTACATGCAGAAC GATGAGTCCTGAGTAACTA 6 GACTGCGTACATGCAGACA GATGAGTCCTGAGTAACTT 7 GACTGCGTACATGCAGACT GATGAGTCCTGAGTAACTG 8 GACTGCGTACATGCAGACC GATGAGTCCTGAGTAACTC 1 3 0 05 0 10 0 20 * 0 30 0 40 0 50 μmol /dm 3 1 3 1 DNA 100 mg Mg 2 + 1 00 1 25 1 50 * 1 75 2 00 2 25 1 5 cm 3 mmol /dm 3 PCR 94 1 cm 3 SNET 20 mmol /dm 3 Tris-HCl ph = 8 0 5 0 mmol /dm 3 EDTA ph = 8 0 400 mmol /dm 3 NaCl 1% m /m SDS K 400 1 3 4 μg /cm 3 55 RNase 50 mm 3 100 μg /cm 3 37 1 h 10 20 30 40 50 60 70 80 90 100 dntp 25 24 1 0 10 0 15 0 20 * 0 25 0 30 mmol /dm 3 Taq 0 5 1 0 1 5 * 2 0 2 5 3 0 4 0 5 0 U 24 1 0 05 0 10 0 20 * 0 30 0 40 0 50 DNA 1 cm 3 μmol /dm 3 Mg 2 + 1 00 1 25 1 50 * 1 75 70% V /V 2 TE 2 00 2 25 mmol /dm 3 PCR DNA 250 ng /mm 3-20 94 60 s 65 ~ 56 60 s 72 90 s 10 94 1 3 2 DNA 300 ng 2 0 mm 3 NEB Buffer 3 0 2 mm 3 100 BSA 0 5 mm 3 PstI 10 U /mm 3 0 5 mm 3 MseI 10 U /mm 3 20 mm 3 cm 3 30% m /m 8 cm 3 10% 37 4h 80 20 min m /m 250 mm 3 TEMED 1 5% m /m 4-5 25 mm 3 50 cm 3 PstI MseI 1 2 94 3 min 65 10 min 37 10 min 25 10 min 4 25 min 16 1 3 3 DNA 50 mm 3 5 10 15 10% V /V 20 25 30 dntp 0 05 0 10 0 15 * 0 20 0 25 0 30 0 35 mmol /dm 3 Taq 0 5 1 0 30s 56 60s 72 60s 20 * 30 s 56 30 s 72 60 s 23 * 1 3 5 6% m /m 21 02 g 5 TBE 10 loading buffer 95 5 min 1 700 V 3 h 30 min 3 30 min 20 s 1 5 * 2 0 2 5 3 0 4 0 5 0 U 5 ~ 6 min
442 31 10% 2 ~ 3 min 3 PCR 0 20 2 2 2 1 DNA DNA OD 260 /OD 280 1 8 ~ 2 0 1 DNA AFLP DNA 1 DNA Fig 1 Genomic DNA of Penaeus Vannamei M λdna /HindIII mmol /dm 3 Taq Taq 3 U 4 PCR 0 05 0 10 μmol /dm 3 0 5 μmol /dm 3 0 4 μmol /dm 3 5 Mg 2 + PCR Mg 2 + PCR PCR PCR Mg 2 + 1 5 mmol /dm 3 6 6-7 2 2 2 30 ~ 70 7 50 dntp 0 10 ~ 0 25 mmol /dm 3 dntp 0 20 mmol /dm 3 8 Taq 4U 5U PCR 3U 9 0 4 μmol /dm 3 2 2 AFLP 10 2 2 1 Mg 2 + 2 mmol /dm 3 10 PCR 11 2 2 3 AFLP PCR dntp PCR dntp DNA AFLP 0 05 ~ 0 25 mmol /dm 3
3 AFLP 443
444 31 50 5 mm 3 10 PCR Buffer 5 mm 3 MgCl 2 25 mmol /dm 3 4 mm 3 dntp 2 5 mmol /dm 3 each 4 mm 3 Taq 5 U /mm 3 0 6 mm 3 PstI 20 μmol /dm 3 1 mm 3 MseI 20 μmol /dm 3 1 mm 3 50 mm 3 2 4 AFLP 64 AFLP 6% m /m 12 12 11 Mg 2 + Fig 11 Pattern of selective amplification using different concentrations of Mg 2 + M 100 bp DNA ladder 1 ~ 6 Mg2 + 1 00 1 25 1 50 1 75 2 00 2 25 mmol /dm 3 7 Fig 12 12 AFLP AFLP pattern of Litopenaeus vannamei DNA 300 ng NEB Buffer 3 2 mm 3 100 BSA 0 2 mm 3 PstI 10 U /mm 3 0 5 mm 3 MseI 10 U /mm 3 0 5 mm 3 20 mm 3 DNA 20 mm 3 PstI adaptor 5 μmol /dm 3 1 mm 3 MseI adaptor 10 μmol /dm 3 5 mm 3 ATP 10 mmol /dm 3 2 mm 3 T4 Ligase 1 mm 3 10 T4 Ligase Buffer 2 mm 3 40 mm 3 10 5 mm 3 10 PCR Buffer 5 mm 3 MgCl 2 25 mmol /dm 3 3 mm 3 dntp 2 5 mmol /dm 3 each 4 mm 3 Taq 5 U /mm 3 0 6 mm 3 PstI 20 μmol /dm 3 1 mm 3 MseI 20 μmol /dm 3 1 mm 3 50 mm 3 3 AFLP DNA EcoRI / MseI PstI /MseI 8-9 EcoRI /MseI PstI /MseI AFLP DNA PstI MseI 64 12
3 AFLP 445 AFLP 10% 3 AFLP DNA AFLP 1 Li Z X Li J Wang Q Y et al AFLP-based genetic linkage map of marine shrimp Penaeus Fenneropenaeus chinensis J Aquaculture 2006 261 463-472 2 Vos P Hogers R Bleeker M et al AFLP a new technique for DNA fingerprinting J Nucleic Acids Research 1995 23 4 407-4 414 3 AFLP J 2009 15 6 8 879 4 Du Z Q Ciobanu D C Onteru S K et al A gene-based SNP linkage map for pacific white shrimp Litopenaeus vannamei J Animal Genetics 2009 41 286-294 5 Ciobanu D C Bastiaansen J W M Magrin J et al A major SNP resource for dissection of phenotypic and genetic variation in Pacific white shrimp Litopenaeus vannamei J Animal Genetics 2009 41 39-47 6 AFLP J 2006 52 3 575-584 7 AFLP J 2008 18 1 36-39 8 Zhao H Bughrara S S Oliveira J A Genetic diversity in colonial bentgrass Agrostiscapillaris L revealed by EcoRI-MseI and PstI-MseI AFLP markers J Genome 2006 49 328-335 9 AFLP J 2009 48 11 2 804-2 807 Establishment of AFLP fingerprinting in genetic diversity analysis of Litopenaeus vannamei WANG Wei-yi 1 XU Jing-xiang 1 2 RUAN Ling-wei 1 1 Key Laboratory of Marine Biogenetic Resources Third Institute of Oceanography SOA Xiamen 361005 China 2 College of Life Science Xiamen University Xiamen 361005 China Abstract Although Litopenaeus vannamei is the most economically important shrimp species in the world broodstock breeding is still limited and molecular genetics seems to be a promising method to overcome the problem This study is to establish an AFLP reaction system for Litopenaeus vannamei We analyzed the dilution multiple the concentration of dntp Taq Mg 2 + and primers for the pre-amplification and selective amplification It showed that clear and repeatable gel profiles could be obtained under the reaction protocol with 300 ng genomic DNA digested by 5U of PstI and MseI then conjugated at 16 overnight the ligation products diluted for 10 times as template for pre-amplification After pre-amplification the products were diluted for 50 times and used as template for selective amplification Using the optimized reaction system we selected 12 informative primer combinations out of 64 which would be useful for the further study of Litopenaeus vannamei genetic diversity The establishment of the system might lay a foundation for the application of AFLP techniques for genetic diversity studies of Litopenaeus vannamei Key words marine biology Litopenaeus vannamei genetic diversity AFLP reaction system DOI 10 3969 /J ISSN 1000-8160 2012 03 020