HL260. Influence of interferon2 on the expression of metalloproteinases22,9 and tissue inhibitor of matrix metalloproteinase21 mrna in HL260 cell line

Σχετικά έγγραφα
IL - 13 /IL - 18 ELISA PCR RT - PCR. IL - 13 IL - 18 mrna. 13 IL - 18 mrna IL - 13 /IL Th1 /Th2

Anti2leukemia effect of resveratrol of Polygonum cuspidatum exerts and possible molecular mechanism

Hepatic Stellate Cells: Multifunctional mesenchymal cells of the Liver

Journal of Ningxia Medical University. Annexin P19 mrna P < AnnexinA2 P19 mrna. AnnexinA2 P19 mrna. PCR 1.

Gro wth Properties of Typical Water Bloom Algae in Reclaimed Water

High mobility group 1 HMG1

BGP TRACP-5b BGP TRACP-5b P 0.05

The toxicity of three chitin synthesis inhibitors to Calliptamus italicus Othoptera Acridoidea

[11].,, , 316 6, ,., 15.5%, 9.8%, 2006., IDF,, ,500, 2,830.,, ,200.,,, β, [12]. 90% 2,,,,, [13-15].,, [13,

Survivin sirna. Inhibitory effect of small interference RNA targeting survivin nanospheres on human pancreatic carcinoma BXPC-3 cell growth

0. 35g kg ~ 2. 0cm 10min. Nar- 15μL 6mm

Expressions of leptin, COX22 and p27 in bile2induced gastric mucosa injury

Antimicrobial Ability of Limonene, a Natural and Active Monoterpene

Mouse Gene 2.0 ST Array Shn3. Runx2 Shn3. Runx2 Shn3 Runx2. adult. (Schnurri, Shn)3/Hivep3. Runx2 Shn/Hivep. ST2 BMP-2 Shn3

Quick algorithm f or computing core attribute

GDNF 220YL) 2,52. (glial cell line2de2. 015d 15d rived neurotrophic factor GDNF) 1993 Lin B49 (L15) (FBS) (poly2l2lysin, pll) (laminin, LN) GDNF GDNF

J. of Math. (PRC) Banach, , X = N(T ) R(T + ), Y = R(T ) N(T + ). Vol. 37 ( 2017 ) No. 5

Basic & Clinical Medicine PLGA MUC1 MUC1 IC 50 MUC1 +

svari Real-time RT-PCR RSV

Metal-free Oxidative Coupling of Amines with Sodium Sulfinates: A Mild Access to Sulfonamides

CPT. Tsuchiya. beta. quantitative RT PCR QIAGEN IGFBP. Fect Transfection Reagent sirna. RT PCR RNA Affymetrix GeneChip Expression Array

Η ΦΛΕΓΜΟΝΩ ΗΣ ΑΝΤΙ ΡΑΣΗ ΤΟΥ ΓΑΣΤΡΙΚΟΥ ΒΛΕΝΝΟΓΟΝΟΥ ΣΤΗ ΛΟΙΜΩΞΗ ΜΕ ΕΛΙΚΟΒΑΚΤΗΡΙ ΙΟ ΤΟΥ ΠΥΛΩΡΟΥ ΠΡΙΝ ΚΑΙ ΜΕΤΑ ΤΗ ΘΕΡΑΠΕΙΑ

Cellular Physiology and Biochemistry

VEGF. Survivin α Laboratoires Serono S. A. LSA 60% Santa Cruz HMG. 10% 100IU ml μg ml % VEGF Survivin

College of Life Science, Dalian Nationalities University, Dalian , PR China.

Approximation Expressions for the Temperature Integral

Gene expression of mouse in early embryonic development 3

Effects of soothing liver and invigorating spleen recipes of TCM on hepatic inflammatory cytokines of rats with nonalcoholic steatosishepatitis

HIV HIV HIV HIV AIDS 3 :.1 /-,**1 +332

Supporting Information

Influence of Flow Rate on Nitrate Removal in Flow Process

Supplementary Table 1. Primers used for RT-qPCR analysis of striatal and nigral tissue.

ACTA CHINESE MEDICINE. diabetic nephropathies DN 24. urine protein quantitation in 24 hours 24hUTP serum creatinine Scr

Correction of chromatic aberration for human eyes with diffractive-refractive hybrid elements

LUO, Hong2Qun LIU, Shao2Pu Ξ LI, Nian2Bing

ΙΩΑΝΝΗΣ ΚΛΑΓΚΑΣ. Χημικός, MSc ΔΙΔΑΚΤΟΡΙΚΗ ΔΙΑΤΡΙΒΗ ΥΠΟΒΛΗΘΗΚΕ ΣΤΗΝ ΙΑΤΡΙΚΗ ΣΧΟΛΗ ΤΟΥ ΑΡΙΣΤΟΤΕΛΕΙΟΥ ΠΑΝΕΠΙΣΤΗΜΙΟΥ ΘΕΣΣΑΛΟΝΙΚΗΣ

Study on the Strengthen Method of Masonry Structure by Steel Truss for Collapse Prevention

Accumulation of Soil Arsenic by Panax notoginseng and Its Associated Health Risk

Μελέτη της έκφρασης του ογκοκατασταλτικού γονιδίου Cyld στον καρκίνο του μαστού

A Systematic Review of Procalcitonin for Early Detection of Septicemia of Newborn

PE CVVH PE+HP HP+CVVH HP+CVVH+PE CVVH. ENLAV of HCO - 3 ENLAV-HCO ± μmol /L HP+PE HP+CVVH HP+CVVH+PE

Mitomycin C application for the prevention of postoperative synechiae formation at the anterior commissure.

Polyvinyl Chloride PVC, The effects of organotin thermal stabilizers on the dehydrochlorination of TPUΠPVC blends

CorV CVAC. CorV TU317. 1

Research of postpartum depression and progesterone estradiol change before and after childbirth

c Key words: cultivation of blood, two-sets blood culture, detection rate of germ Vol. 18 No

2 ~ 8 Hz Hz. Blondet 1 Trombetti 2-4 Symans 5. = - M p. M p. s 2 x p. s 2 x t x t. + C p. sx p. + K p. x p. C p. s 2. x tp x t.

Nucleotide Sequence of Cloned cd NA for alpha Subunit of Goat Follicle Stimulating Hormone

Comparison of HPLC fingerprint between enzymatic Calculus bovis and natural Calculus bovis

30s 56 60s 72 60s dntp cm s s s 23

ΜΟΡΙΑΚΕΣ ΜΕΘΟΔΟΙ ΚΡΙΤΗΡΙΑ ΕΠΙΛΟΓΗΣ ΑΞΙΟΛΟΓΗΣΗ

þÿ ɺÁ Ä ÅÂ, ±»Î¼ Neapolis University þÿ Á̳Á±¼¼± ¼Ìù±Â ¹ º à Â, Ç» Ÿ¹º ½ ¼¹ºÎ½ À¹ÃÄ ¼Î½ º±¹ ¹ º à  þÿ ±½µÀ¹ÃÄ ¼¹ µ À»¹Â Æ Å

KLT SMMC Anti - tumor effect in vitro of coix seed oil injection on the human liver cancer cell SMMC and the mechanism study

ΠΡΟΓΡΑΜΜΑ ΜΕΤΑΠΤΥΧΙΑΚΩΝ ΣΠΟΥΔΩΝ ΣΤΙΣ «ΚΛΙΝΙΚΕΣ ΚΑΙ ΚΛΙΝΙΚΟΕΡΓΑΣΤΗΡΙΑΚΕΣ ΙΑΤΡΙΚΕΣ ΕΙΔΙΚΟΤΗΤΕΣ»

Science of Sericulture

Ινσουλίνη και καρδιά. Ηλιάδης Φώτης Λέκτορας Α.Π.Θ.

Αθήνα, 15 Οκτωβρίου 2014 Αρ. Πρωτ.: 2988

Technical Research Report, Earthquake Research Institute, the University of Tokyo, No. +-, pp. 0 +3,,**1. No ,**1

MSM Men who have Sex with Men HIV -

Discontinuous Hermite Collocation and Diagonally Implicit RK3 for a Brain Tumour Invasion Model

9-amino-(9-deoxy)cinchona alkaloids-derived novel chiral phase-transfer catalysts

Reaction of a Platinum Electrode for the Measurement of Redox Potential of Paddy Soil

Supporting Information

Η ΨΥΧΙΑΤΡΙΚΗ - ΨΥΧΟΛΟΓΙΚΗ ΠΡΑΓΜΑΤΟΓΝΩΜΟΣΥΝΗ ΣΤΗΝ ΠΟΙΝΙΚΗ ΔΙΚΗ

Développement de virus HSV-1 (virus de l herpes simplex de type 1) oncolytiques ciblés pour traiter les carcinomes hépatocellulaires

Optimizing Microwave-assisted Extraction Process for Paprika Red Pigments Using Response Surface Methodology

Τα ηπατικά επίπεδα του FOXP3 mrna στη χρόνια ηπατίτιδα Β εξαρτώνται από την έκφραση των οδών Fas/FasL και PD-1/PD-L1

Comparison of carbon-sulfur and carbon-amine bond in therapeutic drug: -S-aromatic heterocyclic podophyllum derivatives display antitumor activity

Octretide joint proton pump inhibitors in treating non-variceal gastrointestinal bleeding a Metaanalysis

, DYY-8B, ; : Centrifuge 11 R. min

China Biotechnology, 2005, 25 (3) :74 78

microrna126 GATA mg /kg 800 November 2013 Vol. 35 No. 11 Chinese Traditional Patent Medicine 10% 5% GATA-3 40 BALB /c GATA-3 TH2 NA126

Comparison of Evapotranspiration between Indigenous Vegetation and Invading Vegetation in a Bog

http / / cjbmb. bjmu. edu. cn Chinese Journal of Biochemistry and Molecular Biology HBx HBxΔ127

Vol. 35 No Journal of South-Central University for Nationalities Nat. Sci. Edition Jun TNFα. . MDSCs

6.003: Signals and Systems. Modulation

Supplementary Table 1. Construct List with key Biophysical Properties of the expression

Biapenem BIPM Lot No g mg

Εθνικό Μετσόβιο Πολυτεχνείο ΑΝΑΠΤΥΞΗ ΤΕΧΝΙΚΗΣ ΜΕΤΡΗΣΗΣ ΕΚΚΡΙΣΗΣ ΠΡΩΤΕΪΝΩΝ ΚΟΝΤΑ ΣΤΗ ΚΥΤΤΑΡΙΚΗ ΕΠΙΦΑΝΕΙΑ

A research on the influence of dummy activity on float in an AOA network and its amendments

Inhibition of mushroom tyrosinase by flavonoid from Sorbus tianschanica Ruper in Xinjiang

Η ΥΠΕΡΕΚΦΡΑΣΗ ΤΟΥ SMAD7 ΠΡΟΣΤΑΤΕΥΕΙ ΤΟ ΗΠΑΡ ΑΠΟ ΤΗΝ TGF-Β/SMAD ΜΕΣΟΛΑΒΟΥΜΕΝΗ ΙΝΟΓΕΝΕΣΗ

( ) , ) , ; kg 1) 80 % kg. Vol. 28,No. 1 Jan.,2006 RESOURCES SCIENCE : (2006) ,2 ,,,, ; ;

Relationship between Connective Tissue Diseases and Thyroid Diseases

Supplemental file 3. All 306 mapped IDs collected by IPA program. Supplemental file 6. The functions and main focused genes in each network.

HepG hotmail. com. HepG2 Bid Bcl-2. HepG2 G0 /G1 Bid Bcl-2. HepG2. HepG2

26 3 V o l. 26 N o A cta Eco logiae A n im alis Dom astici M ay ,

TGFp FSH INH INH

Real2time Quantitative Assay of Telomerase Product Using the Duplex Scorpion Primer

17 min R A (2009) To probe into the thermal property the mechanism of the thermal decomposition and the prospective

VBA Microsoft Excel. J. Comput. Chem. Jpn., Vol. 5, No. 1, pp (2006)

3.5.4 Ο αυξητικός παράγοντας BMP Ο αυξητικός παράγοντας FGF Αυξητικός παράγοντας PDGF (Platelet Derived Growth Factor)...

CMOS Technology for Computer Architects

*,* + -+ on Bedrock Bath. Hideyuki O, Shoichi O, Takao O, Kumiko Y, Yoshinao K and Tsuneaki G

Chinese Journal of Biochemistry and Molecular Biology. p38mapk

Recent advances on metastasis suppressor related genes of lung cancer

A strategy for the identification of combinatorial bioactive compounds. contributing to the holistic effect of herbal medicines

Synthesis of Imines from Amines in Aliphatic Alcohols on Pd/ZrO 2 Catalyst at Ambient Conditions

THE EXPRESSION AND SIGNIFICANCE OF11β-HSD 2 AND TNF-α IN PLACENTA WITH HYPERTENSION DISORDERS COMPLICATING PREGNANCY

1 h, , CaCl 2. pelamis) 58.1%, (Headspace solid -phase microextraction and gas chromatography -mass spectrometry,hs -SPME - Vol. 15 No.

Transcript:

29 4 2 0 0 8 8 ( ) J ournal of Xiπan J iaot ong U niversity (Medical Sciences) V ol. 29 No. 4 Aug. 2008 IFN2 MM P22 29 TIM P21 HL260 1, 1,2, 1, 1, 1 (1., 710061 ;2., 100730) : HL260 2 9 ( MMP22 MMP29) 21 ( TIMP21) ( IFN2 ) MMP22 MMP29 TIMP21 HL260 (1-5d), RT2PCR, HL260 MMP22 MMP29 TIMP21 mrna ; IFN2 HL260,24 48 h RT2PCR MMP22 MMP29 TIMP21 mrna 24 h MMP22 MMP29 mrna, TIMP21 IFN2 MMP22 MMP29 mrna ( P < 0. 05), mrna ; TIMP21 HL260 MMP22 MMP29 TIMP21 ; IFN2 MMP22 MMP29 mrna, TIMP21 : ; ; ; 2 :R7323 ;R733. 7 :A :167128259 (2008) 0420428205 Influence of interferon2 on the expression of metalloproteinases22,9 and tissue inhibitor of matrix metalloproteinase21 mrna in HL260 cell line Liu Xin 1, Wang Ting 1,2, Yang Hua 1, Chen Wei 1, Xu Bo 1 (1. Depart ment of Hematology, t he Fir st Affiliated Ho spital, Medical School of Xiπan Jiaotong University, Xiπan 710061 ; 2. Depart ment of Hematology of Beijing Ho spital, Minist ry of Healt h, Beijing 100730, China) ABSTRACT : Objective To detect t he exp ression of MM P22, MM P29 and TIM P21 in leukemia cell line HL260, and explore t he eff ect of interf eron2 ( I FN2 ) on t heir exp ression. Methods Reverse t ranscrip tase2p olymerase chain reaction was used t o assay MM P22, 9 and TIM P21 m RNA in leukemia cell line HL260 at different time (t he first day t o t he fif t h day of t he cell growt h), and half2quantity values of t he influence on t he cells af ter t reat ment wit h I FN2 in different concent ration and diff erent time (24 hours, 48 hours). Results The exp ression of MM P2 2, 29 m RNA was significantly t he highest af ter 24 hours of t he cell culture. But the exp ression of TIMP21 mrna was constant. I FN2 in diff erent concent ration could dow n2regulate t he m RNA exp ression of MM P22, 29 ( P < 0. 05), a nd as t he conce nt ration increased, m RNA exp ression decreased. But m RNA exp ression of TIM P could not be aff ected by I FN2. Conclusion MM P22, 29 and TIM P21 m RNA are exp ressed in leukemia cell line HL260. I FN2 can inhibit exp ression of MM P22 or MM P29, but has no influence on TIM P21 m RNA exp ression. KEY WORDS : mat rix metallop roteinase (MM P) ; tissue inhibit or of metallop roteinases ; leukemia ; interferon2 ( matrix metallop roteinase, MMPs), :2007212229 :2008203203 : (No. 2005 K102G1) : (19592), ( ),,. :. E2mail : liuxin59221 @medmail. com. cn ( extracellular matrix, ECM) MMP,MMP ECM,,, [122 ], MMP ECM

4,,,. IFN2 MMP22 29 TIMP21 HL260 429 MMP22 MMP29 MMP [3],MMP (tissue inhibitor of matrix metalloproteinase, Oligo (dt) 16 1 L RNA 1 g,70 TIMP),,, 5 Reactive Buffer 4 L 10 mmol/ L dn TP mixt ure 1 L Ribolock TM MMP22 MMP29 Ribonuclease inhibitor 1 L,70,,, 1 L MML V (,200 ),42 RT2PCR, MMP22 60 min, 70 10 min MMP29 TIMP21, cdna - 20,2 PCR MMP22 9, 1. 3. 3 PCR IFN2 Priemier primer, blast 1 1. 1 HL260 RPMI21640 100 ml/ L 100 u/ ml HL260 37 50 ml/ L CO2,2-3 d, HL260 5 10 4 / ml, (1-5 d), RT2PCR IFN2 MMP22 MMP29 TIMP21, ( IFN2 ) IFN2 10 50 100 200 500 u/ ml 1. 2 IFN2 99 % ( ) ; RPMI21640 ( GIBCO ) ; ( ) ; D EPC (Sigma ) ; Trizol Reagent ( Invitrogen ) ; ( Fermentas ) ;2 PCR T aq Mix ( ) CO2 ( National Appliance Co mpany) ; GeneA mp PCR System 2400 ( PER KIN EL M ER, U SA) ; ( ) 1. 3 R T2PCR MMP22 MMP29 TIMP21 1. 3. 1 RNA Rnase, DEPC ( 4 10 5 ), TRIZOL 1 ml,,, RNA, DEPC, - 70 RNA A260/ 280 ;10 g/ L (200 V,30 min), 18 S 28 S 1. 3. 2 cdna Eppendorff ( Sangon ) MMP22 : 5 2TGACGG2 TAAGGACGGACTC23, 5 2TGGAA GGGAATG2 GAAAC23, 324 bp ; TIMP21 : 5 2 TTCCACA GGTCCCACAAC23, 5 2GCATTCCT2 CACAGCCAAC23, 165 bp ;MMP29 : 5 2TCCCTGGA GACCTGAGAACC23, 5 2CG2 GCAA GTCTTCCGAGTAGTT23, 308 bp ; 2actin : 5 2ACACTGTGCCCATCTACGA GG2 3, 5 2A GGGGCCGGACTCGTCATACT 23, 621 bp 1. 3. 4 PCR 2 PCR Taq Mix (100 mmol/ L KCl 20 mmol/ L Tris2HCl 3 mmol/ L MgCl2 0. 2 g/ L ) 12. 5 L,Primer 1 (10 mol/ L) 1 L,Primer 2 (10 mol/ L) 1 L,cDNA 1. 0 L,ddH2 O 25 L : MMP22 94 30 s,53 30 s,72 30 s, 30 ;MMP29 94 30 s,57 30 s,72 30 s, 30 ; TIMP21 94 30 s, 58 30 s,72 30 s, 30 ; 2actin 94 30 s,57 30 s,72 30 s, 30 RNA 1. 3. 5 PCR PCR 20 g/ L, 75 V, 30 ma Genesnap, ( Image Master), Genetools, ( MMP22/ 2actin MMP29/ 2actin TIMP21/ 2 actin) mrna 1. 4 3, 3,, Dunnett2t P < 0. 05

430 ( ) 29 2 2. 1 HL260 MMP22 MMP29 TIMP21 mrna HL260 MMP22 MMP29, 24h MMP22 MMP29 mrna HL260 2, TIMP21 ( 1) 1 MMP22 29 TIMP21 HL260 Fig. 1 Expression of MMP22, 9 and TIMP21 in HL260 cell line at various time 2. 2 IFN2 HL260 MMP22 MMP29 TIMP21 ( IFN2 ) IFN2 10 50 100 200 500 u/ ml, 24 48 h R T2PCR MMP22 9 ( 2 3), TIMP21 ( 4), IFN2 MMP22 MMP29 mrna ( P < 0. 05), IFN2 mrna,, TIMP21,IFN2 ( 1) 1 IFN2 HL260 MMP22 29 TIMP21 Table 1 Effect of interferon2 on MMP22, 9 and TIMP21 in HL260 cell line ( gx s, 2action) IFN2 (u/ ml) MMP22 MMP29 TIMP21 0 (Control) 1. 37 0. 05 1. 12 0. 03 2. 20 0. 16 1. 93 0. 15 1. 00 0. 08 1. 13 0. 11 10 0. 98 0. 03 3 0. 72 0. 06 3 1. 82 0. 15 3 1. 79 0. 09 3 1. 25 0. 07 1. 12 0. 09 50 0. 86 0. 03 3 0. 68 0. 06 3 1. 67 0. 04 3 1. 56 0. 05 3 0. 96 0. 06 0. 89 0. 06 100 0. 77 0. 07 3 0. 62 0. 04 3 1. 28 0. 05 3 1. 14 0. 04 3 0. 97 0. 12 1. 11 0. 09 200 0. 69 0. 04 3 0. 55 0. 02 3 1. 20 0. 06 3 1. 11 0. 03 3 0. 74 0. 05 0. 94 0. 08 500 0. 60 0. 06 3 0. 47 0. 07 3 1. 14 0. 05 3 1. 03 0. 05 3 1. 13 0. 09 1. 08 0. 06 3 P < 0. 05 vs. control 3, MMP, EMC [4 ] MMP2 2 MMP29 MMP,,, TIMP, [4 ]

4,,,. IFN2 MMP22 29 TIMP21 HL260 431,N HL MMP22 MMP29 EMC [5 ], MMP22 MMP29 (multi2 ple myeloma, MM), MM [627 ] MMP ECM, /,, Kuittinen [8 ] MMP22,, MMP22 MMP29, MMP22 MMP29, R T2PCR, HL260 MMP22 MMP29, HL260 MMP22 MMP29, 24 h,, MMP22 MMP29,,, MMP [ 9 ], AML MMP TIMP21 MMP29, TIMP21 mrna, IFN2, IFN2 HL260 MMP29, TIMP21 MMP29 mrna HL260 MMP22 MMP29, IFN2 MMP22 MMP29,,,,, MMP22 MMP29 MMP,, MMP, MMP, IFN2 TIMP, TIMP, marimastat BMS2275291 A E2941 ( neovastat ) [9 ] COL23 (metastat), III [14215 ],, IFN2 Hep22 MMP22 MMP29 mrna,, MMP, Galboiz [11 ] IFN2 MMP22 TIMP22 M T12 MMP, IFN2 HL260 MMP22 MMP29 mrnas ( P < 0. 05), IFN2,mRNA, IFN2 MMP22 MMP29 Ma [12 ] IFN2 MMP29,, STA T21, MMP,IFN2 MMP, IFN2 MMP GM2CSF, IFN2 TN F2 MMP21 ; caspase8 p382sta T1, IFN2 TN F2 MMP29 [ 13 ] IFN2 MMP22 MMP29, HL2 60 TIMP21 IFN2 TIMP MMP, MMP MMP, : [ 1 ] Polette M, Mawrocki2Raby B, Gilles C, et al. Tumour invasion and matrix metallop roteinases [ J ]. Crit Rev Oncol Hematol, 2004, 49 (1) :1792186. [ 2 ],,. MM P22 MM P29 [J ]. ( ), 2006, 41 (3) :5702571. [ 3 ],,,. MMP29 2 7 TIM P21 2 3 [J ]., 2004, 23 (10) : 119421198. [ 4 ] Furukawa A, Tsuji M, Nishitani M, et al. Role of t he matrix metallop roteinase and tissue inhibitors of metalloproteinase f ai2 milles in non2invasive and invasive tumors transplanted in mice

432 ( ) 29 with severe combined immunodeficiency [ J ]. U rology, 1998, 51 (5) :8492853. [ 5 ],,,. MMP29, MMP22 [J ]., 2006, 14 (2) :2182220. [ 6 ],,. MM P22 MM P29 [J ]., 2006, 16 (7) :5782580. [ 7 ]Sfirida ki A, Miyakis S, Tsira kis G, et al. Syste mic levels of in2 terleukin26 and matrix metallop roteinase29 in patients with mul2 tiple myeloma may be usef ul as p rognostic indexes of bone dis2 ease [J ]. Clin Chem L ab Med, 2005, 43 (9) :9342938. [ 8 ] Kuittinen O, Savolainen ER, Koistinen P, et al. Gelatinase A and B ( MMP22, MMP29) in leukaemia MMP22 may indicate a good p rognosis in AML [J ]. A ntica nceres Res, 1999, 19 (5C) : 439524400. [ 9 ],,,. 82 V EGF MM P22 MM P29 [ J ]. 2006, 14 (1) :15220., [ 10 ],,,. TN F2 I FN2 Hep22 MM Ps [J ]. ( ), 2002, 28 (6) :5872590. [ 11 ] Galboiz Y, Shapiro S, L ahat N, et al. Modulation of mono2 cytes matrix metalloproteinase22, M T12MMP and TIMP22 by in2 terf eron2 a nd2 : implications to multiple sclerosis [J ]. J Neu2 roimmunol, 2002, 131 (122) :1912200. [ 12 ] Ma Z, Qin H, Benveniste EN. Transcriptional supp ression of mat rix metallop roteinase29 gene exp ression by I FN2 a nd I FN2 beta [J ]. J I mmunol, 2001, 167 (9) :515025159. [ 13 ] Zhou M, Zha ng Y, A rda ns J A, et al. Interf eron2 ga mma dif2 f erentially regulates monocyte matrix metallop roteinase21 and 29 t hrough tumor necrosis f act or2 and caspase 8 [ J ]. J Biol Chem, 2003, 278 (46) :45406245413. [ 14 ] Yip D, Ahmad A, Karapetis CS, et al. Matrix metalloprotein2 ase inhibitors : applications in oncology [J ]. Invest New Drugs, 1999, 17 (4) :3872399. [ 15 ] Wojtowicz2Praga S. Clinical p otential of matrix metallop rotease inhibitors [J ]. D rugs In R&D, 1999, 1 (2) :1172129. ( ) ( 403 ) : [ 1 ] A mbrosini G, Adida C, Altieri DC. A novel anti2ap optosis gene, survivin, exp ressed in cancer and lymp homa [ J ]. Nat Med, 1997, 3 (8) :9172921. [ 2 ]Altieri DC. Survivin, versatile modulation of cell division and ap optosis in ca ncer [J ]. Oncogene, 2003, 22 (53) :858128589. [ 3 ]Jia ng X, Wilf ord C, Duensing S, et al. Particip ation of survivin in mitotic and apoptotic activities of nor mal and tumor2derived cells [J ]. J Cell Bioche m, 2001, 83 (2) :3422354. [ 4 ]Skonfias DA, Mollinari C, L acroix FB, et al. Huma n survivin is a kinet ochore2associated passenger p rotein [J ]. J Cell Biol, 2000, 151 (7) :157521582. [ 5 ]Bla nc2brude O P, Mesri M, Wall N R, et al. Therap eutic targe2 ting of t he survivin pathway in cancer : initiation of mitochon2 drial ap optosis and supp ression of tumor2associated angiogenesis [J ]. Clin Cancer Res, 2003, 9 (6) :268322692. [ 6 ] Altieri D C. Targeted t herapy by disabling crossroad signaling networks :the survivin paradigm [J ]. Mol Cancer Ther, 2006, 5 (3) :4782482. [ 7 ] Fortugno P, Belt ra mi E, Plecia J, et al. Regulation of survivin f unction by Hsp90 [J ]. PNAS, 2003, 100 (24) :13791213796. [ 8 ] Plesia J, Salz W, Xia F, et al. Rational design of shep herdin, a novel anticancer agent [J ]. Cancer Cell, 2005, 7 (5) :4572468. [ 9 ] Richard J P, Melikov K, Brooks H, et al. Cellular upta ke of un2 conjugated TA T peptide involves clathrin2dependent endocyto2 sis and heparan sulf ate receptors [J ]. J Biol Chem, 2005, 280 (15) :15300215306. [ 10 ],,,. N T42NA P [ J ]., 2004, 37 ( 3) : 2602261. ( )