29 4 2 0 0 8 8 ( ) J ournal of Xiπan J iaot ong U niversity (Medical Sciences) V ol. 29 No. 4 Aug. 2008 IFN2 MM P22 29 TIM P21 HL260 1, 1,2, 1, 1, 1 (1., 710061 ;2., 100730) : HL260 2 9 ( MMP22 MMP29) 21 ( TIMP21) ( IFN2 ) MMP22 MMP29 TIMP21 HL260 (1-5d), RT2PCR, HL260 MMP22 MMP29 TIMP21 mrna ; IFN2 HL260,24 48 h RT2PCR MMP22 MMP29 TIMP21 mrna 24 h MMP22 MMP29 mrna, TIMP21 IFN2 MMP22 MMP29 mrna ( P < 0. 05), mrna ; TIMP21 HL260 MMP22 MMP29 TIMP21 ; IFN2 MMP22 MMP29 mrna, TIMP21 : ; ; ; 2 :R7323 ;R733. 7 :A :167128259 (2008) 0420428205 Influence of interferon2 on the expression of metalloproteinases22,9 and tissue inhibitor of matrix metalloproteinase21 mrna in HL260 cell line Liu Xin 1, Wang Ting 1,2, Yang Hua 1, Chen Wei 1, Xu Bo 1 (1. Depart ment of Hematology, t he Fir st Affiliated Ho spital, Medical School of Xiπan Jiaotong University, Xiπan 710061 ; 2. Depart ment of Hematology of Beijing Ho spital, Minist ry of Healt h, Beijing 100730, China) ABSTRACT : Objective To detect t he exp ression of MM P22, MM P29 and TIM P21 in leukemia cell line HL260, and explore t he eff ect of interf eron2 ( I FN2 ) on t heir exp ression. Methods Reverse t ranscrip tase2p olymerase chain reaction was used t o assay MM P22, 9 and TIM P21 m RNA in leukemia cell line HL260 at different time (t he first day t o t he fif t h day of t he cell growt h), and half2quantity values of t he influence on t he cells af ter t reat ment wit h I FN2 in different concent ration and diff erent time (24 hours, 48 hours). Results The exp ression of MM P2 2, 29 m RNA was significantly t he highest af ter 24 hours of t he cell culture. But the exp ression of TIMP21 mrna was constant. I FN2 in diff erent concent ration could dow n2regulate t he m RNA exp ression of MM P22, 29 ( P < 0. 05), a nd as t he conce nt ration increased, m RNA exp ression decreased. But m RNA exp ression of TIM P could not be aff ected by I FN2. Conclusion MM P22, 29 and TIM P21 m RNA are exp ressed in leukemia cell line HL260. I FN2 can inhibit exp ression of MM P22 or MM P29, but has no influence on TIM P21 m RNA exp ression. KEY WORDS : mat rix metallop roteinase (MM P) ; tissue inhibit or of metallop roteinases ; leukemia ; interferon2 ( matrix metallop roteinase, MMPs), :2007212229 :2008203203 : (No. 2005 K102G1) : (19592), ( ),,. :. E2mail : liuxin59221 @medmail. com. cn ( extracellular matrix, ECM) MMP,MMP ECM,,, [122 ], MMP ECM
4,,,. IFN2 MMP22 29 TIMP21 HL260 429 MMP22 MMP29 MMP [3],MMP (tissue inhibitor of matrix metalloproteinase, Oligo (dt) 16 1 L RNA 1 g,70 TIMP),,, 5 Reactive Buffer 4 L 10 mmol/ L dn TP mixt ure 1 L Ribolock TM MMP22 MMP29 Ribonuclease inhibitor 1 L,70,,, 1 L MML V (,200 ),42 RT2PCR, MMP22 60 min, 70 10 min MMP29 TIMP21, cdna - 20,2 PCR MMP22 9, 1. 3. 3 PCR IFN2 Priemier primer, blast 1 1. 1 HL260 RPMI21640 100 ml/ L 100 u/ ml HL260 37 50 ml/ L CO2,2-3 d, HL260 5 10 4 / ml, (1-5 d), RT2PCR IFN2 MMP22 MMP29 TIMP21, ( IFN2 ) IFN2 10 50 100 200 500 u/ ml 1. 2 IFN2 99 % ( ) ; RPMI21640 ( GIBCO ) ; ( ) ; D EPC (Sigma ) ; Trizol Reagent ( Invitrogen ) ; ( Fermentas ) ;2 PCR T aq Mix ( ) CO2 ( National Appliance Co mpany) ; GeneA mp PCR System 2400 ( PER KIN EL M ER, U SA) ; ( ) 1. 3 R T2PCR MMP22 MMP29 TIMP21 1. 3. 1 RNA Rnase, DEPC ( 4 10 5 ), TRIZOL 1 ml,,, RNA, DEPC, - 70 RNA A260/ 280 ;10 g/ L (200 V,30 min), 18 S 28 S 1. 3. 2 cdna Eppendorff ( Sangon ) MMP22 : 5 2TGACGG2 TAAGGACGGACTC23, 5 2TGGAA GGGAATG2 GAAAC23, 324 bp ; TIMP21 : 5 2 TTCCACA GGTCCCACAAC23, 5 2GCATTCCT2 CACAGCCAAC23, 165 bp ;MMP29 : 5 2TCCCTGGA GACCTGAGAACC23, 5 2CG2 GCAA GTCTTCCGAGTAGTT23, 308 bp ; 2actin : 5 2ACACTGTGCCCATCTACGA GG2 3, 5 2A GGGGCCGGACTCGTCATACT 23, 621 bp 1. 3. 4 PCR 2 PCR Taq Mix (100 mmol/ L KCl 20 mmol/ L Tris2HCl 3 mmol/ L MgCl2 0. 2 g/ L ) 12. 5 L,Primer 1 (10 mol/ L) 1 L,Primer 2 (10 mol/ L) 1 L,cDNA 1. 0 L,ddH2 O 25 L : MMP22 94 30 s,53 30 s,72 30 s, 30 ;MMP29 94 30 s,57 30 s,72 30 s, 30 ; TIMP21 94 30 s, 58 30 s,72 30 s, 30 ; 2actin 94 30 s,57 30 s,72 30 s, 30 RNA 1. 3. 5 PCR PCR 20 g/ L, 75 V, 30 ma Genesnap, ( Image Master), Genetools, ( MMP22/ 2actin MMP29/ 2actin TIMP21/ 2 actin) mrna 1. 4 3, 3,, Dunnett2t P < 0. 05
430 ( ) 29 2 2. 1 HL260 MMP22 MMP29 TIMP21 mrna HL260 MMP22 MMP29, 24h MMP22 MMP29 mrna HL260 2, TIMP21 ( 1) 1 MMP22 29 TIMP21 HL260 Fig. 1 Expression of MMP22, 9 and TIMP21 in HL260 cell line at various time 2. 2 IFN2 HL260 MMP22 MMP29 TIMP21 ( IFN2 ) IFN2 10 50 100 200 500 u/ ml, 24 48 h R T2PCR MMP22 9 ( 2 3), TIMP21 ( 4), IFN2 MMP22 MMP29 mrna ( P < 0. 05), IFN2 mrna,, TIMP21,IFN2 ( 1) 1 IFN2 HL260 MMP22 29 TIMP21 Table 1 Effect of interferon2 on MMP22, 9 and TIMP21 in HL260 cell line ( gx s, 2action) IFN2 (u/ ml) MMP22 MMP29 TIMP21 0 (Control) 1. 37 0. 05 1. 12 0. 03 2. 20 0. 16 1. 93 0. 15 1. 00 0. 08 1. 13 0. 11 10 0. 98 0. 03 3 0. 72 0. 06 3 1. 82 0. 15 3 1. 79 0. 09 3 1. 25 0. 07 1. 12 0. 09 50 0. 86 0. 03 3 0. 68 0. 06 3 1. 67 0. 04 3 1. 56 0. 05 3 0. 96 0. 06 0. 89 0. 06 100 0. 77 0. 07 3 0. 62 0. 04 3 1. 28 0. 05 3 1. 14 0. 04 3 0. 97 0. 12 1. 11 0. 09 200 0. 69 0. 04 3 0. 55 0. 02 3 1. 20 0. 06 3 1. 11 0. 03 3 0. 74 0. 05 0. 94 0. 08 500 0. 60 0. 06 3 0. 47 0. 07 3 1. 14 0. 05 3 1. 03 0. 05 3 1. 13 0. 09 1. 08 0. 06 3 P < 0. 05 vs. control 3, MMP, EMC [4 ] MMP2 2 MMP29 MMP,,, TIMP, [4 ]
4,,,. IFN2 MMP22 29 TIMP21 HL260 431,N HL MMP22 MMP29 EMC [5 ], MMP22 MMP29 (multi2 ple myeloma, MM), MM [627 ] MMP ECM, /,, Kuittinen [8 ] MMP22,, MMP22 MMP29, MMP22 MMP29, R T2PCR, HL260 MMP22 MMP29, HL260 MMP22 MMP29, 24 h,, MMP22 MMP29,,, MMP [ 9 ], AML MMP TIMP21 MMP29, TIMP21 mrna, IFN2, IFN2 HL260 MMP29, TIMP21 MMP29 mrna HL260 MMP22 MMP29, IFN2 MMP22 MMP29,,,,, MMP22 MMP29 MMP,, MMP, MMP, IFN2 TIMP, TIMP, marimastat BMS2275291 A E2941 ( neovastat ) [9 ] COL23 (metastat), III [14215 ],, IFN2 Hep22 MMP22 MMP29 mrna,, MMP, Galboiz [11 ] IFN2 MMP22 TIMP22 M T12 MMP, IFN2 HL260 MMP22 MMP29 mrnas ( P < 0. 05), IFN2,mRNA, IFN2 MMP22 MMP29 Ma [12 ] IFN2 MMP29,, STA T21, MMP,IFN2 MMP, IFN2 MMP GM2CSF, IFN2 TN F2 MMP21 ; caspase8 p382sta T1, IFN2 TN F2 MMP29 [ 13 ] IFN2 MMP22 MMP29, HL2 60 TIMP21 IFN2 TIMP MMP, MMP MMP, : [ 1 ] Polette M, Mawrocki2Raby B, Gilles C, et al. Tumour invasion and matrix metallop roteinases [ J ]. Crit Rev Oncol Hematol, 2004, 49 (1) :1792186. [ 2 ],,. MM P22 MM P29 [J ]. ( ), 2006, 41 (3) :5702571. [ 3 ],,,. MMP29 2 7 TIM P21 2 3 [J ]., 2004, 23 (10) : 119421198. [ 4 ] Furukawa A, Tsuji M, Nishitani M, et al. Role of t he matrix metallop roteinase and tissue inhibitors of metalloproteinase f ai2 milles in non2invasive and invasive tumors transplanted in mice
432 ( ) 29 with severe combined immunodeficiency [ J ]. U rology, 1998, 51 (5) :8492853. [ 5 ],,,. MMP29, MMP22 [J ]., 2006, 14 (2) :2182220. [ 6 ],,. MM P22 MM P29 [J ]., 2006, 16 (7) :5782580. [ 7 ]Sfirida ki A, Miyakis S, Tsira kis G, et al. Syste mic levels of in2 terleukin26 and matrix metallop roteinase29 in patients with mul2 tiple myeloma may be usef ul as p rognostic indexes of bone dis2 ease [J ]. Clin Chem L ab Med, 2005, 43 (9) :9342938. [ 8 ] Kuittinen O, Savolainen ER, Koistinen P, et al. Gelatinase A and B ( MMP22, MMP29) in leukaemia MMP22 may indicate a good p rognosis in AML [J ]. A ntica nceres Res, 1999, 19 (5C) : 439524400. [ 9 ],,,. 82 V EGF MM P22 MM P29 [ J ]. 2006, 14 (1) :15220., [ 10 ],,,. TN F2 I FN2 Hep22 MM Ps [J ]. ( ), 2002, 28 (6) :5872590. [ 11 ] Galboiz Y, Shapiro S, L ahat N, et al. Modulation of mono2 cytes matrix metalloproteinase22, M T12MMP and TIMP22 by in2 terf eron2 a nd2 : implications to multiple sclerosis [J ]. J Neu2 roimmunol, 2002, 131 (122) :1912200. [ 12 ] Ma Z, Qin H, Benveniste EN. Transcriptional supp ression of mat rix metallop roteinase29 gene exp ression by I FN2 a nd I FN2 beta [J ]. J I mmunol, 2001, 167 (9) :515025159. [ 13 ] Zhou M, Zha ng Y, A rda ns J A, et al. Interf eron2 ga mma dif2 f erentially regulates monocyte matrix metallop roteinase21 and 29 t hrough tumor necrosis f act or2 and caspase 8 [ J ]. J Biol Chem, 2003, 278 (46) :45406245413. [ 14 ] Yip D, Ahmad A, Karapetis CS, et al. Matrix metalloprotein2 ase inhibitors : applications in oncology [J ]. Invest New Drugs, 1999, 17 (4) :3872399. [ 15 ] Wojtowicz2Praga S. Clinical p otential of matrix metallop rotease inhibitors [J ]. D rugs In R&D, 1999, 1 (2) :1172129. ( ) ( 403 ) : [ 1 ] A mbrosini G, Adida C, Altieri DC. A novel anti2ap optosis gene, survivin, exp ressed in cancer and lymp homa [ J ]. Nat Med, 1997, 3 (8) :9172921. [ 2 ]Altieri DC. Survivin, versatile modulation of cell division and ap optosis in ca ncer [J ]. Oncogene, 2003, 22 (53) :858128589. [ 3 ]Jia ng X, Wilf ord C, Duensing S, et al. Particip ation of survivin in mitotic and apoptotic activities of nor mal and tumor2derived cells [J ]. J Cell Bioche m, 2001, 83 (2) :3422354. [ 4 ]Skonfias DA, Mollinari C, L acroix FB, et al. Huma n survivin is a kinet ochore2associated passenger p rotein [J ]. J Cell Biol, 2000, 151 (7) :157521582. [ 5 ]Bla nc2brude O P, Mesri M, Wall N R, et al. Therap eutic targe2 ting of t he survivin pathway in cancer : initiation of mitochon2 drial ap optosis and supp ression of tumor2associated angiogenesis [J ]. Clin Cancer Res, 2003, 9 (6) :268322692. [ 6 ] Altieri D C. Targeted t herapy by disabling crossroad signaling networks :the survivin paradigm [J ]. Mol Cancer Ther, 2006, 5 (3) :4782482. [ 7 ] Fortugno P, Belt ra mi E, Plecia J, et al. Regulation of survivin f unction by Hsp90 [J ]. PNAS, 2003, 100 (24) :13791213796. [ 8 ] Plesia J, Salz W, Xia F, et al. Rational design of shep herdin, a novel anticancer agent [J ]. Cancer Cell, 2005, 7 (5) :4572468. [ 9 ] Richard J P, Melikov K, Brooks H, et al. Cellular upta ke of un2 conjugated TA T peptide involves clathrin2dependent endocyto2 sis and heparan sulf ate receptors [J ]. J Biol Chem, 2005, 280 (15) :15300215306. [ 10 ],,,. N T42NA P [ J ]., 2004, 37 ( 3) : 2602261. ( )