2005,38(9):1898-1904 Scientia Agricultura Sinica 2 2 1 ( 150001 2 100050) equine infectious anemia virus, EIAV DV 100 PCR DV 3 plg338 pd70344 3 RT-PCR 1 EIAV pd70344v 1 EIAV Development of a Molecular Clone of Chinese Equine Infectious Anemia Virus Donkey Adapted Strain WANG Xiao-jun 1, WEI Li-li 1, XIANG Wen-hua 1, ZHANG Xiao-yan 2, LÜ Xiao-ling 1, ZHAO Li-ping 1, ZHU Yuan-mao 1, SHAO Yi-ming 2, SHEN Rong-xian 1 ( 1 Harbin Veterinary Research Institute of Chinese Academy of Agricultural Sciences, Harbin 150001; 2 National Center for AIDS/STD Prevention and Control, Chinese Center Disease Control and Prevention, Beijing 100050) Abstract: An equine infectious anemia virus donkey adapted strain (designated as DV), which has lethal virulence to horse and donkey, was obtained through serials passaging in donkeys in vivo used a wide-type EIAV isolate. Three fragments covering entire genome of DV were amplified by PCR techniques from DV infected donkey leucocyte culture. The full-length genome was cloned into a low-copy number vector plg338 using molecular clone strategies and a recombinant plasmid (designated pd70344) was obtained. pd70344 was used to transfect fetal donkey dermal cell culture in vitro and passaged in donkey leucocyte cells. The supernatants of passages were tested to be positive by reverse transcriptase activity (RT) assay and EIAV special RT-PCR. Cytopathogenic effects were observed by 5-6 days post infection in donkey leukocyte infected with the pd70344 derived virus. EIAV-like virions were also observed by electronic microscope in donkey leukocyte passages. And sequence analysis of this derived virus shows highly coincident with original DV strain. Tow donkeys were inoculated with this virus and developed typical equine infectious anemia symptom. These results showed that a pathogenic infectious molecular clone of EIAV DV was obtained, and it has provided an important tool for evaluating of gene function on EIAV attenuation. Key words: Equine infectious anemia virus; Donkey adapted virus; Molecular clone equine enfectious anemia virus, infectious anemia, EIA, EIAV EIAV 20 70 EIAV equine 2004-11-02 No. 2001CCA00600 No.30200200 1974- Tel 0451-85935072 Fax: 0451-82733132 E-mail: wxj74@sohu.com Tel 0451-85935070 Fax: 0451-82733132 E-mail: hvriwang@yahoo.com.cn
9 1899 donkey adapted EIAV, DV [1,2] 1. DV 10 6 FDD 100% EIAV EIA AGID [3] 1.2 env 3 LTR pgem-t easy vector Amp r Promega [4,5] Gag p9 5 N 31 EIAV UK [6] plg338 Amp r NIH E. coli DH5α 1.3 EIAV 1 1 Table 1 Primers used for gene clone Primer Sequence Position LTR-F5 TGT GGG ATT AAT ATA AGA TTC T 1-19 LTR-R5 TGT TAG ATC TTG AAA ACA AGA C 320-303 PR40 GAT GTG AAT ATA CCA TGT CTG 3523-3503 P732 ACC GCA ATA ACC GCA TTT GTG ACG 115-138 Ev-Fa CTG GAA TTC GTC GAC AGC AGA GGA GAA CTT ACA G 398-418 Ev-Ra CAG ACT CGA GCA GGG ACT CAG ACC GCA GAA TC 8168-8150 1271015 The sequence of EIAV DV was used as references (unpublished) 1.4 EIAV Sac Hind pt_3.5 K 2.5 kb Sac Hind pt_7.7k, 8.5 kb TNE 0.1mol L -1 Tris-HCl, ph 8.0 Qiagen Genomenic DNA Kit Qiagen Mlu I plg_ltr CIAP 8.0 kb DNA LTR-F5/LTR-R5 LTR 321 bp Mlu I Mlu I plg_ltr pgem T easy vector DH5α EcoR I P26 GR11 PCR pt_ltr EcoR I T7 plg338 - ( plg338 Mlu I ) plg_ltr Expand TM Long Template PCR System BOEHRINGER MANNHEIM gag 3.5 kb pol-env 3 LTR 7.7 kb pgem T easy vector pt_3.5 K pt_7.7 K 2.5 kb 8.5 kb pt_8.0 K Mlu I pt_8.0 K 8.0 kb pd70344 1 1.5 EIAV plg_d EIAV GCG ORF
1900 38 1 EIAV D Fig. 1 Strategy of construction of a full length genome clone of EIAV DV 1.6 90% MEM, 10% Winzard PureFection Plasmid DNA Purification 5 cm 5 cm 70% System (Promega ) pd70344 72 96 h EIAV UK 5 10 µg 100% 5 DOTAP Liposomal Transfection System Roche 7 d
9 1901 plg338 EIAV UK 1.7 1.7. (RT) 4 2 000 g 30 min 2 4 100 000 g 30 min 2-70 RT-PCR Boehringer Mainnheim 3 500 bp 1.7.2 mrna 1 ml FDD DL 5 10 d 2 4 QIAamp Viral RNA Mini Kit RNA EIAV env EV-R62 5 TGTATT 100 nm GCTGCCTTGTTGTC 3, 6197-6217 3 pd70344 cdna PCR EV-F88 5 RT 2 pd70344 EIAV UK 4 RT pd70344v GGTTCATTTCCTGGGTGTAG 3,5694-5713 / EV- R62 1.7.3 2 RT Table 2 Reverse transcriptase activity in supernatants of cell culture EIA 1 2 3 4 1.8 Passage 1 Passage 2 Passage 3 Passage 4 pd70344 / EIAV UK / 4 2 4 ml plg338 vector PCR Cell control 2.3 2 pd70344vf4 2 03008 03009 2.1 EIAV 7 12 40 PCR DV116 DNA 321 bp 3.5 kb 7.7 kb 3 03008 5 d pgem-t easy vector, DV DV DV DNA 8 236 03009 18 d 1 316 5 LTR gag 458 1 915 pol 1 732 5 2 2 112 env 5 308 7 899 3 LTR 7 920 8 236 pd70344vf4 gag pol env tat rev S2 1.4 DV116 4 plg338 3 plgd70 344 2.2
1902 38 A B A. DL B. DL A. Normal donkey leukocyte culture; B. CPE occurred on donkey leukocyte culture after infected with EIAV 2 pd70344 DL CPE Fig. 2 CPE occurred on donkey leukocyte culture after infected with EIAV EIAV LN 100% DV EIAV 8.2 kb [4,5] 3 EIAV DV Fig. 3 Virion under electron microscope on donkey leukocyte cell culture infected by virus deriverd from molecular clone pd70344 HIV [7,8] 20 70 [7,8] [1] EIAV
9 1903 4 Fig.4 Temperatures of experimental infected animals env 3 LTR env Chinese 4 [2] [9,10] LTR [11].... 1983: 21-33. Shen R X. Development and application of Chinese equine infectious anemia donkey leukocyte attenuated vaccine. The International EIAV 21-33. in Chinese horses. Journal of Virology, 1990, 64(12):5 750-5 756. virus. Journal of Virology, 1998, 72(1):483-487. Congress of Immunology on Equine Infectious Anemia, Harbin. 1983: [3] Whetter L, Archambault D, Perry S, Gazit A, Coggins L, Yaniv A, Clabough D, Dahlberg J, Fuller F, Tronick S. Equine infectious anemia virus derived from a molecular clone persistently infects [4] Payne S L, Qi X M, Shao H, Dwyer A, Fuller F J. Disease induction by virus derived from molecular clones of equine infectious anemia [5] Cook R F, Leroux C, Cook S J, Berger S L, Lichtenstein D L, Ghabrial N N, Montelaro R C, Issel C J. Development and characterization of an in vivo pathogenic molecular clone of equine infectious anemia virus. Journal of Virology, 1998 72(2): 1 383- plg338 EIAVUK 1 393. NIH [6] Chen C, Li F, Montelaro R C. Functional roles of equine infectious anemia virus Gag p9 in viral budding and infection. Journal of References Virology, 2001 75(20): 9 762-9 770. [1],,.. [7] Jia B, He X, Fan X J, Liu Z Y, Zhao Q B, Shen R X, Shao Y M. 1979 12 4 1-15. Immune protection induced by the infectious clone of live-attenuated Shen R X, Xu Z D, He Y S. Immune study of equine infectious EIAV vaccine strain against lethal challenge of wild-type EIAV. anemia virus. Scientia Agricultura Sinica, 1979, 12(4) :1-15. in Presented at AIDS Vaccine 2001, Philadelphia, PA, USA.
1904 38 [8],,,,,. China CDC.., 2003, [11],,,,,,,, 36(12) :1 560 1 565. Wang L, Tong G Z, Qiu H J, Gu S L, Tu Y B, Yang B. Infectious molecular clone derived from equine infectious anemia virus chinese donkey leukocyte attenuated strain. Scientia Agricultura Sinica, 2003, 36(12) :1 560-1 565. in Chinese [9] He X, Shao Y, Xue F, Fan X, Jia B, Zhao Q, Shen R X. Construction of infectious equine anemia virus ( EIAV) chimeric clones. Chinese,. LTR., 2005,20(2): 149-154. Wei L L, Wang X J, Wang Y, Liang H, Shen T, Li J P, Zhang X Y, Xiang W H, Shao Y M, Shen R X. Construction of a chimeric infectious clone of Chinese equine infectious anemia virus by partial LTR substitution. Virologica Sinica, 2005, 20(2):149-154. (in Chinese Journal of Virology, 2003, 19: 128-132. [10] He X, Shao Y M. Construction of EIAV chimeric clones and the ( ) study of its biological characteristics. Ph.D. Thesis. 2002, NCAIDS, 2006 ISSN 1001-7216 CN 33-1146/S Rice Science ISSN 1672-6308 CN 33-1317/S 20 2004 0.975 74 4 663 219 8 2005 10.00 60.00 32-94 Q6533 10.00 40.00 359 310006 0571-63370278 E-mail cjrs@263.net cjrs@fy.hz.zj.cn