CBF1. Study on CBF1 Gene Transferred from Transgenic Strawberry to Nontransgenic

Σχετικά έγγραφα
Studies on the Binding Mechanism of Several Antibiotics and Human Serum Albumin

LUO, Hong2Qun LIU, Shao2Pu Ξ LI, Nian2Bing

8Q5SAC) 8Q5SAC UV2Vis 8500 ( ) ; PHS23C ) ;721 ( ) :1 4. ;8Q5SAC : molπl ;Britton2Robinson Q5SAC BSA Britton2Robinson,

Study on AgrobacteriunΟmediated transformation of tobacco plant with rol C gene

Antimicrobial Ability of Limonene, a Natural and Active Monoterpene

Approximation Expressions for the Temperature Integral

Accumulation of Soil Arsenic by Panax notoginseng and Its Associated Health Risk

1 h, , CaCl 2. pelamis) 58.1%, (Headspace solid -phase microextraction and gas chromatography -mass spectrometry,hs -SPME - Vol. 15 No.

CorV CVAC. CorV TU317. 1

Quick algorithm f or computing core attribute

JOURNAL OF BEIJ ING FORESTRY UNIVERSITY

Composition Analysis of Protein and Oil and Amino Acids of the Soybean Varieties in Heilongjiang Province of China

) ; GSP ) ;PXD g, 100 ml

IL - 13 /IL - 18 ELISA PCR RT - PCR. IL - 13 IL - 18 mrna. 13 IL - 18 mrna IL - 13 /IL Th1 /Th2

Optimizing Microwave-assisted Extraction Process for Paprika Red Pigments Using Response Surface Methodology

J. of Math. (PRC) Banach, , X = N(T ) R(T + ), Y = R(T ) N(T + ). Vol. 37 ( 2017 ) No. 5

The toxicity of three chitin synthesis inhibitors to Calliptamus italicus Othoptera Acridoidea

,,, (, ) , ;,,, ; -

Rapid Raman spectra identification and determination of levofloxacin hydrochloride injection *

Autoxidation of Commercial Edible Oils and Emulsified Liquid Type Dressing by the Simple Method for the Determination of Peroxide Value

2 PbO 2. Pb 3 O 4 Sn. Ti/SnO 2 -Sb 2 O 4 -CF/PbO x SnO 2 -Sb PbO 2. Sn-Sb 1:1. 1 h. Sn:Sb=10:1. PbO 2 - CeO 2 PbO 2. [8] SnO 2 +Sb 2 O 4 _

Study on the Solubility of Kiwi Fruit Seed Oil in Supercritical Carbon Dioxide

Supporting information. An unusual bifunctional Tb-MOF for highly sensing of Ba 2+ ions and remarkable selectivities of CO 2 /N 2 and CO 2 /CH 4

Screening of Respiration-deficient Saccharomyces cerevisiae Strains with Sugar-and Thermo-tolerances

Quantum dot sensitized solar cells with efficiency over 12% based on tetraethyl orthosilicate additive in polysulfide electrolyte

Electronic Supplementary Information

Supplementary Information. Living Ring-Opening Polymerization of Lactones by N-Heterocyclic Olefin/Al(C 6 F 5 ) 3

Differences in Contents of Neutral Aroma Components and Sensory Evaluation in Air-cured Burley Leaves from Different Curing Barns

Supporting Information

1 (forward modeling) 2 (data-driven modeling) e- Quest EnergyPlus DeST 1.1. {X t } ARMA. S.Sp. Pappas [4]

Gro wth Properties of Typical Water Bloom Algae in Reclaimed Water

Varietal Differences in Response of Main Root Traits to Nitrogen Application Time in Rice ( Oryza sativa L. )

Study on Re-adhesion control by monitoring excessive angular momentum in electric railway traction

THE GENETIC TRANSFORMATION OF STRAWBERRY WITH WINTER FLOUNDER ANTIFREEZE PROTEIN GENE

( ) , ) , ; kg 1) 80 % kg. Vol. 28,No. 1 Jan.,2006 RESOURCES SCIENCE : (2006) ,2 ,,,, ; ;

ER-Tree (Extended R*-Tree)

Supporting Information

Identification of Fish Species using DNA Method

Inhibition of mushroom tyrosinase by flavonoid from Sorbus tianschanica Ruper in Xinjiang

Congruence Classes of Invertible Matrices of Order 3 over F 2

N 2. Temperature Programmed Surface Reaction of N 2Nitrosonornicotine on Zeolites and Molecular Sieves

Nguyen Hien Trang* **

Motion analysis and simulation of a stratospheric airship

Vol. 38 No Journal of Jiangxi Normal University Natural Science Nov. 2014

90 [, ] p Panel nested error structure) : Lagrange-multiple LM) Honda [3] LM ; King Wu, Baltagi, Chang Li [4] Moulton Randolph ANOVA) F p Panel,, p Z

Comparison of carbon-sulfur and carbon-amine bond in therapeutic drug: -S-aromatic heterocyclic podophyllum derivatives display antitumor activity

Octretide joint proton pump inhibitors in treating non-variceal gastrointestinal bleeding a Metaanalysis

Comparative Study on Determinations of BTEX in Soils from Industrial Contaminated Sites

Design and Fabrication of Water Heater with Electromagnetic Induction Heating

Extract Isolation Purification and Identification of Polysaccharides from Exocarp of Unripe Fruits of Juglans mandshurica

# School of Pharmaceutical Sciences, Zhengzhou University, 100 Kexue Avenue, Zhengzhou, Henan , China.

VBA Microsoft Excel. J. Comput. Chem. Jpn., Vol. 5, No. 1, pp (2006)

Reaction of a Platinum Electrode for the Measurement of Redox Potential of Paddy Soil

SCITECH Volume 13, Issue 2 RESEARCH ORGANISATION Published online: March 29, 2018

Study on the Strengthen Method of Masonry Structure by Steel Truss for Collapse Prevention

Influence of Flow Rate on Nitrate Removal in Flow Process

. O 2 + 2H 2 O + 4e 4OH -

ACTA MATHEMATICAE APPLICATAE SINICA Nov., ( µ ) ( (

Lewis Acid Catalyzed Propargylation of Arenes with O-Propargyl Trichloroacetimidate: Synthesis of 1,3-Diarylpropynes

Copper-catalyzed formal O-H insertion reaction of α-diazo-1,3-dicarb- onyl compounds to carboxylic acids with the assistance of isocyanide

, Litrrow. Maxwell. Helmholtz Fredholm, . 40 Maystre [4 ], Goray [5 ], Kleemann [6 ] PACC: 4210, 4110H

Rapid determination of soluble reactive silicate in seawater by flow injection analysis with spectrophotometric detection and its application

Supplementary information:

Apr Vol.26 No.2. Pure and Applied Mathematics O157.5 A (2010) (d(u)d(v)) α, 1, (1969-),,.

, DYY-8B, ; : Centrifuge 11 R. min

Supplementary Information for

The Exploitation and Utilization of Magnesium Resources in Salt Lakes

Error ana lysis of P2wave non2hyperbolic m oveout veloc ity in layered media

(II) * PACS: a, Hj 300. ) [6 9] ) [10 23] ) [26 30]. . Deng [24,25] Acta Phys. Sin. Vol. 61, No. 15 (2012)

Vol. 31,No JOURNAL OF CHINA UNIVERSITY OF SCIENCE AND TECHNOLOGY Feb

Trace gas emissions from soil ecosystems and their implications in the atmospheric environment

Preparation of Hydroxyapatite Coatings on Enamel by Electrochemical Technique

MSM Men who have Sex with Men HIV -

Separation and Determination of Ephedrine Pseudoephedrine and Methylephedrine by Capillary Electrophoresis with Electrochemiluminescence Detection

Supporting Information

Protective Effect of Surface Coatings on Concrete

Copper-Catalyzed Oxidative Dehydrogenative N-N Bond. Formation for the Synthesis of N,N -Diarylindazol-3-ones

Potential Dividers. 46 minutes. 46 marks. Page 1 of 11

ΓΕΩΠΟΝΙΚΟ ΠΑΝΕΠΙΣΤΗΜΙΟ ΑΘΗΝΩΝ

ΤΕΧΝΟΛΟΓΙΚΟ ΠΑΝΕΠΙΣΤΗΜΙΟ ΚΥΠΡΟΥ ΣΧΟΛΗ ΕΠΙΣΤΗΜΩΝ ΥΓΕΙΑΣ

*,* + -+ on Bedrock Bath. Hideyuki O, Shoichi O, Takao O, Kumiko Y, Yoshinao K and Tsuneaki G

Neutralization E#ects of Acidity of Rain by Cover Plants on Slope Land

Investigation on Fast Determination of Trace N2Nitrosamines Assisted by Microwave Radiation

,HLA2B2704,, The Technique of Producing HLA2B2704 Gene Transgenic Mice. Chinese Journal of Biochemistry and Molecular Biology HLA2 B2704 ,1,2 Q33,Q78

ΑΡΙΣΤΟΤΕΛΕΙΟ ΠΑΝΕΠΙΣΤΗΜΙΟ ΘΕΣΣΑΛΟΝΙΚΗΣ ΓΕΩΠΟΝΙΚΗ ΣΧΟΛΗ ΕΡΓΑΣΤΗΡΙΟ ΓΕΝΕΤΙΚΗΣ ΚΑΙ ΒΕΛΤΙΩΣΗΣ ΤΩΝ ΦΥΤΩΝ

ΔΙΕΡΕΥΝΗΣΗ ΤΗΣ ΣΕΞΟΥΑΛΙΚΗΣ ΔΡΑΣΤΗΡΙΟΤΗΤΑΣ ΤΩΝ ΓΥΝΑΙΚΩΝ ΚΑΤΑ ΤΗ ΔΙΑΡΚΕΙΑ ΤΗΣ ΕΓΚΥΜΟΣΥΝΗΣ ΤΕΧΝΟΛΟΓΙΚΟ ΠΑΝΕΠΙΣΤΗΜΙΟ ΚΥΠΡΟΥ ΣΧΟΛΗ ΕΠΙΣΤΗΜΩΝ ΥΓΕΙΑΣ

FENXI HUAXUE Chinese Journal of Analytical Chemistry. Savitzky-Golay. n = SG SG. Savitzky-Golay mmol /L 5700.

Stress Relaxation Test and Constitutive Equation of Saturated Soft Soil

Studies on Synthesis and Biological Activities of 2( 1 H21,2,42 Triazol212yl)2 2Arylthioethyl Substituted Phenyl Ketones

ΠΟΛΥΤΕΧΝΕΙΟ ΚΡΗΤΗΣ ΣΧΟΛΗ ΜΗΧΑΝΙΚΩΝ ΠΕΡΙΒΑΛΛΟΝΤΟΣ

Supporting Information. Asymmetric Binary-acid Catalysis with Chiral. Phosphoric Acid and MgF 2 : Catalytic

High order interpolation function for surface contact problem

ph Maillard MRPs maillard reaction products Maillard ph kDa Maillard Maillard DOI /j. issn

Γεωπονικό Πανεπιςτήμιο Αθηνών Τμήμα Αξιοποίηςησ Φυςικών Πόρων και Γεωργικήσ Μηχανικήσ

Potentiometric Diphtheria Immunosensor Based on a Glassy Carbon Electrode Modified with Colloidal Gold and Anti2Diph

Protease-catalysed Direct Asymmetric Mannich Reaction in Organic Solvent

Supporting Information

[11].,, , 316 6, ,., 15.5%, 9.8%, 2006., IDF,, ,500, 2,830.,, ,200.,,, β, [12]. 90% 2,,,,, [13-15].,, [13,

Aronia. melanocarpa. Επιβλεπονηερ καθηγηηερ:

1-4 certified reference material CRM. DSC HPLC ± 0. 4 % k = 2 P = GBW

Transcript:

2007 5 3 309 313 Molecular Plant Breeding, 2007, Vol.5, No.3, 309 313 Research Report CBF1 1,3 2 1 3 1 1* 1,, 100093; 2,, 1000871; 3,, 010019 *, jinwanmei@sohu.com CBF1 PCR 640 bpcbf1 20 16 2CBF1, CBF1,, Study on CBF1 Gene Transferred from Transgenic Strawberry to Nontransgenic Strawberry Liu Yan 1,3 Hu Yuanlei 2 Dong Jing 1 Tian Zihua 3 Chen Meixiang 1 Jin Wanmei 1* 1 Institute of Forestry and Pomology, Beijing Academy of Agriculture and Forestry Sciences, Beijing, 100093; 2 The College of Life Science, Peking University, Beijing, 1000871; 3 Department of Agriculture of Inner Mongolia Agricultural University, Hohhot, 010019 * Corresponding author, jinwanmei@sohu.com Abstract In order to improve strawberry Toyonoka freezing resistance, transgenic strawberry Honeoye which was studied as father and cultivar Toyonoka which was studied as mother was crossed. Results of molecular analysis by PCR confirmed that foreign gene CBF1 in transgenic strawberry Honeoye could be transferred into cultivar Toyonoka by crossing. Electrolyte leakage tests showed that electrolyte leakage ratio of transferred CBF1 gene plants was lower than control s at every low temperature. Comparaed with cultivar Toyonoka whose electrolyte leakage ratio rised obviously at 16, electrolyte leakage ratio of transferred CBF1 gene plants rised obviously at 20, and the intercellular icing temperature of transferred CBF1 gene plants is 2 lower than control s. The study showed that the expression of CBF1 gene of crossed plant increased the freezing tolerance of transgenic strawberry. Keywords Strawberry (Fragaria ananassa Duch.), CBF1gene, Gene transfer, Freezing tolerance (Fragaria ananassa Duch.) 1990 (, 2005a) (2001) (2005b) (5052010)

310 Molecular Plant Breeding (, 2002;, 2002) (, 2000,, 10(12): 1105-1108) (2000,, 45(1): 11-16) CBF1 COR CBF1 (C-repeat binding factor) (, 2007) CBF1 1 1.1 CBF1 83 pbpcbf1 LBA4404 CaMV35S NPT CBF1 1 1.2 CBF1 83 ( ) 83 70% 83 1 pbpcbf1 CaMV35S CBF1 Figure 1 Diagram of binery vector pbpcbf1 with CBF1 gene 1.3 MS ph 5.8 121~126 20 min 55 0 10 mg/l 20 mg/l 30 mg/l 40 mg/l 50 mg/l 1.4 55 10 min 3 d 70% 30 s 5 min 0.1% 10 min 3 5 min 1.5 PCR CTAB DNA DNA (2002) P1 5' GAAACGACATCGAATATTAG 3' P2 5' GTACTCTAGTCAATGAACTC 3' DNA 3 μl buffer 2 μl Mg 2+ 2 μl dntp 1 μl P1 1 μl P2 1 μl Taq 0.5 μl ddh 2 O 9.5 μl 20 μl 20 μl 94 4 min 35 (92 30 s, 55 40 s, 72 40 s) 72 10 min 1.6 1.6.1 (Jaglo-Ottosen et al.,1998) 0.4 cm 2

CBF1 Study on CBF1 Gene Transferred from Transgenic Strawberry to Non- transgenic Strawberry 311 6 3 5 25 ml 0 4 8 12 16 20 30 min 0~4 30 min 20 ml 30 min (DDSJ 308A, 1.000) 10 min 20 ml 30 min =( / ) 100% 2.2 MS+Km 30 mg/l ( 3A) MS+IBA 0.2 mg/l+ba 0.5 mg/l ( 3B) 1.6.2 Joglo-Ottosen (1998) 50 6 3 d (22~25 ) 1.6.3 Data Logger DT500 80 2 2.1 ( 2) 10 mg/l 20 mg/l 26% 44% 30 mg/l 40 mg/l 50 mg/l 79% 80% 96% MS+Km 30 mg/l 3 : A: 30 mg/l ; B: Figure 3 Screening of crossed strawberry generation Note: A: Screening crossed seeds in medium with 30 mg/l Km; B: Transferred plant growth 2.3 PCR CBF1 PCR 4 PCR 640 bp 0 10 mg/l 20 mg/l 30 mg/l 40 mg/l 50 mg/l 2 Figure 2 Effect of Km of different concentration on growth of strawberry 4 PCR : M: DNA marker; 1: ; 2: ; 3, 4: ; 5, 6: Figure 4 PCR analysis of crossed generation plants Note: M: DNA marker; 1: Positive control; 2: Negative control; 3,4: Transferred CBF1 gene plants; 5,6: Non-transferred CBF1 gene plants

312 Molecular Plant Breeding 2.4 2.4.1 ( 5) 20 16 CBF1 6 : A: 6 3 d (22~25 ) ; B: 6 3 d (22~25 ) Figure 6 Detection of cold resistance of transferred strawberry using method of freezing survival of plants Note: A: Non-transferred CBF1 gene plants which were frozen at 6 for 3 days and then returned to a growth chamber at 22~25 for a week; B: Transferred CBF1 gene plants which were frozen at 6 for 3 days and then returned to a growth chamber at 22~25 for a week 5 Figure 5 Detection of cold resistance of transferred strawberry using method of electrical conductibity 2.4.2 6 3 d 57.7% 35.6% 22~25 51.9% 73.2% ( 6) CBF1 2.4.3 7 6.11 7 Figure 7 Detection of cold resistance of transferred strawberry by testing intercellular icing temperature 4.15 2 3 (2004) pecp

CBF1 Study on CBF1 Gene Transferred from Transgenic Strawberry to Non- transgenic Strawberry 313 pecp (2000) Bt (2002) bar (2006) (, 2002) CBF1 Cui H.R., Wang Z.H., Shu Q.Y., Wu D.X., Xia Y.W., and Gao M.W., 2001, Agronomic traits of hybrid progenies between Bt transgenic rice and conventional rice varieties, Zhongguo Shuidao Kexue (Chinese Journal of Rice Science), 15(2): 101-106 (,,,,,, 2001, Bt,, 15(2): 101-106) Jaglo-Ottosen K.R., Gilmour S.J., Zarka Daniel G., Schabenberger O., and Thomashow M.F., 1998, Arabidopsis CBF1 overexpression induces COR genes and enhances freezing tolerance, Science, 280(5360): 104-106 Jiang F.Y., Li Y., and Weng B.Q., 2002, Review on physiology of chilling stress and chilling resistance of plants, Fujian Nongye Xuebao (Fujian Journal of Agricultural Sciences), 17(3): 190-195 (,,, 2002,,, 17(3): 190-195) Jin W.M., Yin S.P., Lu R.Q., Yuan W.F., Dong J., and Wang G.X., 2005a, GO gene transformation of strawberry and its resistance to gray mold, Fenzi Zhiwu Yuzhong (Molecular Plant Breeding), 3(6): 797-800 (,,,,,, 2005a, GO,, 3(6): 797-800) Jin W.M., Pan Q.H., Yin S.P., Dong J., Jiang L.J., Yang L., Chen Q.H., and Zhao J.B., 2005b, Progress of the genetic stability and breeding behavior of foreign gene in genetically modified plants, Fenzi Zhiwu Yuzhong (Molecular Plant Breeding), 3(6): 864-868 (,,,,,,,, 2005b,,, 3(6): 864-868) Jin W.M., Dong J., Yin S.P., Yan A.L., and Chen M.X., 2007, CBF1 gene transgenic strawberry and increase freezing tolerance, Xibei Zhiwu Xuebao (Acta Botanica Borealloccidentalla Sinica), 27(2): 223-227 (,,,,, 2007, CBF1,, 27(2): 223-227) Meng Q.R., Yang J.M., and Fan Y.L., 2002, Research progress in cold hardiness of orchard trees, Hebei Nongye Daxue Xuebao (Journal of Agricultural University of HeBei), 25(8): 87-91 (,,, 2002,,, 25(8): 87-91) Wang C.L., Zhao L., Zong S.Q., Lv C.G., Zou J.S., He X.L., and Zhu W.M., 2002, Transfer of herbicide resistant gene bar into new rice variety by backcrossing, Zuowu Xuebao (Acta Agronomic Sinica), 28(3): 305-309 (,,,,,,, 2002, bar,, 28(3): 305-309) Wang D.Z., Wang S.H., Wu S., Li C.Q., Jiao D.M., Luo Y.C., Wang X.F., and Du S.Y., 2004, Inheritance and expression of the maize pepc gene in progenies of transgenic rice bred by crossing, Yichuan Xuebao (Acta Genetica Sinica), 31(2): 195-201 (,,,,,,,, 2004, pepc,, 31(2): 195-201) Wang G.L., and Fang H.J., 2002, Plant gene engineering, Science Press, Beijing, China, pp.738-745 (,, 2002,,,,, pp.738-745) Wang Z.H., Cui H.R., Shu Q.Y., Ye G.Y., Wu D.X., Gao M.W., and Xia Y.W., 2000, The inheritance and expression of transgenes in the progenies of Bt rice crossed to conventional rice varieties and its breeding utilization, Nongye Shengwu Jishu Xuebao (Journal of Agricultural Biotechnology), 8(1): 89-94 (,,,,,,, 2000, Bt,, 8(1): 89-94) Yi Z.L., Wang Z.X., Tan J.P., Jiang J.X., Tan Y.N., and Zhou Q.M., 2006, Transfer of lysozyme gene into Indica parents of hybrid rice by backcrossing, Zhongguo Shuidao Kexue (Chinese Journal of Rice Science), 20(2): 147-152 (,,,,,, 2006,,, 20(2): 147-152)