Erwin Sablon (34. 2 % 10 %,

2004 6 24 6 Chin J Microbiol Immunol, June 2004, Vol 24, No. 6 421 C Erwin Sablon ( HBV) (BCP) C 113 HBV, INNO2LiPA BCP T1762ΠA1764 C A1896, HBV S C BCP T1762ΠA1764 B, (34. 2 % 10 %, 2 = 6. 74, P < 0. 01), C A1896 B C (2. 5 % 4. 1 %, 2 = 0. 00, P > 0. 05) B,C BCP T1762ΠA1764 ; ; C ; ; Relationship between hepatitis B virus basic core promoterπprecore mutations and viral genotypes FANG Ji2lian 3, WEI Lai, LI Ruo2bing, CONG Xu, XU Jun, Erwin Sablon, SUN Yan, WANG Hao, WANG Yu. 3 Institute of Liver Diseases and People s Hospital, Peking University, Beijing 100044, China Corresponding author : WEI Lai, Email : weelai @163. com Abstract Objective To investigate the relationship between hepatitis B virus ( HBV) basic core pro2 moter (BCP)Πprecore (PreC) mutations and viral genotypes. Methods Sera from 113 patients chronically infected with HBV were tested. HBV genotype was determined by S gene sequencing. Double mutation in BCP ( T1762Π A1764) and PreC mutation (A1896) were determined by INNO2LiPA. Results The double2mutation in BCP ( T1762ΠA1764) was significantly more frequent in genotype C patients than that in B patients(34. 2 % vs 10. 0 %, 2 = 6. 74, P < 0. 01). However, there was no significant difference in the distribution of PreC mutant with A1896 between genotype B and C patients(2. 5 % vs 4. 1 %, 2 = 0. 00, P > 0. 05). Conclusion Compared with geno2 type B, the double2mutation in BCP( T1762ΠA1764) was more common in patients with genotype C patients. Key words Hepatitis B virus ; Basic core promoter ; Precore gene ; Mutation ; (HBV) ( chronic asymptomatic HBsAg carrier,asc) (chronic hepatitis B,CHB) (liver cirrhosis,lc) (hepa2 tocellular carcinoma,hcc) 1, ( basic core promoter, BCP) T1762ΠA1764 C A1896, BCP T1762ΠA1764 C A1896, HBV BCP T1762Π A1764 C A1896 :973 ( G1999054106) :,(,,,,,,, ) ; Hepatitis Diagnostics Pro2 gram, Innogenetic N. V., Belgium( Erwin Sablon) :,100044,,Email :weelai @163. com, :6831442225730 :113 HBV (60 ) (53 ), 88, 25, 1167, AsC 36,CHB 54,LC 14, HCC 9, 2000 2 270 Ortho HBsAg 2 HBs HBeAg2HBe 2HBc HBV DNA : 50 l 310 l [ 1mgΠml K( Merck ), 1gΠml poly (A), 2gΠL SDS, 10mmolΠL EDTA, 50mmolΠL Tris2HCl (ph8. 0),200mmolΠL NaCl ] S PCR : ( nt245 264 ) 5 2 AGTCTAGACTCGTGGTGGAC23, ( nt668 687) 5 2T( GΠT) GCACTAGTAAACTGAGCC23 ; 转载

422 2004 6 24 6 Chin J Microbiol Immunol, June 2004, Vol 24, No. 6 :94 30 s,55 30 s,72 45 s,35, 72 7 min ; 443bp PCR C : INNO2LiPA HBV PreCore Amplication ( Innogenetics Sablon ), :94 30 s,50 30 s,72 30 s,40, 72 10 min ; PCR 326bp, PCR 239bp BCP T1762ΠA1764 C A1896 :INNO2LiPA HBV PreCore ( Innogenetics Sablon ) HBV : Roche PCR S PCR, S PCR,PE 3700 S 3 : SPSS11. 5 2 11 B C BCP T1762ΠA1764 C A1896 :113 HBV,B 40 (35. 4 %) C 73 (64. 6 %),,C BCP T1762ΠA1764 B, ( 34. 2 % 10. 0 %, 2 = 6. 74, P < 0. 01) ;,B BCP A1762Π G1764 C, (47. 5 % 8. 2 %, 2 = 23. 14, P < 0. 001) ; B C BCP (40. 0 % 47. 9 %, 2 = 0. 66, P > 0. 05), 11,B C C A1896,B C C ;C B,C A1896 ( 52. 5 % 56. 2 % 2. 5 % 4. 1 % 45. 0 % 39. 7 %, P > 0. 05), 12 1 B C BCP T1762ΠA1764 Fig 1. Comparison of BCP T1762ΠA1764 mutation rate in infected persons with B and C genotype 2 BC C A1896 Fig 2. Comparison of A1896 mutation rate in pre C region for infected persons with B and C genotype 21 HBeAg 2HBe B C BCP T1762ΠA1764 C A1896 :2,HBeAg,C BCP T1762ΠA1764 B,(11. 4 % 8. 0 %, 2 = 0. 00, P > 0. 05) ;C BCP B, (54. 3 % 20 %, 2 = 7. 14, P < 0. 01) ; C BCP B, (14. 3 % 68 %, 2 = 18. 12, P < 0. 001) 2HBe,C BCP T1762ΠA1764 B, (55. 6 % 11. 1 %, P < 0. 05) ;C B 1 B C T1762ΠA1764 A1896 Table 1. The distribution of T1762ΠA1764 and A1896 gene mutation in infected persons with B and C genotype Basic core promoter nt1762πnt1764 Pre C region nt1896 B 19(47. 5 %) 4 (10. 0 %) 16(40. 0 %) 1(2. 5 %) 21(52. 5 %) 1(2. 5 %) 18(45. 0 %) C 6(8. 2 %) 25 (34. 2 %) 35(47. 9 %) 7(9. 5 %) 41(56. 2 %) 3(4. 1 %) 29(39. 7 %) 2 value 23. 14 6. 74 0. 66 1. 04 0. 14 0. 00 0. 30 P value < 0. 001 < 0. 01 > 0. 05 > 0. 05 > 0. 05 > 0. 05 > 0. 05 WT: wild strains ; MT: mutation strains ; WT + MT: mixed infection of wild strains and mutation strains ; Others : mixed infection of BCP AΠT1764 muta2 tion strains and wild strains

2004 6 24 6 Chin J Microbiol Immunol, June 2004, Vol 24, No. 6 423 BCP (0 % 11. 1 %44. 4 % 77. 8 %, P > 0. 05),2HBe BCP T1762ΠA1764 HBeAg ( 44. 4 % 10 %, 2 = 15. 11, P < 0. 001),C 2HBe BCP T1762ΠA1764 HBeAg (55. 6 % 11. 4 %, 2 = 11. 97, P = 0. 001) 3,HBeAg,B C C, C A1896 ;B C, C (76 % 88. 6 %24 % 11. 4 %, P > 0. 05) 2 HBe,B C C ( 50 %) ;B C,C ( 11. 1 % 29. 6 % 11. 1 % 7. 4 % 77. 8 % 63 %, P > 0. 05) B C, 2HBe C HBeAg (B : 77. 8 % 24 %, P < 0. 05 ; C :63 % 11. 4 %, 2 = 15. 85, P < 0. 001) 31 B C : 4,113 HBV,B C, HBeAg 2 HBeAg 2HBe B C BCP T1762ΠA1764 Table 2. Distribution of BCP T1762ΠA1764 mutation for infected persons with B and C genotype in HBeAg positive group and anti2hbe positive group HBeAg positive group ( n = 60) Anti2HBe positive group ( n = 36) B 17(68. 0 %) 2 (8. 0 %) 5 (20. 0 %) 1 (4. 0 %) 1(11. 1 %) 1 (11. 1 %) 7(77. 8 %) 0 C 5 (14. 3 %) 4 (11. 4 %) 19 (54. 3 %) 7 (20. 0 %) 0 15 (55. 6 %) 12(44. 4 %) 0 2 value 18. 12 0. 00 7. 14 2. 00 P value < 0. 001 > 0. 05 < 0. 01 > 0. 05 > 0. 05 < 0. 05 > 0. 05 WT: wild strains ; MT: mutation strains ; WT + MT: mixed infection of wild strains and mutation strains ; Others : mixed infection of AΠT1764 mutation strains and wild strains 3 HBeAg 2HBe B C A1896 Table 3. Distribution of A1896 mutation for infected persons with B and C genotype in HBeAg positive group and anti2hbe positive group HBeAg positive group ( n = 60) Anti2HBe positive group ( n = 36) B 19(76. 0 %) 0 6(24. 0 %) 1 (11. 1 %) 1(11. 1 %) 7 (77. 8 %) C 31(88. 6 %) 0 4(11. 4 %) 8 (29. 6 %) 2(7. 4 %) 17 (63. 0 %) 2 value 0. 88 0. 88 P value > 0. 05 > 0. 05 > 0. 05 > 0. 05 > 0. 05 WT: wild strains ; MT: mutation strains ; WT + MT: mixed infection of wild strains and mutation strains 2HBe ALT AsC CHB B C, HBeAg 2HBe ALT CHB, C 2HBe B, (30. 3 % 9. 5 %, 2 = 2. 12, P > 0. 05),HBV BCP T1762ΠA1764 C A1896,, B C, C BCP T1762ΠA1764 427,HBeAgΠ2HBe 4,627, A C A1896, C A1896 5,7 ; A HBV C1858,C G1896 (C2G),,A A1896 ; HBV T1858,C A1896 ( T2A), C A1896 8 B C C A1896, 5,7 ;

424 2004 6 24 6 Chin J Microbiol Immunol, June 2004, Vol 24, No. 6 4 113 B C Group AsC CHB Total Table 4. The clinical data of the 113 infected persons with B and C genotype B genotype ( n = 40) Age MΠF HBeAg + HBeAb + ALT(UΠL) C genotype ( n = 73) Age MΠW HBeAg + HBeAb + ALT(UΠL) 27 11 11Π6 58. 8 % 35. 3 % 30. 6 6. 7 30 12 9Π10 63. 2 % 31. 6 % 29. 3 10. 5 31 11 17Π4 71. 4 % 9. 5 % 109. 4 97. 4 27 10 29Π4 60. 6 % 30. 3 % 119. 7 103. 9 30 12 30Π10 62. 5 % 22. 5 % 72. 7 80. 1 34 14 58Π15 47. 9 % 36. 7 % 83. 5 83. 0 AsC: chronic asymptomatic HBsAg carrier ; CHB : chronic hepatitis B ; Total : 113 HBV infected persons ; MΠF : maleπfemale 6,9 C A1896 B BCP T1762ΠA1764,C BCP T1762Π A1764 B (34. 2 % A1764 HBeAg ; C 10 %, P < 0. 01), B,C A1896 2HBe, BCP T1762ΠA1764, HBeAg C 427 HBeAg,B,BCP T1762ΠA1764 C C BCP T1762ΠA1764 A1896 HBeAg Π2HBe ; 2HBe,C BCP T1762ΠA1764 HBeAg BCP T1762ΠA1764 B C A1896 HBeAg, ; BCP T1762ΠA1764 C HBeAg,, HBV BCP 4,627, T1762ΠA1764 C A1896 B C,B C, C BCP T1762Π BCP (40 % A1764 BCP C ), Orito 7,Orito A1896, B C BCP,, (10 % ) BCP T1762ΠA1764, ( INNO2LiPA,Orito, HBV RFLP2PCR ), BCP : HBV,B C, C, A1896 C, A B ; 2HBe,B HBV C C A1896 113 HBV C,,C BCP, C A1896 B C T1762ΠA1764 B 113, Orito 7, B C, HBV,, B C HBV ALT HBeAgΠ2HBe ; AsC CHB B C,, ALT HBeAgΠ 2HBe,B,C,2HBe BCP T1762Π 10 1 Chen DS. From hepatitis to hepatoma : lessons from type B viral hepati2 tis. Science, 1993, 262 : 3692370. 2.., 2000, 8 : 3242329. 3,,,.., 2003, 11 : 11213.

2004 6 24 6 Chin J Microbiol Immunol, June 2004, Vol 24, No. 6 425 4 Sakugawa H, Nakasone H, Nakayoshi T, et al. Preponderance of hepati2 tis B virus genotype B contributes to a better prognosis of chronic HBV in2 fection in Okinawa, Japan J Med Virol, 2002, 67 : 4842489. 5 Kidd2Ljunggren K, Oberg M, Kidd AH, et al. Hepatitis B virus X gene 1751 to 1764 mutation : implications for HBeAg status and disease. J Gen Virol, 1997, 78 : 146921478. 6 Sumi H, Yokosuka O, Seki N, et al. Influence of hepatitis B virus geno2 types on the progression of chronic type B liver disease. Hepatology, 2003, 37 : 19226. 7 Orito E, Mizokami M, Sakugawa H, et al. A case2control study for clini2 cal and molecular biological differences between hepatitis B viruses of genotypes B and C. Japan HBV Research Group. Hepatology, 2001, 33 : 2182223. 8 Lindh M, Andersson AS, Gusdal A. s, nt1858 variants, and geographic origin of hepatitis B virus large2scale analysis using a new genotyping metheod. J Infect Dis, 1997, 175 : 128521293. 9 Yuen MF, Sablon E, Yuan HJ, et al. Significance of hepatitis B geno2 type in acute exacerbation, HBeAg seroconversion, cirrhosis2related com2 plications, and hepatocellular carcinoma. Hepatology, 2003, 37 : 5622 567. 10 Buckwold VE, Xu Z, Chen M, et al. Effects of a naturally occurring mutation in the hepatitis B virus basal core promoter on precore gene ex2 pression and viral replication. J Virol, 1996, 70 : 584525851. ( :2004201216) 2 (Borna disease virus, BDV) RNA, 9 l,1 0. 51, 1640 C T,nt 1648 A G,nt 1655 C T,nt,, min,95 3 min :,58 BDV 2( GBS) GBS 15, 10,5, 37. 2 15 112 RT2PCR 1 l, 1 l :93, 1,1, 2 min,93 45 s,55 1 min,10 ;, BDV p24 86bp 93 30 s,55 45 s,30, GBS 1 PCR 10 5 10 4 10 3 10 2 / l BDV :P1 :5 2TGACCCAACCAGTAGACCA23 P2 :5 2GTCCCATTCATCCGTTGTC23, 2 PCR 501 PE7700 PCR (, :P1 :5 2CCCTCCAAGTGGAAACCAT23 Perkin Elmer ) PCR, 2 P2 :5 2CAGTATCTTGATGTTCTCGCCA23 :5 2FAM2TCAGCGGTGCGACCACTCCGA PCR BDV TAGC2TAMRA23 PCR Bode 92 pmd182 4 BDV p40 10ml, T Vector (), BDV (PBMCs) ; TriPure RNA, 2 GBS PBMCs (Roche ) RNA PCR, BDV p24, 4 BDV, : (No :39870252) DNA,,BDV :400016 GBS 1 GBS PBMCs, GBS :, Email : xiepeng58 @163. BDV p24, BDV,BDV GBS 1. 02 10 3 Π l, net, :023268485490, RNA 93 %, 6 (nt MMLV 20U, 11 l, 37 60 10 l, 1 1 l,10mmolπl dntp 1 l, 25mmolΠL MgCl 2 3U,50 l,1 PCR, :94 2 min,94 1 min,55 1 min,72 1 min,40 ;72 7 1 51,10mmolΠL dntp 1 l, Taq 3U,25mmolΠL MgCl 2 10 l,1 Genbank BDV (C6BV) 1658 T C,nt 1667 A G,nt 1670 C T),,3, 10 l, Taq,,,, H GBS 12, 3 min 2 PCR 50 l,,pandy ( + + ), 2. 36gΠL,IV +, 2 ( :2004203201)