Activated Notch counteracts Ikaros tumor suppression in mouse and human T cell acute lymphoblastic leukemia

SUPPLEMENTAL MATERIAL FOR: Activated Notch counteracts Ikaros tumor suppression in mouse and human T cell acute lymphoblastic leukemia Matthew T. Witkowski, Luisa Cimmino, Yifang Hu, Thomas Trimarchi, Hiromi Tagoh, Mark D. McKenzie, Sarah A. Best, Laura Tuohey, Tracy A. Willson, Stephen L. Nutt, Meinrad Busslinger, Iannis Aifantis, Gordon K. Smyth, and Ross A. Dickins SUPPLEMENTAL METHODS Transgenic mice TRE-GFP-shRNA transgenes were detected by PCR using forward primers specific for each shrna (Ikaros.456: 5 -GTATTAATCTCTGAATACCACTGG; Luc.139: 5 - GTATTAATCAGAGACTTCAGGCGG) and a common reverse primer (GAAAGAACAATCAAGGGTCC) yielding a 21 bp product. The Vav-tTA transgene was detected tta specific forward (CCATACTCACTTTTGCCCTTTAG) and reverse (CAGCGCTGAGTGCATATAATGCA) primers, yielding a 221 bp product. Cell culture and western blotting OP9-DL1 stromal feeder cells were cultured in IMDM supplemented with 1% FBS, 1µg/mL streptomycin, 1U/mL penicillin, 1µM L-glutamine and 5µM β-mercaptoethanol and grown at 37 C in 1% CO 2. Wild type fetal liver cells were retrovirally co-infected with LMP-Cherrybased shrna vectors and MSCV-IRES-GFP vectors and cultured on an OP9-DL1 layer in media conditioned with 1ng/µL IL-7 (Peprotech) and 5ng/µL Flt3L for 12 days to induce T differentiation. 2Q T hybridoma cells were cultured similar to OP9-DL1 cells but with DME- KELSO replacing IMDM. Cell lysates were western blotted with anti-ikaros antibody E-2 (sc- 9861) (Santa Cruz Biotechnology, CA), anti-cleaved Notch1 (ICN1) antibody D3B8 (Cell Signaling, Boston, MA), anti-acetyl-histone H3 antibody 6-599 (Millipore, Billerica, MA) and anti-actin antibody I-19 (sc-1616) (Santa Cruz Biotechnology). Leukemia transplantation Primary splenocytes from leukemic mice (predominantly leukemia cells) were transplanted by tail vein injection into immunocompromised Rag1 / recipient mice (2 x 1 6 cells/mouse). Transplant recipients generally developed overt signs of leukemia after approximately 2 weeks. For T-ALL transduction, 5 x 1 6 freshly harvested secondary leukemic spleen cells were spin-

infected at 1,2 rpm at 22 C onto a retrovirus-coated plate for 2 hours. Following centrifugation, cells were incubated in medium for 6 h at 37 C in 1% CO 2 and transplanted by tail vein injection into recipient mice. Doxycycline treatment was commenced upon detection of GFP + tumor cells in peripheral blood. Flow cytometry and blood analysis Mice were monitored for signs of leukemia (loss of activity or weight, breathing difficulty, enlarged lymph nodes, palpable splenomegaly). Single cell suspensions were prepared from bone marrow, thymus, and peripheral blood. Following red blood cell lysis, cells were stained with APC-conjugated anti-b22 (BD55392) or anti-cd8 (ebioscience 17-81-82), or PEconjugated anti-cd4 (BD55373) or anti-mac1 (BD557397). Stained cells were analysed on a fluorescence activated cell sorter (BD FACSCalibur, BD Biosciences, San Jose, CA). To assess viability, cells were stained with AlexaFluor 647-conjugated AnnexinV (Invitrogen A2324) in AnnexinV binding buffer (BD556454). Stained cells were analysed on a fluorescence activated cell sorter (BD LSRII). For OP9-DL1 co-culture, cells were harvested and removed from the stromal layer for antibody staining. Biotinylated antibodies were used for lineage exclusion (Ter119-biotin Ly76, Gr1-biotin CR868C5, Mac1-biotin M1/7, B22-biotin RA36B2; generated in the WEHI Monoclonal Antibody Facility), then stained for CD8-PECy7 (Biolegend 53-6.7), CD4-PE (WEHI GK1.5), CD44-APC (WEHI IM7.81) and CD25-PerCP.Cy5.5 (Biolegend PC621). Stained cells were analysed on a fluorescence activated cell sorter (BD LSRII). RNA-seq profiling of ALL65, ALL11, and ALL211 RNA samples were sequenced on an Illumina HiSeq 2 to produce 1 bp reads, either singleend (ALL65 and ALL11) or paired-end (ALL211). Reads were mapped to the mouse genome (mm1, NCBI build 38.1) by the subread aligner (7). Read counts were obtained for RefSeq Entrez genes using featurecounts (8). To cut down on variation not relevant to the current study, sex-linked genes (those on the Y chromosome plus Xist,), mitochondrial genes and unannotated genes without recognized gene symbols were excluded from the analysis. Remaining genes were filtered as not expressed if they failed to show at least one count per million reads in at least 3 samples. TMM normalization (9) was applied using edger software (1). The individual leukemias (ALL65, ALL11 and ALL211) were analyzed separately by computing predictive log2 fold changes between treated and untreated samples using edger with a prior count of 3. The predictive log folds are shrunk towards zero to avoid instability with small counts in one or more samples. Both technical and biological replicates of ALL11 were averaged for this purpose. Other statistical analyses were conducted using the limma software

package (11). Barcode plots for individual leukemias were ranked by predictive log fold changes and gene set tests used mean-rank enrichment tests (2). For analysis of biological replicates, read counts were transformed to log-counts-per-million and associated precision weights using the voom method (12). Statistical significance was assessed using linear models and empirical Bayes moderated t-statistics (13) controlling the false discovery rate at 5%. The analysis of the ALL11 biological replicates was a simple two group comparison. The combined analysis of all three leukemias was a paired analysis with the individual leukemias as blocks. For the combined analysis, the biological replicates of ALL11 were averaged by summing counts. Barcode plots of combined data were ranked by moderated t statistic (14) and gene set tests used rotation gene set testing (roast) (13, 15). Roast performs a hypothesis test that takes into account the directionality (up or down) and strength (log 2 fold change) of the genes in the set. Mutation analysis RNA-seq reads were searched for SNPs and other mutations using the exactsnp function of the subread package (http://bioinf.wehi.edu.au/exactsnp). The ALL211 PEST domain sequence variant was identified by Sanger sequencing of a PCR product amplified from genomic DNA using forward (5 -CTACACAGCAGCCTCTCCAC) and reverse (5 - TGACCAGGAAAATCAAGGCTCT) primers. To assess whether the ALL11 Notch1 mutations were in cis or trans, approximately 2.4 kb of the coding region (spanning sequences encoding the HD and PEST domains) was PCR amplified from ALL11 cdna using forward (5 -GATCGGATCCATCAAGCGCTCTACAGTGG) and reverse (5 - GATCGTCGACGCAGAATGGTGTGCACAGGC) primers and cloned into pbluescript (Stratagene) using BamHI/SalI. The HD and PEST regions of several individual clones were sequenced using M13 forward (5 -TGTAAAACGACGGCCAGT) and reverse (5 - CAGGAAACAGCTATGAC) primers flanking the insert. Bio-ChIP-sequencing DP thymocytes (~2 x 1 8 ), which were enriched by CD8 MACS sorting from the thymus of Ikzf1 ihcd2/ihcd2 Rosa26 BirA/BirA mice, were used for chromatin precipitation by streptavidin pulldown (Bio-ChIP), as recently described in detail (16, 17). The precipitated genomic DNA was quantified by real-time PCR, and about 5 ng of precipitated DNA was used as starting material for generating single-end sequencing libraries selected for DNA fragments of 2 35 bp as described by Illumina s ChIP Sequencing sample preparation protocol. Sequencing was carried out using the Illumina/Solexa Genome Analyzer (GA) II systems according to manufacturer s guidelines. Sequence reads of 36 bp that passed the Illumina quality filtering were aligned against the mouse genome assembly version of July 27 (NCBI37/mm9) using the

Bowtie program version 12.5, allowing up to two mismatches and ignoring any read that would map more than once in the genome. Peaks were called by the MACS program (version 1.3.6.1) and filtered for P values of < 1-1, as previously described (18). The peak-to-gene assignment was based on the RefSeq database, which was downloaded from UCSC on April 29th, 21. Peaks were assigned to genes in a stepwise manner by prioritizing genes containing peaks in their promoter and/or gene body, as described (18). This procedure essentially assigned peaks to a gene if they were located in a region spanning from 5 kb upstream of the TSS to 5 kb downstream of the TES of a given gene. Primary human primary samples Primary T-ALL samples were provided by the Childrens Oncology Group with informed consent and analyzed under the supervision of the New York University Langone Medical Center Institutional Review Board. Total RNA was extracted from samples using the RNeasy Plus mini kit (Life Technologies, Carlsbad, CA). Samples were subject to rrna removal using the Ribo- Zero kit (Epicentre, Madison, WI) according to manufacturer instructions. The resulting RNA samples were then used as input for library construction using the dutp method as described (19). RNA libraries were sequenced on Illumina HiSeq 2 and 25 machines to produce 5bp paired-end reads. Reads were aligned to the human hg19 genome using TopHat (2) v1.4 with default parameters. FPKM (fragments per kilobase per million reads) expression values were generated by Cufflinks (21) v1.3 using RefSeq gene annotation. Genes with reduced expression in T-ALL relative to thymocytes were ranked by Students s t test P value following removal of genes that had zero FKPM values in at least one sample. SUPPLEMENTAL REFERENCES 1. Weng AP, Millholland JM, Yashiro-Ohtani Y, Arcangeli ML, Lau A, Wai C, et al. c-myc is an important direct target of Notch1 in T-cell acute lymphoblastic leukemia/lymphoma. Genes & Development 26 Aug 1; 2(15): 296-219. 2. Michaud J, Simpson KM, Escher R, Buchet-Poyau K, Beissbarth T, Carmichael C, et al. Integrative analysis of RUNX1 downstream pathways and target genes. BMC Genomics 28; 9: 363. 3. Zeller KI, Zhao X, Lee CWH, Chiu KP, Yao F, Yustein JT, et al. Global mapping of c-myc binding sites and target gene networks in human B cells. Proc Natl Acad Sci USA 26 Nov 21; 13(47): 17834-17839. 4. Mingueneau M, Kreslavsky T, Gray D, Heng T, Cruse R, Ericson J, et al. The transcriptional landscape of alphabeta T cell differentiation. Nat Immunol 213 Jun; 14(6): 619-632. 5. Herranz D, Ambesi-Impiombato A, Palomero T, Schnell SA, Belver L, Wendorff AA, et al. A NOTCH1-driven MYC enhancer promotes T cell development, transformation and acute lymphoblastic leukemia. Nat Med 214 Oct; 2(1): 113-1137.

6. Yashiro-Ohtani Y, Wang H, Zang C, Arnett KL, Bailis W, Ho Y, et al. Long-range enhancer activity determines Myc sensitivity to Notch inhibitors in T cell leukemia. Proc Natl Acad Sci U S A 214 Nov 18; 111(46): E4946-4953. 7. Liao Y, Smyth GK, Shi W. The Subread aligner: fast, accurate and scalable read mapping by seed-and-vote. Nucleic Acids Res 213 May 1; 41(1): e18. 8. Liao Y, Smyth GK, Shi W. featurecounts: an efficient general-purpose program for assigning sequence reads to genomic features. Bioinformatics 213 Nov 13. 9. Robinson MD, Oshlack A. A scaling normalization method for differential expression analysis of RNA-seq data. Genome Biol 21 Jan 1; 11(3): R25. 1. Robinson MD, McCarthy DJ, Smyth GK. edger: a Bioconductor package for differential expression analysis of digital gene expression data. Bioinformatics 21 Jan 1; 26(1): 139-14. 11. Ritchie ME, Phipson B, Wu D, Hu Y, Law CW, Shi W, et al. limma powers differential expression analyses for RNA-sequencing and microarray studies. Nucleic Acids Research 215; 43: in press. 12. Law CW, Chen Y, Shi W, Smyth GK. Voom: precision weights unlock linear model analysis tools for RNA-seq read counts. Genome Biol 214; 15(2): R29. 13. Smyth GK. Linear models and empirical bayes methods for assessing differential expression in microarray experiments. Statistical Applications in Genetics and Molecular Biology 24 Jan 1; 3: Article3. 14. Lim E, Vaillant F, Wu D, Forrest NC, Pal B, Hart AH, et al. Aberrant luminal progenitors as the candidate target population for basal tumor development in BRCA1 mutation carriers. Nature Medicine 29 Aug 1; 15(8): 97-913. 15. Wu D, Lim E, Vaillant F, Asselin-Labat M-L, Visvader JE, Smyth GK. ROAST: rotation gene set tests for complex microarray experiments. Bioinformatics 21 Sep 1; 26(17): 2176-2182. 16. Ebert A, McManus S, Tagoh H, Medvedovic J, Salvagiotto G, Novatchkova M, et al. The distal V(H) gene cluster of the Igh locus contains distinct regulatory elements with Pax5 transcription factor-dependent activity in pro-b cells. Immunity 211 Feb 25; 34(2): 175-187. 17. Schwickert TA, Tagoh H, Gultekin S, Dakic A, Axelsson E, Minnich M, et al. Stagespecific control of early B cell development by the transcription factor Ikaros. Nat Immunol 214; 15(3): 283-293. 18. Revilla-I-Domingo R, Bilic I, Vilagos B, Tagoh H, Ebert A, Tamir IM, et al. The B-cell identity factor Pax5 regulates distinct transcriptional programmes in early and late B lymphopoiesis. EMBO J 212; 31(14): 313-3146. 19. Parkhomchuk D, Borodina T, Amstislavskiy V, Banaru M, Hallen L, Krobitsch S, et al. Transcriptome analysis by strand-specific sequencing of complementary DNA. Nucleic Acids Res 29 Oct; 37(18): e123. 2. Trapnell C, Pachter L, Salzberg SL. TopHat: discovering splice junctions with RNA-Seq. Bioinformatics 29 May 1; 25(9): 115-1111. 21. Trapnell C, Williams BA, Pertea G, Mortazavi A, Kwan G, van Baren MJ, et al. Transcript assembly and quantification by RNA-Seq reveals unannotated transcripts and isoform switching during cell differentiation. Nat Biotechnol 21 May; 28(5): 511-515.

Figure S1 A ATG STOP Ikaros.279 Ikaros.456 mrna isoform Ik1 Exon 123 4 5 67 8 CDS B 1 C survival (%) D 8 6 4 Ren.713 (n=1) 2 Ikaros.279 (n=6) Ikaros.456 (n=7) 5 1 15 age (days) 4 2 spleen 5 1 2.5 77.9 thymus Ren.713 Ikaros.456 cell count 3 2 82.9 CD4 1 4 1 3 1 1 2 1 3 1 4 1 5 GFP 1 2 16 1 2 1 3 1 4 1 5 CD8

Figure S2 A X Vav-tTA B Vav-tTA; TRE-GFPshIkaros leukemia transplant 3 mice untreated 3 mice Dox 3d FACS sort GFP+ leukemia cells VAV-tTA; TRE-GFP-shIkaros untreated + Dox shrna on: Ikaros knockdown shrna off: Ikaros restoration

Ikzf1 Fignl1 untreated 3 days Dox B A Figure S3 1 1 1 2 1 3 2 4 6 8 1 GFP Freq untreated d3 Dox C 2 2 4 6 8 1 12 6 4 2 2 4 ALL11: RNA Seq Average log expression log fold change Ikzf1 398 genes 2943 genes 2-6 log2 fold change -4-2 4-2 2 4 6 8 1 12 average expression (log2 counts per million) ALL11: RNA-Seq

Figure S4 A 4.7 Enrichment ALL65 RNA-Seq Weng Notch withdrawal genes Mean-rank gene set test Red bars: genes increased upon Notch withdrawal B 4.5 Enrichment ALL11 RNA-Seq Weng Notch withdrawal genes Mean-rank gene set test Red bars: genes increased upon Notch withdrawal P<1-5 P<1-4 increased upon Ikaros restoration decreased upon Ikaros restoration increased upon Ikaros restoration decreased upon Ikaros restoration P<1-5 P<1-8 Enrichment Enrichment 2.5 Blue bars: genes decreased upon Notch withdrawal 3 Blue bars: genes decreased upon Notch withdrawal C 3.6 Enrichment ALL211 RNA-Seq Weng Notch withdrawal genes Mean-rank gene set test Red bars: genes increased upon Notch withdrawal P<1-6 increased upon Ikaros restoration decreased upon Ikaros restoration P<1-11 Enrichment 4.1 Blue bars: genes decreased upon Notch withdrawal

Figure S5 A Transplant ut Disease onset Dox d3 d7 Dox Harvest recipients -7d -3d ut C Percent survival 1 5 ALL211 untreated negative shikaros Dox ICN1 ALL65 ALL11 ALL211 D Percent survival 1 1 2 3 5 Days post dox ALL11 untreated negative shikaros ICN1 Dox 1 2 3 B Percent survival 1 5 ALL65 untreated negative shikaros ICN1 Dox E 5 kda ALL65 d Days post dox d3 ALL11 d d3 Ik1 Ik2 1 2 3 Days post dox 37 kda Actin

Figure S6 A 5 kda 37 kda relapse d29 Dox d d3 #1 #2 Ik1 * Ik2 * B ALL65 Relative expression to HPRT 1..8.6.4.2. Ikaros Exons 3-4 Ikaros Exons 7-8 Hes1 Relative expression to HPRT 1.5 1..5. d d3 Relapse d d3 Relapse Relative expression to Gapdh.15.1.5. d d3 Relapse 37 kda Actin ALL211 Relative expression to HPRT.8.6.4.2. d d3 Relapse Relative expression to HPRT 1.5 1..5. d d3 Relapse Relative expression to Gapdh.8.6.4.2. d d3 Relapse ALL11 Relative expression to HPRT 1..8.6.4.2. d d3 Relapse Relative expression to HPRT 1.5 1..5. d d3 Relapse Relative expression to Gapdh.15.1.5. d d3 Relapse

Notch1 chr2: (Notch1 Figure S7 A Notch1 chr2:2648278 (Notch1 Exon 26) Notch1 chr2:26459973 Notch1 Exon 34) 53 64 ALL211 ALL211 69 93 ALL65 (P41S) ALL65 (N2385T) 41 534 ALL11 ALL11 Sequence Sequence B Notch1 chr2:2646661 (Notch1 Exon 27) Notch1 Notch1 chr2:26459934 (Notch1 Exon 34) Notch1 42 64 ALL211 ALL211 66 83 ALL65 ALL65 247 ALL11 (L1668P) ALL11 (S2398X) Sequence Sequence Notch1 Notch1 C Notch1 chr2:26466487 (Notch1 Exon 27) D ALL211 genomic DNA Notch1 Sanger Sequencing 46 PEST DOMAIN ALL11 (wildtype) ALL211 (Y176S) 65 P S S M V C G C A ALL211 (S2446fsX1) ALL65 276 E HD DOMAIN P S S X ALL11 cdna Notch1 Sanger Sequencing M V PEST DOMAIN ALL11 Sequence Exon 27 L1668P 68P (HD domain) Clone #1 wildtype Clone #2 c.52t>c (L1668P) Clone #1 c.7192c>a (S2398X) V Y L E I L Clone #2 wildtype V Y P E I L V S X A A L V S S A A L Notch1

Figure S8 A Combined T-ALL Zeller Myc-regulated genes: NEGATIVE correlation (P=.547) C Reads 1 2.5 Enrichment increased upon Ikaros restoration in leukemia Red bars: genes induced directly by Myc decreased upon Ikaros restoration in leukemia D Reads 1 Myc 5 kb Enrichment 2.6 Blue bars: genes repressed directly by Myc Myc Pvt1 1 kb N-Me B 3.3 Combined T-ALL Myc cluster (Mingueneau) Enrichment (P=.547) Enrichment increased upon Ikaros restoration in leukemia decreased upon Ikaros restoration in leukemia Black bars: genes where expression correlates with Myc expression throught thymocyte development

Figure S9 CUTLL1 HPB-ALL 24 48 24 48 GSI (hours) IKZF1 -ACTIN

SUPPLEMENTAL FIGURE LEGENDS Figure S1. (A) Schematic of murine Ikzf1/Ikaros full-length Ik1 isoform, showing sites targeted by the Ikaros.279 and Ikaros.456 shrnas. (B) Kaplan-Meier survival curves of recipient mice reconstituted with fetal liver hematopoietic stem progenitor cells infected with LMP vectors expressing Ikaros shrnas or Ren.713 as indicated. (C) Enlarged thymus and spleen of a representative leukemic Ikaros.456 mouse compared with a healthy Ren.713 control. (D) Representative flow cytometry of splenocytes isolated from a leukemic Ikaros.456 mouse showing accumulation of GFP + CD4 + CD8 + cells. Figure S2. (A) Mating strategy to generate a mouse model of inducible Ikaros restoration in T- ALL. (B) Strategy for tet-regulated Ikaros restoration in T-ALL in vivo. Figure S3. (A) Histogram of GFP expression in cell suspensions from spleens of leukemic recipient mice following transplant with Vav-tTA;TRE-GFP-shIkaros leukemia ALL11. Mouse treatments and gates for sorting of GFP + leukemia cells by FACS are indicated. (B) Scatter plot of RNA-seq differential expression upon Ikaros restoration in ALL11 (comparing 3 days Dox with untreated, averaged from 3 mice per condition). Genes with significant expression changes (FDR<.5) are highlighted, and Ikaros is indicated. (C) ALL11 RNA-seq tracks for Ikzf1/Ikaros and neighbouring control gene Fignl1 for triplicate untreated and Dox treated mice. Figure S4. Gene set analysis barcode plots of RNA-seq differential gene expression upon Ikaros restoration in ALL65 (upper), ALL11 (middle), and ALL211 (lower), with genes horizontally ranked by predictive log2 fold changes. Genes upregulated upon Ikaros restoration are shaded pink (logfc > 1.2) and downregulated genes are shaded blue (logfc < 1.2). As for Figure 2E, overlaid are a previously described set of genes induced (red bars) or repressed (blue bars) upon Notch inhibition in a murine T-ALL cell line (1). Red and blue traces above and below the barcode represent relative enrichment. P values for induced and repressed gene sets (indicating significant positive correlation with genes upregulated or downregulated upon Ikaros restoration respectively) are calculated separately using a mean-rank gene set test (2). Figure S5. (A) Spleens isolated from representative leukemic recipient mice showing regression of ALL65 and ALL211 following 7 days of Dox treatment, but progression of ALL11. Note that the spleen from the ALL11 day 3 Dox treated mouse is unusually small and likely reflects a lower leukemia burden at the start of Dox treatment for this particular mouse. (B-D) Kaplan- Meier survival curves for leukemic recipient mice bearing ALL65 (B), ALL211 (C), and ALL11 (D). Following disease establishment mice were either left untreated (black) or Dox treated. Negative (blue) indicates recipients of T-ALL cells that were either uninfected or

transduced with a negative control Cherry-expressing retroviral vector. Dox treatment significantly extended survival of mice bearing ALL65 (median survival for untreated and Doxtreated mice: 4 days vs 15 days respectively, P =.1, log rank test) and ALL211 (1 days vs 25 days, P =.1) but not ALL11 (7 days for both, P =.17). Recipients of T-ALL cells previously transduced with shikaros (red) or ICN1 (green) vectors promoted relapse of ALL65 and ALL211 as described in the text (transduced [shikaros or ICN1] vs negative: P <.5 and P <.1 for ALL65 and ALL211 respectively). (E) Western blot analysis of Ikaros expression in ALL65 and ALL11 cells isolated from representative leukemic mice that were untreated or Dox treated for 3 days. The two panels are cropped from the same blot, indicating similar Ikaros restoration in each leukemia. Figure S6. (A) Western blot analysis of Ikaros isoform expression in ALL65 leukemia cells isolated from independent leukemic mice that were either untreated (d), treated with Dox for 3 days (d3), or upon relapse following Dox treatment. #1 and #2 are leukemias isolated from two different relapsed mice after 29 days Dox. Asterisks indicate Ikaros species in relapsed leukemias not detected in untreated leukemias. Actin is a loading control. (B) Average Ikaros and Hes1 mrna expression detected by RT-qPCR in ALL65, ALL11, and ALL211, comparing mice that were untreated (d), treated with Dox for 3 days (d3), or upon relapse following Dox treatment. Datapoints represent leukemias isolated from independent mice. Hes1 expression in ALL65 is not significantly different in d vs relapse (P =.15, unpaired t test with Welch s correction). Figure S7. (A-C) RNA-seq track comparison of ALL65, ALL11, and ALL211 showing reads mapped to the Notch1 coding region altered by mutation in ALL65 (A), ALL11 (B), and ALL211 (C). Read numbers for each region are indicated on the right. (D) Sanger sequence electropherogram of a PCR product amplified from genomic DNA isolated from ALL211, showing a heterozygous S2446fsX1 frameshift mutation that introduces a premature stop codon in the Notch1 PEST domain. The same region amplified from ALL11 is shown as a wild type control. (E) Representative Sanger sequence electropherogram of a PCR product amplified from ALL11 cdna showing Notch1 mutations in trans with amino acid substititions highlighted in red. Figure S8. (A,B) Gene set analysis barcode plots of differential gene expression upon Ikaros restoration in T-ALL from a combined analysis of ALL65, ALL11, and ALL211. The barcode format is as described for Figure 2E. The Myc-regulated gene set in (A) comprises direct Mycinduced genes (red bars) or direct Myc-repressed genes (blue bars) identified previously in a

human B cell line harboring a tet-regulated Myc construct (3). The Myc cluster gene set in (B) comprises 84 genes with mrna expression closely correlated to Myc recently identified in detailed gene expression profiling of multiple stages of thymic T cell development (4). (C) Ikaros binding at the Myc locus in DP thymocytes. Grey bars below the Bio-ChIP-seq track indicate significant Ikaros-binding (P < 1 1 ). The Y axis indicates the number of mapped sequence reads. (D) Ikaros Bio-ChIP-seq track spanning the Myc locus and the Notch-driven Myc enhancer (N-Me) regulatory element (5, 6) ~1.3 Mb 3 of the Myc gene (arrowed), showing no binding of Ikaros to the N-Me in DP thymocytes. Figure S9. Western blot analysis of IKZF1 expression in the human T-ALL cell lines CUTLL1 and HPB-ALL following treatment with the GSI Compound E (CompE, 5 nm) for 24 and 48 h as indicated. ACTB (beta-actin) is a loading control.

Table S1. Gene expression changes upon acute Ikaros restoration in ALL11 - Top 1 genes RNA-Seq expression analysis of Vav-tTA;TRE-GFP-shIkaros leukemia #11 isolated from transplant recipient mice. 3 days doxycycline (GFPmid) vs. untreated (GFPhigh) INCREASED EXPRESSION Rank Symbol logfc AveLogCPM t PValue FDR 1 Ikzf1 3.29 8.88 55.46 1.91E-11 2.15E-7 2 Cd6 1.65 7.51 22.28 2.3E-8 5.18E-5 3 P2rx7 2.63 6.4 21.21 3.36E-8 5.74E-5 4 Trac 2.7 7.53 21.5 3.57E-8 5.74E-5 5 Dusp2 1.49 6.59 2.1 5.9E-8 5.81E-5 6 Limd2 1.16 8.62 19.82 5.68E-8 5.81E-5 7 Cmtm6 1.92 5.85 19.34 6.86E-8 5.81E-5 8 Shisa5 1.62 7.5 19.18 7.3E-8 5.81E-5 9 Gsn 2.46 5.74 18.63 9.13E-8 5.81E-5 1 Dgka 1.68 7.19 18.6 9.25E-8 5.81E-5 11 Prr13 1.22 5.63 18.27 1.6E-7 5.96E-5 12 Laptm5 1.3 9.33 18.24 1.7E-7 5.96E-5 13 Kcnf1 2.19 6.5 18.16 1.11E-7 5.96E-5 14 Igsf23 1.59 6.23 17.71 1.35E-7 6.51E-5 15 Gpr146 2.49 3.18 17.64 1.39E-7 6.51E-5 16 Jakmip1 1.56 6.1 17.15 1.72E-7 7.75E-5 17 Stk4 1.3 8.88 16.97 1.87E-7 8.9E-5 18 Tigit 4.86 -.33 16.24 2.62E-7 9.1E-5 19 Bzrap1 2.5 4.81 16.19 2.67E-7 9.1E-5 2 Wdr1 1.38 8.11 16.5 2.85E-7 9.1E-5 21 Egr1 2.72 6.42 15.99 2.94E-7 9.1E-5 22 Lrp1 1.14 7.5 15.99 2.94E-7 9.1E-5 23 Pld3 1.4 5.67 15.8 3.21E-7 9.1E-5 24 Rab37 1.87 5.13 15.72 3.35E-7 9.1E-5 25 Arid5a 1.28 5.25 15.71 3.36E-7 9.1E-5 26 Akna.9 7.43 15.68 3.4E-7 9.1E-5 27 Edem1 1.1 9.86 15.63 3.5E-7 9.1E-5 28 Cd27 1.13 7.97 15.52 3.68E-7 9.1E-5 29 Fam15a 1.18 5.34 15.52 3.69E-7 9.1E-5 3 Sp1 1.79 6.7 15.33 4.4E-7 9.1E-5 31 Zfand6 1.17 5.57 15.27 4.16E-7 9.1E-5 32 Cdh24 2.22 4.52 15.16 4.42E-7 9.1E-5 33 Prkcq 1.12 7.6 15.13 4.48E-7 9.1E-5 34 Gem 1.46 4.21 15.11 4.52E-7 9.1E-5 35 Stk11ip 1.14 5.28 15.9 4.57E-7 9.1E-5 36 Itgam 2.16 4.36 15.1 4.74E-7 9.1E-5 37 Plcxd2 1.71 5.3 14.97 4.85E-7 9.1E-5 38 Foxo1 2.5 6.47 14.89 5.6E-7 9.34E-5 39 Gramd1a 1.34 5.96 14.8 5.28E-7 9.6E-5 4 Trav13n-4 2.14 4.68 14.68 5.63E-7 9.81E-5 41 Tor2a 1.22 5.6 14.67 5.66E-7 9.81E-5 42 Pstpip1.99 5.63 14.59 5.9E-7 1.E-4 43 Pdlim2 1.34 5.16 14.57 5.96E-7 1.E-4 44 Nlrc3 1.11 4.81 14.43 6.4E-7 1.6E-4 45 Dennd1c 1.93 4.8 14.39 6.54E-7 1.6E-4 46 Gadd45a 1.87 3.53 14.32 6.8E-7 1.6E-4 47 Arhgap25 1.33 5.39 14.27 6.96E-7 1.6E-4 48 583411N6Rik 2.97 4.23 14.27 6.98E-7 1.6E-4 49 Aff4 1.3 7.25 14.12 7.57E-7 1.11E-4 5 Rbl2 1.24 6.63 13.93 8.39E-7 1.16E-4 51 Trav13-2 2.2 3.26 13.77 9.15E-7 1.23E-4 52 Arid5b 1.97 3.12 13.59 1.1E-6 1.3E-4 53 Abhd8.77 7.15 13.42 1.11E-6 1.34E-4 54 Nedd9 1.51 6.3 13.36 1.15E-6 1.34E-4 55 Srp14.8 6.4 13.34 1.16E-6 1.34E-4 56 Chmp1b 1.23 6.17 13.18 1.27E-6 1.36E-4 57 Zfp821 1.91 3.85 13.17 1.28E-6 1.36E-4 58 Nbeal2.97 7.13 13.16 1.28E-6 1.36E-4 59 Il12rb1 1.44 6.2 13.11 1.33E-6 1.36E-4 6 Rasal3 1.16 7.91 13.1 1.33E-6 1.36E-4 61 Arhgap4.92 7.22 13.7 1.36E-6 1.38E-4 62 Rab19 3.9 2.16 13.4 1.38E-6 1.38E-4 63 Flna.99 9.18 13.2 1.39E-6 1.38E-4 64 Pycard 1.3 6.74 12.88 1.51E-6 1.45E-4 65 Ifngr1 1.12 7.39 12.75 1.63E-6 1.53E-4 66 Extl3 1.5 6. 12.75 1.63E-6 1.53E-4 67 Jak2 1.17 6.86 12.74 1.64E-6 1.53E-4 68 Cdc42se1.95 7.53 12.63 1.75E-6 1.59E-4 69 Ehd3 1.61 5.8 12.63 1.75E-6 1.59E-4

7 Plgrkt 1. 5.61 12.62 1.76E-6 1.59E-4 71 Hmha1.85 8.88 12.61 1.77E-6 1.59E-4 72 Coro1a.78 1.5 12.56 1.83E-6 1.6E-4 73 Evi2b 1.29 4.99 12.55 1.84E-6 1.6E-4 74 Cd5 1.5 7.22 12.5 1.89E-6 1.6E-4 75 Cd37 1.61 5.75 12.5 1.9E-6 1.6E-4 76 Zbp1 2.53 4.7 12.49 1.9E-6 1.6E-4 77 Rec8 1.65 3.87 12.49 1.9E-6 1.6E-4 78 Fgd3 1.26 4.89 12.48 1.91E-6 1.6E-4 79 Trpv6 2.4 2.37 12.4 2.1E-6 1.64E-4 8 Cdyl2 2.3 4.88 12.32 2.11E-6 1.64E-4 81 Fmnl1.71 8.26 12.31 2.13E-6 1.64E-4 82 Nr4a1 2.32 5.96 12.3 2.14E-6 1.64E-4 83 Trav13n-3 2.41 1.71 12.26 2.19E-6 1.64E-4 84 Trbv5 1.11 7.13 12.25 2.21E-6 1.64E-4 85 Cd8a 2.2 9.78 12.24 2.21E-6 1.64E-4 86 Lcp2 1.13 7.29 12.22 2.24E-6 1.64E-4 87 Xylt2 1.11 4.56 12.16 2.33E-6 1.68E-4 88 Cd52 2.67 4.99 12.13 2.36E-6 1.68E-4 89 Traj42 2.21 4.7 12.12 2.38E-6 1.68E-4 9 P2ry1.82 5.93 12.12 2.38E-6 1.68E-4 91 Celf2 1.21 8.55 12.1 2.42E-6 1.68E-4 92 Gimap1.76 6.7 12.7 2.46E-6 1.7E-4 93 Mtmr12.82 7.14 12.4 2.5E-6 1.72E-4 94 Plekhg2 1.57 6.47 11.98 2.6E-6 1.76E-4 95 Slc36a1 1.35 4.35 11.95 2.64E-6 1.76E-4 96 Ephx1 2.13 3.27 11.92 2.7E-6 1.76E-4 97 A4378G23Rik 1.25 4.18 11.92 2.71E-6 1.76E-4 98 Txnip 1.8 6.82 11.91 2.71E-6 1.76E-4 99 Adamts1.99 4.97 11.91 2.72E-6 1.76E-4 1 Aes.9 8.64 11.89 2.75E-6 1.77E-4 DECREASED EXPRESSION Probe rank Symbol logfc AveExpr t P.Value FDR 1 Il9r -1.98 6.83-29.85 2.39E-9 1.35E-5 2 Tns3-2.32 5.75-23.23 1.67E-8 5.18E-5 3 Maged1-2.63 4.5-22.47 2.16E-8 5.18E-5 4 Mpzl2-3.9 4.42-2.2 4.9E-8 5.81E-5 5 Slfn9-1.67 6.76-19.87 5.56E-8 5.81E-5 6 Tbc1d4-2.47 4.38-19.33 6.89E-8 5.81E-5 7 Dock1-2.52 5.74-18.94 8.5E-8 5.81E-5 8 Elfn2-2.68 4.75-18.59 9.28E-8 5.81E-5 9 Megf8-3.77 2.53-17.82 1.28E-7 6.51E-5 1 Maoa -1.93 4.45-16.82 1.99E-7 8.32E-5 11 Tmed5-1.9 7.45-16.16 2.71E-7 9.1E-5 12 C1qtnf6-1.45 4.8-15.95 3.E-7 9.1E-5 13 Polr1b -1.27 6.6-15.48 3.77E-7 9.1E-5 14 Tmem55a -2.16 4.62-15.44 3.83E-7 9.1E-5 15 Klf3-1.29 5.69-15.34 4.3E-7 9.1E-5 16 Kifap3-1.47 4.41-15.28 4.14E-7 9.1E-5 17 Pdxk -1.26 5.96-15.21 4.29E-7 9.1E-5 18 Eif4ebp1-1.78 4.18-15.15 4.44E-7 9.1E-5 19 Wls -1.79 4.18-15.13 4.47E-7 9.1E-5 2 Matn2-2.9 3.61-15.13 4.48E-7 9.1E-5 21 Slc45a3-2.38 4.28-15.2 4.73E-7 9.1E-5 22 Qsox2-1.3 4.52-14.99 4.81E-7 9.1E-5 23 BC349-3. 1.41-14.98 4.83E-7 9.1E-5 24 Spats2-1.96 6.1-14.7 5.57E-7 9.81E-5 25 Wscd1-1.28 5.21-14.31 6.82E-7 1.6E-4 26 Igfbpl1-3.53 4.14-14.27 6.99E-7 1.6E-4 27 Myo5b -2.49 4.56-14.23 7.11E-7 1.7E-4 28 Myzap -2.48 3.26-14.14 7.47E-7 1.11E-4 29 Qser1-1.13 6.81-14.1 8.1E-7 1.16E-4 3 Pkn3-1.52 4.75-13.97 8.19E-7 1.16E-4 31 2117G12Rik -2.27 3.4-13.95 8.3E-7 1.16E-4 32 Tspan2-2.51 4.53-13.91 8.45E-7 1.16E-4 33 Igf1r -1.97 5.48-13.9 8.52E-7 1.16E-4 34 Hes1-1.8 4.98-13.69 9.55E-7 1.27E-4 35 Irs1-2.89 1.61-13.6 1.E-6 1.3E-4 36 Uaca -4.6 5.96-13.55 1.3E-6 1.3E-4 37 C1qtnf1-2.97 1.59-13.55 1.3E-6 1.3E-4 38 Vgll1-1.32 5.86-13.54 1.3E-6 1.3E-4 39 Rsu1-1.35 5.32-13.51 1.5E-6 1.31E-4 4 Rps6kl1-1.72 3.46-13.4 1.12E-6 1.34E-4 41 Cluh -.91 7.11-13.4 1.12E-6 1.34E-4

42 1736A12Rik -4.65-1.79-13.38 1.14E-6 1.34E-4 43 Tmem176b -2.18 3. -13.35 1.15E-6 1.34E-4 44 Rab34-3.9 2.52-13.26 1.22E-6 1.36E-4 45 Myh1-1.39 7.52-13.25 1.22E-6 1.36E-4 46 Emp1-1.93 3.7-13.23 1.24E-6 1.36E-4 47 Cdv3 -.86 8.58-13.21 1.25E-6 1.36E-4 48 Arhgap5-1.65 4.99-13.14 1.3E-6 1.36E-4 49 Gid4-1.1 6.36-13.13 1.31E-6 1.36E-4 5 Carkd -.97 5.74-13.3 1.39E-6 1.38E-4 51 Kdelc1-1.16 5.18-12.93 1.46E-6 1.44E-4 52 Nadk2 -.94 6.5-12.89 1.5E-6 1.45E-4 53 Klhl23-1.7 4.63-12.74 1.64E-6 1.53E-4 54 Pdgfrb -2.91 5.58-12.69 1.69E-6 1.56E-4 55 Psrc1-1.55 4.18-12.51 1.88E-6 1.6E-4 56 Vash1-1.74 6.7-12.47 1.93E-6 1.6E-4 57 Mtf2 -.82 7.99-12.46 1.94E-6 1.6E-4 58 Mrps25 -.87 5.38-12.41 1.99E-6 1.64E-4 59 Itgb1 -.93 8.16-12.38 2.3E-6 1.64E-4 6 Hivep3-3.14 6.73-12.37 2.4E-6 1.64E-4 61 Epb4.1l5-1.78 3.45-12.36 2.6E-6 1.64E-4 62 Mgat4b -1.59 3.26-12.32 2.11E-6 1.64E-4 63 Acvr1-1.98 2.22-12.31 2.13E-6 1.64E-4 64 Ahctf1 -.67 7.57-12.3 2.14E-6 1.64E-4 65 Frmd4a -1.89 4.66-12.24 2.21E-6 1.64E-4 66 Npr1-2.47 1.81-12.22 2.24E-6 1.64E-4 67 D8331N3Rik -1.5 5.45-12.21 2.25E-6 1.64E-4 68 Tmem132a -1.49 5.21-12.21 2.26E-6 1.64E-4 69 Utp2 -.79 7.39-12.11 2.4E-6 1.68E-4 7 Arhgap21-1.43 4.88-12.11 2.4E-6 1.68E-4 71 Ctnnd1-2.8 5.85-12.3 2.52E-6 1.72E-4 72 Ccdc18-1.64 5.37-11.97 2.62E-6 1.76E-4 73 Nat1 -.79 6.67-11.95 2.65E-6 1.76E-4 74 Bst2-1.63 4.87-11.92 2.7E-6 1.76E-4 75 Rab44-3.82 2.84-11.8 2.91E-6 1.85E-4 76 Fam188b -2.72.74-11.79 2.92E-6 1.85E-4 77 Josd1 -.98 6.35-11.74 3.2E-6 1.88E-4 78 Aldh1b1-2.82 7.39-11.61 3.29E-6 1.93E-4 79 Tfap4-1.4 5.15-11.58 3.35E-6 1.94E-4 8 Anks1 -.82 6.54-11.57 3.38E-6 1.94E-4 81 Zfp53-2.78 2.26-11.53 3.47E-6 1.95E-4 82 Mettl13-1.9 5.36-11.52 3.48E-6 1.95E-4 83 Nt5dc2-1.2 7.31-11.48 3.57E-6 1.96E-4 84 Trip1-1.21 3.46-11.47 3.6E-6 1.96E-4 85 Dpy19l1 -.96 6.3-11.41 3.73E-6 2.1E-4 86 Jazf1-2.12 3.9-11.39 3.79E-6 2.1E-4 87 Akap1 -.75 6.24-11.38 3.81E-6 2.1E-4 88 Rnpep -.71 6.7-11.36 3.85E-6 2.2E-4 89 Gphn -.87 5.71-11.27 4.1E-6 2.9E-4 9 Wdr12 -.79 5.77-11.26 4.12E-6 2.9E-4 91 Podnl1-3.49 1.41-11.21 4.27E-6 2.12E-4 92 Tnfrsf8-1.42 5.92-11.2 4.3E-6 2.12E-4 93 Vcl -.96 5.91-11.17 4.36E-6 2.14E-4 94 Ccdc12-3.25 -.5-11.17 4.39E-6 2.14E-4 95 Bmp1-4.64.66-11.14 4.46E-6 2.15E-4 96 Bsn -1.33 4.8-11.14 4.47E-6 2.15E-4 97 Vwa7-2.22 2.95-11.11 4.56E-6 2.17E-4 98 Cpne3 -.9 5.44-11.11 4.56E-6 2.17E-4 99 Tnfsf11-4.9.99-11.7 4.69E-6 2.18E-4 1 Smo -.78 7.79-1.99 4.95E-6 2.27E-4

Table S2. Ikaros activated genes Activated upon 3d Dox treatment in ALL65, ALL11and ALL211 - sorted by FDR Rank GeneID Symbol Name ChIP logfc AveExpr t P.Value FDR 1 8348 Gimap3 GTPase, IMAP family member 3 TRUE 3.8 4.58 19.99 1.83E-6 1.77E-2 2 1722 Gramd3 GRAM domain containing 3 TRUE 2.31 5.38 17.55 3.78E-6 1.77E-2 3 1361 Ecm1 extracellular matrix protein 1 FALSE 2.44 4.56 15.13 8.61E-6 1.77E-2 4 231931 Gimap6 GTPase, IMAP family member 6 TRUE 1.93 7.33 14.88 9.42E-6 1.77E-2 5 244234 583411N6Rik RIKEN cdna 583411N6 gene FALSE 2.72 4.66 14.34 1.16E-5 1.77E-2 6 16421 Itgb7 integrin beta 7 FALSE 2.3 6.75 14.29 1.18E-5 1.77E-2 7 22778 Ikzf1 IKAROS family zinc finger 1 TRUE 3.7 8.92 14.41 1.22E-5 1.77E-2 8 236451 Phf11b PHD finger protein 11B FALSE 2.95 3.44 13.51 1.61E-5 1.83E-2 9 5744 Ehd3 EH-domain containing 3 TRUE 1.6 5.63 12.96 2.2E-5 1.83E-2 1 12516 Cd7 CD7 antigen FALSE 2.48 4.22 12.67 2.29E-5 1.83E-2 11 17526 Gimap4 GTPase, IMAP family member 4 FALSE 1.78 7.27 12.23 2.78E-5 1.83E-2 12 1871 Pik3r3 phosphatidylinositol 3 kinase, regulatory subunit, polypeptide 3 (p55) TRUE 1.99 5.27 11.92 3.19E-5 1.83E-2 13 143541 B6319A1Rik RIKEN cdna B6319A1 gene FALSE 2.36 3.5 11.56 3.77E-5 1.83E-2 14 58222 Rab37 RAB37, member of RAS oncogene family TRUE 1.74 5.4 11.53 3.84E-5 1.83E-2 15 22329 Vcam1 vascular cell adhesion molecule 1 FALSE 2.54 1.99 11.48 3.92E-5 1.83E-2 16 6694 Shisa5 shisa homolog 5 (Xenopus laevis) FALSE 1.52 8.9 11.32 4.24E-5 1.83E-2 17 231932 Gimap7 GTPase, IMAP family member 7 FALSE 2.8 3.96 11.19 4.53E-5 1.83E-2 18 1369 S1pr1 sphingosine-1-phosphate receptor 1 FALSE 2.71 4.42 11.28 4.64E-5 1.83E-2 19 12493 Cd37 CD37 antigen FALSE 1.51 5.81 11.5 4.85E-5 1.83E-2 2 16598 Klf2 Kruppel-like factor 2 (lung) TRUE 1.73 5.84 11. 4.95E-5 1.83E-2 21 13849 Ephx1 epoxide hydrolase 1, microsomal FALSE 1.95 3.79 1.91 5.18E-5 1.83E-2 22 16416 Itgb3 integrin beta 3 FALSE 1.65 5.95 1.91 5.18E-5 1.83E-2 23 74121 Acoxl acyl-coenzyme A oxidase-like TRUE 2.8 3.95 1.88 5.25E-5 1.83E-2 24 327978 Slfn5 schlafen 5 TRUE 2.58 5.76 1.85 5.71E-5 1.84E-2 25 76933 Ifi27l2a interferon, alpha-inducible protein 27 like 2A FALSE 2.68 4.17 1.67 6.25E-5 1.9E-2 26 22388 Wdr1 WD repeat domain 1 FALSE 1.26 8.19 1.24 7.3E-5 1.92E-2 27 72828 Ubash3b ubiquitin associated and SH3 domain containing, B TRUE 1.84 3.33 1.21 7.43E-5 1.92E-2 28 67213 Cmtm6 CKLF-like MARVEL transmembrane domain containing 6 FALSE 1.75 6.3 1.24 7.46E-5 1.92E-2 29 243374 Gimap8 GTPase, IMAP family member 8 TRUE 2.29 6.1 1.31 7.52E-5 1.92E-2 3 1258 Cd53 CD53 antigen FALSE 1.9 7.39 1.11 8.34E-5 1.97E-2 31 68728 Trp53inp2 transformation related protein 53 inducible nuclear protein 2 FALSE 2.44 2.65 9.99 8.35E-5 1.97E-2 32 229665 Ampd1 adenosine monophosphate deaminase 1 FALSE 3.15 3.43 1.7 8.53E-5 1.97E-2 33 2256 Pde6a phosphodiesterase 6A, cgmp-specific, rod, alpha TRUE 2.79 1.52 9.81 9.19E-5 1.97E-2 34 14256 Flt3l FMS-like tyrosine kinase 3 ligand TRUE 2.12 3.26 9.76 9.45E-5 1.97E-2 35 13139 Dgka diacylglycerol kinase, alpha TRUE 1.44 8. 9.75 9.52E-5 1.97E-2 36 1255 Cd44 CD44 antigen TRUE 2.91 1.2 9.72 1.3E-4 2.7E-2 37 15483 Hsd11b1 hydroxysteroid 11-beta dehydrogenase 1 TRUE 2.81 2.69 9.57 1.5E-4 2.7E-2 38 1412 Fas Fas (TNF receptor superfamily member 6) TRUE 2.21 3.97 9.65 1.5E-4 2.7E-2 39 22352 Vim vimentin TRUE 1.24 6.43 9.48 1.11E-4 2.9E-2 4 192176 Flna filamin, alpha FALSE 1.5 9.61 9.42 1.15E-4 2.9E-2 41 23969 Pacsin1 protein kinase C and casein kinase substrate in neurons 1 FALSE 3.59.22 9.38 1.17E-4 2.9E-2 42 14133 Fcna ficolin A FALSE 2.63.61 9.36 1.19E-4 2.9E-2 43 218294 Cdc14b CDC14 cell division cycle 14B FALSE 1.52 3.78 9.31 1.22E-4 2.9E-2 44 14132 Fcgrt Fc receptor, IgG, alpha chain transporter FALSE 2.35 2.53 9.31 1.22E-4 2.9E-2 45 153797 Gm11738 predicted gene 11738 FALSE 1.9 2.2 9.28 1.24E-4 2.9E-2 46 668139 Gm8995 predicted gene 8995 FALSE 1.9 5.44 9.33 1.28E-4 2.11E-2 47 2533 Slc4a1 solute carrier family 4 (anion exchanger), member 1 FALSE 2.32.97 9.21 1.29E-4 2.11E-2 48 67198 Spats2l spermatogenesis associated, serine-rich 2-like TRUE 2.22 1.76 9.15 1.33E-4 2.11E-2 49 56458 Foxo1 forkhead box O1 TRUE 1.71 7.17 9.22 1.36E-4 2.11E-2 5 215113 Slc43a2 solute carrier family 43, member 2 TRUE 1.51 6.9 9.12 1.37E-4 2.11E-2 51 2351 Sema4a sema domain, immunoglobulin domain (Ig), transmembrane domain (TM) and short cytoplasmic domain, (semaphorin) 4A FALSE 1.34 5.6 9.8 1.4E-4 2.11E-2 52 16414 Itgb2 integrin beta 2 TRUE 1.2 7.76 9.5 1.42E-4 2.11E-2 53 5823 Zbp1 Z-DNA binding protein 1 FALSE 2.63 5.56 9.11 1.45E-4 2.11E-2 54 93736 Aff4 AF4/FMR2 family, member 4 TRUE 1.21 7.21 8.98 1.48E-4 2.11E-2 55 18439 P2rx7 purinergic receptor P2X, ligand-gated ion channel, 7 TRUE 2.1 6.22 9.6 1.49E-4 2.11E-2 56 33256 Gm2559 predicted gene, 2559 FALSE 1.9 4.14 8.9 1.55E-4 2.11E-2 57 147 Celf2 CUGBP, Elav-like family member 2 TRUE 1.7 8.44 8.83 1.62E-4 2.11E-2 58 12877 Cpeb1 cytoplasmic polyadenylation element binding protein 1 FALSE 1.77 3.78 8.82 1.63E-4 2.11E-2 59 18197 Nsg2 neuron specific gene family member 2 TRUE 1.15 6.7 8.8 1.65E-4 2.11E-2 6 17772 Glcci1 glucocorticoid induced transcript 1 TRUE 1.42 7.2 8.79 1.66E-4 2.11E-2 61 21897 Tlr1 toll-like receptor 1 FALSE 1.79 3.24 8.77 1.68E-4 2.11E-2 62 3794 Pdlim4 PDZ and LIM domain 4 FALSE 1.7 6.3 8.74 1.71E-4 2.11E-2 63 236312 Pyhin1 pyrin and HIN domain family, member 1 FALSE 2.2 6.36 8.81 1.73E-4 2.11E-2 64 319493 A4378G23Rik RIKEN cdna A4378G23 gene TRUE 1.28 4.64 8.61 1.85E-4 2.2E-2 65 71371 Arid5b AT rich interactive domain 5B (MRF1-like) TRUE 1.76 3.61 8.6 1.87E-4 2.2E-2 66 227929 Cytip cytohesin 1 interacting protein TRUE 1.48 7.78 8.66 1.89E-4 2.2E-2 67 14579 Gem GTP binding protein (gene overexpressed in skeletal muscle) FALSE 1.38 3.37 8.49 1.99E-4 2.2E-2 68 8859 Nfkbiz nuclear factor of kappa light polypeptide gene enhancer in B cells inhibitor, zeta TRUE 1.56 3.6 8.49 1.99E-4 2.2E-2 69 12775 Ccr7 chemokine (C-C motif) receptor 7 TRUE 1.52 5.55 8.47 2.2E-4 2.2E-2 7 1649 Itgam integrin alpha M TRUE 1.82 4.86 8.56 2.2E-4 2.2E-2 71 56437 Rrad Ras-related associated with diabetes FALSE 1.39 3.64 8.47 2.2E-4 2.2E-2 72 329154 Ankrd44 ankyrin repeat domain 44 TRUE.99 7.55 8.45 2.4E-4 2.2E-2 73 269346 Slc28a2 solute carrier family 28 (sodium-coupled nucleoside transporter), member 2 FALSE 1.21 4.76 8.45 2.5E-4 2.2E-2 74 338523 Kdm7a lysine (K)-specific demethylase 7A FALSE 1.47 4.96 8.43 2.7E-4 2.2E-2 75 786 Cysltr2 cysteinyl leukotriene receptor 2 TRUE 2.68.46 8.36 2.17E-4 2.2E-2 76 15139 Hc hemolytic complement FALSE 1.66 3.76 8.35 2.18E-4 2.2E-2 77 3933 Tor2a torsin family 2, member A FALSE 1.12 5.49 8.34 2.19E-4 2.2E-2 78 227753 Gsn gelsolin FALSE 2.6 6.46 8.4 2.23E-4 2.2E-2 79 238871 Pde4d phosphodiesterase 4D, camp specific TRUE 1.16 5.42 8.29 2.26E-4 2.2E-2 8 239647 Pced1b PC-esterase domain containing 1B TRUE 1.44 4.67 8.28 2.28E-4 2.2E-2 81 183 Nedd9 neural precursor cell expressed, developmentally down-regulated gene 9 TRUE 1.31 6.14 8.27 2.3E-4 2.2E-2 82 18761 Prkcq protein kinase C, theta TRUE 1.34 8.2 8.29 2.3E-4 2.2E-2 83 57912 Cdc42se1 CDC42 small effector 1 TRUE 1.6 8. 8.26 2.31E-4 2.2E-2 84 64933 Ap3m2 adaptor-related protein complex 3, mu 2 subunit TRUE 2.68 2.21 8.24 2.34E-4 2.2E-2 85 7369 Glipr1 GLI pathogenesis-related 1 (glioma) FALSE 2.4 1.85 8.3 2.34E-4 2.2E-2 86 327 Sidt1 SID1 transmembrane family, member 1 FALSE 2.39 4.68 8.29 2.38E-4 2.2E-2 87 69926 Dnah17 dynein, axonemal, heavy chain 17 FALSE 1.58 3.59 8.2 2.39E-4 2.2E-2 88 6627 Fam134b family with sequence similarity 134, member B FALSE 1.68 4.81 8.26 2.41E-4 2.2E-2 89 6783 Limd2 LIM domain containing 2 TRUE 1.7 9.5 8.18 2.43E-4 2.2E-2 9 654 Il21r interleukin 21 receptor TRUE 1.6 6.48 8.14 2.49E-4 2.23E-2 91 2684 Sp1 nuclear antigen Sp1 FALSE 1.77 7.44 8.17 2.57E-4 2.25E-2 92 214639 493486L24Rik RIKEN cdna 493486L24 gene TRUE 1.73 1.57 8.9 2.58E-4 2.25E-2 93 32982 Arl4c ADP-ribosylation factor-like 4C TRUE 1.39 5.9 8.5 2.68E-4 2.3E-2 94 21757 Themis thymocyte selection associated TRUE.93 8.3 8.3 2.68E-4 2.3E-2 95 1924 Tmsb1 thymosin, beta 1 TRUE 1.2 7.26 7.98 2.77E-4 2.32E-2 96 15365 Hbb-bs hemoglobin, beta adult s chain FALSE 1.99 2.26 7.97 2.78E-4 2.32E-2 97 62875 Phf11c PHD finger protein 11C FALSE 2.54 4.4 8.2 2.83E-4 2.33E-2 98 1251 Bcl3 B cell leukemia/lymphoma 3 FALSE 2.15 2.56 7.93 2.85E-4 2.33E-2 99 69769 Tnfaip8l2 tumor necrosis factor, alpha-induced protein 8-like 2 TRUE 1.35 4.53 7.87 2.97E-4 2.36E-2 1 22423 Wnt8b wingless related MMTV integration site 8b FALSE 1.75 2. 7.87 2.98E-4 2.36E-2 11 2986 Samd9l sterile alpha motif domain containing 9-like FALSE 1.77 5.85 7.94 2.99E-4 2.36E-2 12 56878 Rbms1 RNA binding motif, single stranded interacting protein 1 FALSE 1.24 5.57 7.84 3.4E-4 2.36E-2 13 2736 Add3 adducin 3 (gamma) FALSE 2.31 5.81 7.91 3.6E-4 2.36E-2 14 22695 Zfp36 zinc finger protein 36 TRUE 2.4 5.87 7.88 3.1E-4 2.36E-2 15 22779 Ikzf2 IKAROS family zinc finger 2 TRUE.9 7.74 7.81 3.1E-4 2.36E-2 16 16792 Laptm5 lysosomal-associated protein transmembrane 5 TRUE 1.1 9.71 7.81 3.1E-4 2.36E-2 17 112646 Trav13n-4 T cell receptor alpha variable 13N-4 FALSE 2.1 1.41 7.79 3.16E-4 2.36E-2 18 74747 Ddit4 DNA-damage-inducible transcript 4 FALSE 1.47 7.61 7.83 3.21E-4 2.36E-2 19 891 Cxcr6 chemokine (C-X-C motif) receptor 6 FALSE 2.13 1.69 7.75 3.23E-4 2.36E-2 11 23833 Cd52 CD52 antigen TRUE 1.96 6.33 7.82 3.24E-4 2.36E-2

111 12511 Cd6 CD6 antigen TRUE 1.4 7.18 7.81 3.25E-4 2.36E-2 112 15841 Dennd3 DENN/MADD domain containing 3 FALSE 1.13 4.97 7.7 3.32E-4 2.36E-2 113 1887 Pld3 phospholipase D family, member 3 TRUE 1.52 5.68 7.76 3.37E-4 2.36E-2 114 317757 Gimap5 GTPase, IMAP family member 5 TRUE 1.17 4.98 7.68 3.37E-4 2.36E-2 115 56489 Ikbke inhibitor of kappab kinase epsilon TRUE 1.18 6.61 7.68 3.38E-4 2.36E-2 116 12227 Btg2 B cell translocation gene 2, anti-proliferative TRUE.98 7.6 7.67 3.39E-4 2.36E-2 117 545384 BC94916 cdna sequence BC94916 FALSE 2.28 3.13 7.75 3.39E-4 2.36E-2 118 2444 St3gal2 ST3 beta-galactoside alpha-2,3-sialyltransferase 2 TRUE 1.6 5.37 7.75 3.4E-4 2.36E-2 119 67168 Lpar6 lysophosphatidic acid receptor 6 TRUE 1.26 5.46 7.64 3.47E-4 2.37E-2 12 57757 Pglyrp2 peptidoglycan recognition protein 2 TRUE 1.2 5.94 7.52 3.76E-4 2.5E-2 121 66151 Prr13 proline rich 13 TRUE 1.44 5.53 7.56 3.82E-4 2.5E-2 122 235493 Fam214a family with sequence similarity 214, member A FALSE 1.87 4.41 7.5 4.1E-4 2.59E-2 123 16194 Il6ra interleukin 6 receptor, alpha TRUE 2.29 4.7 7.46 4.12E-4 2.62E-2 124 216984 Evi2b ecotropic viral integration site 2b FALSE 1.3 5.32 7.35 4.25E-4 2.66E-2 125 2189 Tgfb3 transforming growth factor, beta 3 FALSE 2.79 2.83 7.41 4.28E-4 2.66E-2 126 5646 Pkp3 plakophilin 3 FALSE 1.8 4.2 7.33 4.32E-4 2.66E-2 127 23912 Rhof ras homolog gene family, member f TRUE 1.87 4.44 7.39 4.32E-4 2.66E-2 128 1619 Il4ra interleukin 4 receptor, alpha TRUE 1.99 4.35 7.39 4.33E-4 2.66E-2 129 11489 Adam12 a disintegrin and metallopeptidase domain 12 (meltrin alpha) FALSE 2.44 1.1 7.38 4.35E-4 2.66E-2 13 14744 Gpr65 G-protein coupled receptor 65 FALSE 1.1 5.12 7.29 4.43E-4 2.66E-2 131 152 H2-Ob histocompatibility 2, O region beta locus FALSE 2.39 1.62 7.29 4.43E-4 2.66E-2 132 12262 C1qc complement component 1, q subcomponent, C chain FALSE 2.6 -.12 7.28 4.45E-4 2.66E-2 133 7242 Cotl1 coactosin-like 1 (Dictyostelium) TRUE 1.7 8.26 7.28 4.45E-4 2.66E-2 134 244 St6gal1 beta galactoside alpha 2,6 sialyltransferase 1 TRUE 1.8 7.12 7.27 4.5E-4 2.67E-2 135 225825 Cd226 CD226 antigen TRUE 1.81 4.51 7.33 4.51E-4 2.67E-2 136 7176 Slc46a3 solute carrier family 46, member 3 FALSE 2.4 1.3 7.25 4.55E-4 2.68E-2 137 53314 Batf basic leucine zipper transcription factor, ATF-like TRUE 1.3 3.86 7.21 4.69E-4 2.7E-2 138 242584 Wdr78 WD repeat domain 78 TRUE 1.48 2.71 7.2 4.73E-4 2.7E-2 139 19419 Rasgrp1 RAS guanyl releasing protein 1 FALSE.88 9.2 7.18 4.78E-4 2.7E-2 14 7244 Wdr44 WD repeat domain 44 TRUE 1.9 4.83 7.18 4.79E-4 2.7E-2 141 27218 Slamf1 signaling lymphocytic activation molecule family member 1 TRUE 1.6 4.35 7.18 4.81E-4 2.7E-2 142 1181 Cd5l CD5 antigen-like FALSE 2.13.21 7.17 4.83E-4 2.7E-2 143 665113 Tnik TRAF2 and NCK interacting kinase TRUE.94 5.96 7.17 4.84E-4 2.7E-2 144 76469 Cmya5 cardiomyopathy associated 5 TRUE 1.63 1.76 7.15 4.9E-4 2.72E-2 145 22142 Tuba1a tubulin, alpha 1A TRUE 1.12 3.61 7.12 4.99E-4 2.75E-2 146 2364 Sepw1 selenoprotein W, muscle 1 FALSE.97 5.14 7.1 5.6E-4 2.76E-2 147 16161 Il12rb1 interleukin 12 receptor, beta 1 TRUE 1.18 5.61 7.1 5.7E-4 2.76E-2 148 13197 Gadd45a growth arrest and DNA-damage-inducible 45 alpha TRUE 1.61 3.89 7.11 5.9E-4 2.76E-2 149 1625 Gimap1 GTPase, IMAP family member 1 TRUE.94 6.3 7.7 5.18E-4 2.76E-2 15 12452 Ccng2 cyclin G2 TRUE 1.13 7.19 7.6 5.25E-4 2.76E-2 151 6764 Chmp1b charged multivesicular body protein 1B FALSE 1.9 6.23 7.3 5.33E-4 2.76E-2 152 11931 Atp1b1 ATPase, Na+/K+ transporting, beta 1 polypeptide TRUE 1.19 3.98 7.2 5.37E-4 2.76E-2 153 76681 Trim12a tripartite motif-containing 12A FALSE 1.55 4.24 7.7 5.37E-4 2.76E-2 154 7624 Gm11346 predicted gene 11346 TRUE 2.28 2.11 7.1 5.42E-4 2.76E-2 155 223827 Gxylt1 glucoside xylosyltransferase 1 FALSE.86 5.9 7.1 5.42E-4 2.76E-2 156 29812 Ndrg3 N-myc downstream regulated gene 3 TRUE 1.45 6.61 7.7 5.42E-4 2.76E-2 157 51791 Rgs14 regulator of G-protein signaling 14 FALSE 1.15 5.24 6.99 5.49E-4 2.76E-2 158 15368 Hmox1 heme oxygenase (decycling) 1 TRUE 1.3 3.28 6.99 5.52E-4 2.76E-2 159 12581 Cdkn2d cyclin-dependent kinase inhibitor 2D (p19, inhibits CDK4) FALSE 1.43 6.9 7.4 5.54E-4 2.76E-2 16 13732 Emp3 epithelial membrane protein 3 TRUE.83 6.18 6.98 5.54E-4 2.76E-2 161 223433 Fam15a family with sequence similarity 15, member A TRUE 1.48 6.35 7.3 5.59E-4 2.76E-2 162 2555 Slfn1 schlafen 1 FALSE 2.92 4.6 7.2 5.63E-4 2.76E-2 163 1878 Pik3r1 phosphatidylinositol 3-kinase, regulatory subunit, polypeptide 1 (p85 alpha) TRUE 1.6 7.58 6.95 5.66E-4 2.76E-2 164 669 Ypel3 yippee-like 3 (Drosophila) FALSE 1.56 4.34 7. 5.7E-4 2.76E-2 165 16994 Ltb lymphotoxin B FALSE 1.62 6. 7. 5.71E-4 2.76E-2 166 17122 Mxd4 Max dimerization protein 4 FALSE 1.69 5.88 6.98 5.78E-4 2.76E-2 167 1767 Nod1 nucleotide-binding oligomerization domain containing 1 TRUE 1.64 4.14 6.98 5.81E-4 2.76E-2 168 217356 Tmc8 transmembrane channel-like gene family 8 TRUE 1.12 5.71 6.91 5.84E-4 2.76E-2 169 26918 Inpp4a inositol polyphosphate-4-phosphatase, type I FALSE 1.77 1.45 6.91 5.85E-4 2.76E-2 17 23221 Arhgap25 Rho GTPase activating protein 25 TRUE 1.3 5.77 6.96 5.89E-4 2.76E-2 171 328833 Treml2 triggering receptor expressed on myeloid cells-like 2 TRUE.9 5.93 6.89 5.92E-4 2.76E-2 172 223453 Dap death-associated protein TRUE 1.31 6.73 6.95 5.92E-4 2.76E-2 173 13549 Dyrk1b dual-specificity tyrosine-(y)-phosphorylation regulated kinase 1b FALSE 1.5 4.39 6.93 5.94E-4 2.76E-2 174 8289 Lysmd3 LysM, putative peptidoglycan-binding, domain containing 3 FALSE 1.9 4.99 6.89 5.94E-4 2.76E-2 175 23943 Esyt1 extended synaptotagmin-like protein 1 TRUE.81 8.72 6.89 5.95E-4 2.76E-2 176 19261 Sirpa signal-regulatory protein alpha FALSE 2.25.86 6.87 6.4E-4 2.79E-2 177 72144 Slc37a3 solute carrier family 37 (glycerol-3-phosphate transporter), member 3 TRUE.96 4.6 6.86 6.9E-4 2.79E-2 178 213438 A6333H2Rik RIKEN cdna A6333H2 gene FALSE 1.13 3.84 6.85 6.12E-4 2.79E-2 179 1282 Cnr2 cannabinoid receptor 2 (macrophage) TRUE 1.37 4.78 6.86 6.17E-4 2.81E-2 18 235627 Nbeal2 neurobeachin-like 2 TRUE 1.7 7. 6.82 6.24E-4 2.81E-2 181 667373 Gm14446 predicted gene 14446 FALSE 2.62 3.57 6.88 6.25E-4 2.81E-2 182 1648 Jup junction plakoglobin FALSE 1.76 5.61 6.87 6.28E-4 2.81E-2 183 1926 Ptpn22 protein tyrosine phosphatase, non-receptor type 22 (lymphoid) TRUE 1.13 6.8 6.8 6.36E-4 2.81E-2 184 98952 Fam12a family with sequence similarity 12, member A TRUE 2.38 5.59 6.85 6.4E-4 2.81E-2 185 2813 Srp14 signal recognition particle 14 TRUE.78 6.32 6.78 6.45E-4 2.81E-2 186 12945 Dmbt1 deleted in malignant brain tumors 1 FALSE 1.32 2.5 6.77 6.5E-4 2.81E-2 187 192 Pstpip1 proline-serine-threonine phosphatase-interacting protein 1 TRUE 1.5 5.89 6.76 6.55E-4 2.81E-2 188 19226 A932I21Rik RIKEN cdna A932I21 gene FALSE 1.12 3.52 6.75 6.59E-4 2.81E-2 189 21319 Pdlim2 PDZ and LIM domain 2 FALSE 1.13 5.43 6.75 6.6E-4 2.81E-2 19 52857 Gramd1a GRAM domain containing 1A TRUE 1.27 6.2 6.8 6.65E-4 2.81E-2 191 75747 Sesn3 sestrin 3 FALSE 1. 5.21 6.74 6.66E-4 2.81E-2 192 98267 Stk17b serine/threonine kinase 17b (apoptosis-inducing) TRUE 1.34 7.87 6.79 6.66E-4 2.81E-2 193 16822 Lcp2 lymphocyte cytosolic protein 2 TRUE 1.5 7.78 6.73 6.69E-4 2.81E-2 194 6599 Trp53inp1 transformation related protein 53 inducible nuclear protein 1 TRUE 1.43 9.2 6.78 6.73E-4 2.81E-2 195 32435 Rinl Ras and Rab interactor-like FALSE 1. 6.54 6.71 6.77E-4 2.81E-2 196 6361 Ms4a4b membrane-spanning 4-domains, subfamily A, member 4B FALSE 2.27 5.53 6.76 6.82E-4 2.81E-2 197 16889 Lipa lysosomal acid lipase A TRUE 1.67 7.6 6.76 6.84E-4 2.81E-2 198 152842 Gm14718 predicted gene 14718 FALSE 3.67.63 6.75 6.87E-4 2.81E-2 199 7152 Grap GRB2-related adaptor protein TRUE 1.2 6.63 6.69 6.89E-4 2.81E-2 2 78473 Skap1 src family associated phosphoprotein 1 FALSE.86 7.64 6.68 6.97E-4 2.83E-2 21 17155 Man1a mannosidase 1, alpha TRUE 1.1 6.19 6.67 7.1E-4 2.83E-2 22 18646 Prf1 perforin 1 (pore forming protein) FALSE 4.2 -.35 6.71 7.8E-4 2.83E-2 23 12721 Coro1a coronin, actin binding protein 1A TRUE.88 1.4 6.65 7.11E-4 2.83E-2 24 13521 Slc26a2 solute carrier family 26 (sulfate transporter), member 2 FALSE 1.7 5.59 6.64 7.14E-4 2.83E-2 25 75665 Ccdc64 coiled-coil domain containing 64 TRUE 1.91 3.1 6.69 7.17E-4 2.83E-2 26 782 Lysmd2 LysM, putative peptidoglycan-binding, domain containing 2 FALSE 2.62 -.29 6.64 7.18E-4 2.83E-2 27 67759 Plgrkt plasminogen receptor, C-terminal lysine transmembrane protein FALSE.96 5.8 6.63 7.2E-4 2.83E-2 28 24162 Pgap1 post-gpi attachment to proteins 1 TRUE 1.59 3.97 6.69 7.22E-4 2.83E-2 29 297 Sdc3 syndecan 3 FALSE 2.18 2.72 6.68 7.26E-4 2.83E-2 21 1537 Nr4a1 nuclear receptor subfamily 4, group A, member 1 TRUE 1.7 6.1 6.67 7.29E-4 2.83E-2 211 1298 Arhgef18 rho/rac guanine nucleotide exchange factor (GEF) 18 FALSE 1. 6.77 6.61 7.3E-4 2.83E-2 212 668253 Dleu2 deleted in lymphocytic leukemia, 2 TRUE 1.11 3.69 6.61 7.35E-4 2.84E-2 213 215449 Rap1b RAS related protein 1b TRUE.75 6.94 6.6 7.4E-4 2.84E-2 214 211389 Suox sulfite oxidase FALSE.97 4.78 6.59 7.46E-4 2.85E-2 215 12335 Capn3 calpain 3 TRUE.93 4.55 6.59 7.46E-4 2.85E-2 216 1617 Il16 interleukin 16 TRUE.9 7.73 6.58 7.49E-4 2.85E-2 217 6619 Tspan13 tetraspanin 13 TRUE.82 6.45 6.55 7.65E-4 2.88E-2 218 12393 Runx2 runt related transcription factor 2 TRUE 3.19.48 6.54 7.72E-4 2.89E-2 219 383295 Ypel5 yippee-like 5 (Drosophila) TRUE 1.45 5.6 6.59 7.79E-4 2.89E-2 22 99696 Ankrd5 ankyrin repeat domain 5 TRUE 1.4 4.3 6.53 7.82E-4 2.89E-2 221 67579 Cpeb4 cytoplasmic polyadenylation element binding protein 4 TRUE 1.6 2.99 6.52 7.83E-4 2.89E-2 222 77799 Sla2 Src-like-adaptor 2 TRUE.83 6.24 6.51 7.89E-4 2.89E-2 223 2238 Atxn1 ataxin 1 TRUE 1.58 2.52 6.51 7.92E-4 2.89E-2 224 23979 Tnfrsf14 tumor necrosis factor receptor superfamily, member 14 (herpesvirus entry mediator) TRUE 1.4 2.93 6.51 7.93E-4 2.89E-2