Μέγεθος: px
Εμφάνιση ξεκινά από τη σελίδα:




2 ΠΑΝΕΠΙΣΤΗΜΙΟ ΠΑΤΡΩΝ ΣΧΟΛΗ ΘΕΤΙΚΩΝ ΕΠΙΣΤΗΜΩΝ ΤΜΗΜΑ ΒΙΟΛΟΓΙΑΣ ΠΡΟΓΡΑΜΜΑ ΜΕΤΑΠΤΥΧΙΑΚΩΝ ΣΠΟΥΔΩΝ «ΒΙΟΛΟΓΙΚΗ ΤΕΧΝΟΛΟΓΙΑ» ΕΡΓΑΣΤΗΡΙΟ ΜΟΡΙΑΚΗΣ ΚΑΙ ΑΝΑΠΤΥΞΙΑΚΗΣ ΒΙΟΛΟΓΙΑΣ ΜΕΤΑΠΤΥΧΙΑΚΗ ΕΡΓΑΣΙΑ «Ο PlCoup-TF και το ρυθμιστικό γονιδιακό δίκτυο της νευρογένεσης στον αχινό» Χριστίνα Καλογήρου Βιολόγος Επιβλέπων καθηγητής: Κων. Φλυτζάνης Αναπληρωτής Καθηγητής Εργαστήριο Μοριακής και Αναπτυξιακής Βιολογίας Τμήμα Βιολογίας Πανεπιστήμιο Πατρών ΠΑΤΡΑ 2014

3 Τριμελής επιτροπή κ. Φλυτζάνης Κωνσταντίνος (Επιβλέπων Καθηγητής) Αναπληρωτής Καθηγητής, Τμήμα Βιολογίας, Πανεπιστήμιο Πατρών κ. Ζαρκάδης Ιωάννης Καθηγητής, Τμήμα Ιατρικής, Πανεπιστήμιο Πατρών κ. Μίντζας Αναστάσιος Καθηγητής, Τμήμα Βιολογίας, Πανεπιστήμιο Πατρών

4 ΠΡΟΛΟΓΟΣ Η παρούσα μεταπτυχιακή εργασία εκπονήθηκε στο Εργαστήριο Μοριακής και Αναπτυξιακής Βιολογίας της Τμήματος Βιολογίας του Πανεπιστημίου Πατρών στα πλαίσια του προγράμματος μεταπτυχιακών σπουδών «Βιολογική Τεχνολογία», υπό την επίβλεψη του Αναπληρωτή Καθηγητή κ. Κων. Φλυτζάνη, κατά τα έτη Σε αυτό το σημείο θα ήθελα να ευχαριστήσω τον κ. Φλυτζάνη για την εμπιστοσύνη που μου έδειξε να πραγματοποίησω στο εργαστήριο του την μεταπτυχιακή μου εργασία και να συνεχιστεί έτσι η συνεργασία μας που είχε ξεκίνησει στα πλαίσια της εκπόνισης της διπλωματικής μου εργασίας στο εργαστήριο του. Θα ήθελα να εκφράσω την ιδιαίτερη τιμή μου στον κ.μίντζα και στον κ.ζαρκάδη που δέχτηκαν να αποτελέσουν μέλη της τριμελούς επιτροπής μου. Ιδιαίτερα και θερμά ευχαριστώ τον κ. Ζαρκάδη για τις καίριες συμβουλές του στην συγγρραφή της μεταπτυχιακής μου εργασίας αλλά και στην γενικότερη υποστήριξη του. Φυσικά ευχαριστώ από ψυχής όλα τα εργαστηριακά μέλη για το κλίμα συνεργασίας και αλληλουποστήριξης που αναπτύξαμε. Ιδιαίτερα ευχαριστώ την Γιάννα Γεώργα για την πολύτιμη βοήθεια της, όπως επίσης και την Αλεξάνδρα Πατμανίδη από το τμήμα Ιατρικής. Χωρίς την υποστήριξη της οικογένειας μου όμως τίποτα δεν θα είχα καταφέρει. Πέρα από την οικονομική υποστήριξη, η ψυχική και ηθική ενδυνάμωση που μου πρόσφεραν συνεχώς ήταν το μόνο ισχυρό όπλο απέναντι στις δυσκολίες που συνάντησα. Χριστίνα Καλογήρου Οκτώβρης 2014 Πάτρα

5 ΠΕΡΙΕΧΟΜΕΝΑ ΕΙΣΑΓΩΓΗ Το πειραματόζωο: Aχινός Paracentrotus lividus Α. Γενικά χαρακτηριστικά Β. Πλεονεκτήματα ως πειραµατόζωο Γ. Eνδιαιτήματα και oικολογία Δ. Συμπεριφορά Ε. Αναπαραγωγή Ζ. Εμβρυογένεση Ζ.1. Ιστορική αναδρομή Ζ.2. Λεπτομερής περιγραφή Η. Νευρογένεση Η.1. Οι νευρογενείς περιοχές και η καθιέρωση τους Η.2. Νευρικός ιστός Θ. Το ρυθμιστικό δίκτυο γονιδίων Η.2.α. Εμπρόσθιο νευροεξώδερμα (ΑΝΕ) Η.2.α. Εξώδερμα βλεφαριδωτής ζώνης(cbe) Ι. Γονίδια εξειδικεύμενα για την νευρογένεση Ι.1. Ο µεταγραφικός παράγοντας Coup-TF Ι.2. Ο μεταγραφικός παράγοντας z81/zhhx1 Ι.3. Ο μεταγραφικός παράγοντας Ηbn Ι.4. Ο μεταγραφικός παράγοντας FoxG ΣΚΟΠΟΣ ΥΛΙΚΑ ΚΑΙ ΜΕΘΟΔΟΙ Α. Δημιουργία ανιχνευτών για χρωμογόνο και διπλή φθορίζουσα in situ υβριδοποίηση

6 Α.1. Συλλογή γαμετών, τεχνητή γονιμοποίηση και καλλιέργεια εμβρύων Α.2. Απομόνωση RNA (50-100mgr) από διαφορετικά αναπτυξιακά στάδια (phenol-chloroform extraction) Α.3. RΤ-PCR με διαβαθμισμένη θερμοκρασία Α.4. Ηλεκτροφόρηση c-dna Α.5. Καθαρισμός προϊόντων RT-PCR Α.6. Φωτομέτρηση νουκλεϊκών οξέων Α.7. Αντίδραση λιγάσης Α.8. Κατασκευή τρυβλίων θρεπτικού υλικού για βακτηριακές καλλιέργειες Α.9. Mετασχηματισμός βακτηρίων E.coli Α.10. Επιλογή μετασχηματισμένων βακτηρίων (blue-white screening) Α.11 Απομόνωση πλασμιδίων (Mini preps) Α.12. Κατάτμηση με ένζυμα περιορισμού Α.13. Αλληλούχιση ενθεμάτων Α.14. Αποθήκευση κλώνων Α.15. PCR Α.16 Ιn vitro μεταγραφή Α.17 Σήμανση των αντινοηματικών μεταγράφων Β. Γονιδιακή καταστολή σε γονιμοποιημένα αυγά με ενέσεις με ΜΑSO Γ. Μονιμοποίηση εμβρύων για χρωμογόνο και διπλή φθορίζουσα in situ υβριδοποίηση Δ. Χρωμογόνος in situ υβριδοποίηση Ε. Διπλή φθορίζουσα in situ υβριδοποίηση Ζ. Απομόνωση RNA(1,5 μgr) από μικρό αριθμό control και ενεμένων εμβρύων για Q- PCR Η. Q-PCR από RNA control και ενεμένων εμβρύων ΑΠΟΤΕΛΕΣΜΑΤΑ Α. Aποτελέσματα προετοιμασίας ανιχνευτών για χρωμογόνο και διπλή φθορίζουσα in situ υβριδοποίηση Α.1. Αποτελέσματα διαβαθμισμένης RT PCR Α.2. Aποτελέσματα κατάτμησης με ένζυμα περιορισμού και της αλληλούχισης των κλώνων Α.3. Αποτελέσματα PCR Α.4. Αποτελέσματα in vitro μεταγραφής Β. Συνεντοπισμός της έκφρασης του PlCOUP-TF και των γονιδίων της νευρογένεσης σε ώριμα αναπτυξιακά στάδια

7 Β.1. Ιστοειδικός εντοπισμός της έκφρασης του PlCOUP-TF και του Plz81 σε ώριμα αναπτυξιακά στάδια Β.1.α. Ιστοειδική έκφραση του PlCOUP-TF σε ώριμα αναπτυξιακά στάδια Β.1.β. Ιστοειδική έκφραση του Plz81 σε ώριμα αναπτυξιακά στάδια Β.1.γ. Συνεντοπισμός της έκφρασης του PlCOUP-TF και του Plz81 σε ώριμα αναπτυξιακά στάδια Β.1.δ. Διαφοροποίηση της έκφρασης του PlCOUP-TF και του Plz81 σε ώριμα αναπτυξιακά στάδια Β.2. Ιστοειδικός εντοπισμός της έκφρασης του PlCOUP-TF και του PlHbn σε ώριμα αναπτυξιακά στάδια Β.2.α. Ιστοειδική έκφραση του PlCOUP-TF σε ώριμα αναπτυξιακά στάδια Β.2.β. Ιστοειδική έκφραση του PlHbn σε ώριμα αναπτυξιακά στάδια Β.2.γ. Συνεντοπισμός της έκφρασης του PlCOUP-TF και του PlHbn σε ώριμα αναπτυξιακά στάδια Β.2.δ. Διαφοροποίηση της έκφρασης του PlCOUP-TF και του PlHbn σε ώριμα αναπτυξιακά στάδια Β.3. Ιστοειδικός εντοπισμός της έκφρασης του PlCOUP-TF και του PlFoxG σε ώριμα αναπτυξιακά στάδια Β.3.α. Ιστοειδική έκφραση του PlCOUP-TF σε ώριμα αναπτυξιακά στάδια Β.3.β. Ιστοειδική έκφραση του PlFoxG σε ώριμα αναπτυξιακά στάδια Β.3.γ. Συνεντοπισμός της έκφρασης του PlCOUP-TF και του PlFoxG σε ώριμα αναπτυξιακά στάδια Β.3.δ. Διαφοροποίηση της έκφρασης του PlCOUP-TF και του PlFoxG σε ώριμα αναπτυξιακά στάδια Γ. Εντοπισμός της ιστοειδικής έκφρασης των γονιδίων της νευρογένεσης σε control και ενεμένα με COUP-T MASO έμβρυα Γ.1. Εντοπισμός της ιστοειδικής έκφρασης του Plz81 σε control και ενεμένα με COUP-T MASO έμβρυα Γ.2. Εντοπισμός της ιστοειδικής έκφρασης του PlΗbn σε control και ενεμένα με COUP-T MASO έμβρυα Γ.3. Εντοπισμός της ιστοειδικής έκφρασης του PlFoxG σε control και ενεμένα με COUP-T MASO έμβρυα Δ. Ποσοτικοποίηση των μεταγράφων των γονιδίων της νευρογένεσης σε control και ενεμένα με COUP-TF MASO έμβρυα ΣΥΖΗΤΗΣΗ ΠΕΡΙΛΗΨΗ ΒΙΒΛΙΟΓΡΑΦΙΑ


9 Το πειραματόζωο: Aχινός Paracentrotus lividus Α. Γενικά χαρακτηριστικά O Paracentrotus lividus είναι ένα είδος αχινού, γνωστό ως πετραχινός. Είναι ένας σχετικά µεγάλος σε µέγεθος αχινός που µπορεί να φτάσει τα 7,5cm σε διάµετρο και συναντάται σε διάφορα χρώµατα (µαυρο- µωβ, καφέ-κόκκινο, σκούρο καφέ, καφεκίτρινο και λαδί). Όπως όλα τα εχινόδερμα έτσι και ο Paracentrotus.lividus φέρει το πιο ξεχωριστό χαρακτηριστικό, την πεντακτινωτή συμμετρία, η οποία προκύπτει δευτερογενώς μετά από μια περίοδο αμφίπλευρης συμμετρίας (Barnes, Invertebrare Zoology), όπως επίσης υδροφορικό σύστημα και εξωσκελετό με πλακίδια και αρθρωτές άκανθες. Εικόνα 1: O πετραχινός Β. Πλεονεκτήματα ως πειραµατόζωο Η επιλογή του αχινού ως πειραματόζωο δεν ήταν τυχαία. Συγκεκριμένα, είναι προτιμητέο πειραµατικό υλικό για έρευνα στην αναπτυξιακή βιολογία γιατί: Είναι ευρέως διαδεδοµένος και εύκολο να συλλεχθεί και να διατηρηθεί (σε ενυδρείο). Τα έµβρυα του διατηρούνται σε θαλασσινό νερό χωρίς απαίτηση ορών ή ακριβών χηµικών αντιδραστηρίων. Κάθε άτοµο δίνει πολλούς γαµέτες και εν δυνάµει έµβρυα (απογόνους). Στο σπέρµα του αχινού υπάρχουν 2x10 11 σπερµατοζωάρια/ml και τα ωάρια όταν έχουν καθιζάνει έχουν πυκνότητα ίση με 2x10 6 /ml. Γονιµοποιείται αμφιγονικά µε εξωτερική γονιµοποίηση που µπορεί να γίνει τεχνητά. Τα έµβρυα του είναι διάφανα και επιτρέπουν την παρακολούθηση: α) της εµβρυογένεσης και των κυτταρικών διαιρέσεων και κινήσεων που επιτελούνται κατά την διάρκεια της, β) των αποτελεσµάτων πειραµατικών διαδικασιών όπως της γονιδιακής ενίσχυσης ή καταστολής π.χ. με ενέσεις με mrna και morpholino αντίστοιχα προκειμένου να γίνει καθαρισμός μεταγραφικών παραγόντων.

10 Λόγω της απλότητας της εµβρυογένεσης και του βασικού αναπτυξιακού προτύπου δευτεροστόµιου οργανισµού που ακολουθεί, επιτρέπει την κατάληξη σε συµπεράσµατα για βασικές αναπτυξιακές διαδικασίες που έχουν συντηρηθεί πανοµοιότυπα και σε εξελικτικά πιο περίπλοκους οργανισµούς όπως ο άνθρωπος (Oliveri et. al., 2007). Παρακάτω παρουσιάζονται κάποια βασικά χαρακτηριστικά του συγκεκριμένου είδους που κάνουν ακόμα πιο ισχυρούς τους λόγους επιλογής του. Γ. Eνδιαιτήματα και oικολογία Οι περιοχές εξάπλωσης του περιλαµβάνουν όλη την Μεσόγειο (και τις παραλίες της Πάτρας) και τον βόρειο Ατλαντικό από την Ιρλανδία έως το Μαρόκο. Γενικότερα η εξάπλωση του περιορίζεται από την θερµοκρασία του νερού και τα όρια ανοχής του είναι 8C το χειµώνα και 28C το καλοκαίρι. Έχει µεγάλη ευαισθησία στις υψηλές τιµές αλατότητας, ενώ δεν επηρεάζεται από την οργανική µόλυνση και τα βαρέα µέταλλα. Ο Paracentrotus lividus είναι τυπικό είδος της υποπαλιρροιακής ζώνης και το ενδιαίτηµά του περιορίζεται συνήθως σε βάθη 10-20m καθώς κατά την διασπορά των προνυµφών στα µεγαλύτερα βάθη υπάρχει έντονη θύρευση. Σε αυτά τα βάθη ο Paracentrotus lividus εντοπίζεται σε βράχια, στα οποία πολλές φορές τρυπώνει αν τα πετρώµατα είναι µαλακά και σε λιβάδια Posidonia oceanica και Zostera marina. Σε αυτές τις περιοχές συνήθως τρέφεται το βράδυ µε µονοκύτταρα και πολυκύτταρα φύκη και διάφορα µέρη του φυτού Posidonia. Δ. Συμπεριφορά Η µελέτη των προτύπων κίνησης και δραστηριοποίησης του είναι µεγάλου ενδιαφέροντος καθώς προσφέρει ενδείξεις της νευρικής του λειτουργίας και συµπεριφοράς. Ο αχινός αυτός µετακινείται καθηµερινά από τα ενδιαιτήματα του προς τις περιοχές που τρέφεται. Στο µέγιστο της δραστηριότητάς του µπορεί και να διανύσει εώς και 40cm/h, µε τυχαίες κινήσεις, κυρίως κατά τις βραδινές ώρες. Το γεγονός αυτό σηµαίνει οτί µπορεί να αντιλαµβάνεται το φως και να δραστηριοποιείται ανάλογα. Βέβαια την δυνατότητα αυτή έχουν πολλές φορές και οργανισµοί χωρίς νευρικό σύστηµα, όµως ο αχινός µπορεί και συσχετίζει αυτήν την πληροφορία µε άλλες. Για παράδειγµα, µαθαίνει να αντιλαµβάνεται τα επίπεδα σωµατικών υγρών άλλων αχινών που έχουν θυρευθεί στο νερό και να τα συσχετίζει µε την ποσότητα του φωτός. Ετσί

11 επιλέγει να δραστηριοποιείται τα χρονικά διαστήµατα µε την µικρότερη θύρευση. Αυτή είναι µία συµπεριφορά που πιθανότατα εµπλέκει µνήµη. Άλλες τέτοιες παρόµοιες συµπεριφορές είναι η κίνηση προς τα βαθύτερα νερά όταν ο κυµατισµός είναι έντονος ή όταν είναι η θερµοκρασία είναι υψηλή. Ε. Αναπαραγωγή Ο αχινός είναι γονοχωριστικό είδος αν και έχουν παρατηρηθεί περιπτώσεις ερµαφροδιτισµού. Η σεξουαλική ωρίµανση συµβαίνει όταν το άτοµο έχει 13-20mm διάµετρο και κάθε χρόνο συµβαίνει ένας κύκλος γαµετογένεσης αν και µπορούν σε ορισµένες περιπτώσεις να παρατηρηθούν και δύο. Κατά την αναπαραγωγή, αρσενικοί και θηλυκοί αχινοί συγκεντρώνονται και απελευθερώνουν σχεδόν ταυτόχρονα τους γαµέτες τους για να συµβεί εξωτερική γονιµοποίηση. Τα γεγονότα απελευθέρωσης των γαµετών µάλλον πυροδοτούνται από την διάρκεια της µέρας και την θερµοκρασία. Γι αυτόν το λόγο η περίοδος της ωοτοκίας σχετίζεται άµεσαµε την περιοχή διαβίωσης του αχινού. Στην Ελλάδα οι γεννητικά ώριµοι αχινοί συλλέγονται µεταξύ Νοεµβρίου και Μαΐου οπότε και έχουν ώριµες γονάδες που µπορούν να δώσουν γαµέτες. Ζ. Εμβρυογένεση Ζ.1. Ιστορική αναδρομή Το έμβρυο του αχινού έχει ιδιαίτερη θέση στην μελέτη του ρόλου του γονιδιώματος στην εμβρυϊκή ανάπτυξη (Davidson et. al., 1998) από τότε που έγινε από τον Fol η ανακάλυψη της προπυρηνικής σύντηξης στα αυγά του αχινού το Τα πειράματα του Boveri για την αναπτυξιακή πορεία των πολυσπερμικών αυγών και των ανευπλοειδικών βλαστομερών που είχαν απομονωθεί από αυτά, ακολουθώντας τον δρόμο των προγενέστερων επιστημόνων Hertwig και Driesch, απέδειξαν ότι η έκφραση του πλήρους συνόλου των χρωμοσωμάτων απαιτείται για την διαδικασία της εμβρυογένεσης (Boveri, 1902, 1904, 1907 και μετέπειτα αξιολόγηση από Baltzer, 1967 και Sander, 1993). Μια ξεχωριστή πειραματική παράδοση αναπτύχθηκε για πρώτη φορά από τον ίδιο Εικόνα 2: O διάσημος εμβρυολόγος Hostadius

12 επιστήμονα (Boveri 1901), καθορίζοντας τμήματα πρόωρων κυτταρικών γραμμών του έμβρυου του αχινού, και κορυφώθηκε με τη θεαματικό ανασυνδυσμό βλαστομεριδίων στα πειράματα του Hörstadius το 1939 και 1973 (εικονιζόμενος στα δεξιά). Οι ερμηνείες του Hörstadius στερούνται κάθε μορφή γενετικής αιτιότητας και αντ' αυτού ο ίδιος και οι συνεχιστές του ευνόησαν εξηγήσεις που στηρίζονται στην θεωρία των τεμνόμενων «κλίσεων» μηνυματοφόρων μηνυμάτων που οδηγούν είτε σε φυτικοποίηση (vegetalization) είτε σε ζωικοποίηση (animalization) του εμβρύου. Ωστόσο, τα πειράματά του παρέχουν εντυπωσιακές (αν και συνήθως προκαταρκτικές) ενδείξεις για τον ευρύ ρόλο των αλληλεπιδράσεων μεταξύ των βλαστομερών στον καθορισμό της κυτταρικής μοίρας στο έμβρυο του αχινού. Σε πιο πρόσφατες μελέτες, το μητρικό mrna ανακαλύφθηκε σε αυγά αχινού από τους Monroy, Tyler, Gross και άλλους (Davidson 1968, 1986) και οι πρώτες εκτιμήσεις της πολυπλοκότητας της γονιδιακής έκφρασης σε ένα έμβρυο διεξήχθησαν δείχνοντας ότι πολλές χιλιάδες γονίδια αντιπροσωπεύονται σε ένα πληθυσμό μηνυματοφόρων μορίων κατά την Eικόνα 3: O διάσημος εμβρυολόγος Davidson διάρκεια της πρώιμης ανάπτυξης (Davidson 1976, 1986). Ένα μοντέλο βαστομεριδίων στο έμβρυο του αχινού διατυπώθηκε επίσης από τον Davidson (εικονιζόμενος στα αριστερά) για τον καθορισμό της τύχης αυτών επανερμηνεύοντας τα δεδομένα του Hörstadius και προτείνοντας ότι οι αλληλεπιδράσεις για μικρής εμβέλειας σηματοδότηση στο στάδιο των αυλακώσεων προκαλούν την ενεργοποίηση συγκεκριμένων ομάδων χωροειδικών γονιδίων στα διάφορα κύτταρα του εμβρύου που θα αποτελέσουν ιδρυτές μιας ολόκληρης γενεαλογίας (Davidson, 1986 και Wilt, 1987). Σχεδόν τριάντα χρόνια αργότερα, είναι προφανές ότι η άποψη αυτή είναι στην ουσία σωστή. Οι εκσυγχρονισμένες νέες τεχνολογίες έχουν τεράστιο αντίκτυπο στην εμβρυολογία του αχινού, όπως και στη μοριακή βιολογία της πρώιμης ανάπτυξης. Πειραματικά στοιχεία έχουν πλέον συσσωρεφθεί και παρέχουν μια ολοκληρωμένη εικόνα του πώς διαφοροποιούνται τα κύτταρα στο στάδιο των αυλακώσεων στο έμβρυο του αχινού. Πλέον θεωρείται το έμβρυο του αχινού ως το προϊόν μιας διαδικασίας έμμεσης ανάπτυξης. Βέβαια το επίπεδο γενετικού προγραμματισμού που απαιτείται για την εμβρυογένεση διαφέρει καθοριστικά από την διαδικασία με την

13 οποία το σώμα των ενηλίκων σχηματίζεται στο στάδιο της μετεμβρυϊκής ανάπτυξης της προνύμφης. Ζ.2. Λεπτομερής περιγραφή Η γονιµοποιήση στον αχινό είναι εξωτερική και µέσα σε διάστηµα δύο ηµερών απ αυτήν, περνάει από το στάδιο του βλαστιδίου, του γαστριδίου και του πλουτέα (Gilbert, 2010). Στο στάδιο αυτό τελειώνει η εµβρυογένεση και η προνυµφική αυτή µορφή του αχινού αρχίζει να τρέφεται µόνη της. Στην συνέχεια οι πλουτείς αναπτύσονται σε νύµφες και εν τέλει σε νεαρά ενήλικα άτοµα αχινών εντός περίπου τεσσάρων εβδοµάδων. Μία ώρα µετά την γονιµοποίηση ξεκινούν οι πρώτες διαιρέσεις του ζυγωτού. Οι πρώτες επτά διαιρέσεις είναι «στερεοτυπικά» πανομοιότυπες δηλαδή συµβαίνουν ακριβώς µε τον ίδιο τρόπο σε όλα τα άτοµα του είδους. Συγκεκριμένα, Η πρώτη και η δεύτερη διαίρεση γίνονται µε µεσηµβρινή κατεύθυνση από τον ζωικό προς τον φυτικό πόλο και το επίπεδο της µίας είναι κάθετο στο επίπεδο της άλλης. Η τρίτη διαίρεση είναι ισηµερινή, κάθετη προς τις άλλες δύο, και είναι αυτή που διαχωρίζει το ζωϊκό από το φυτικό ηµισφαίριο. Κατά την τέταρτη διαίρεση, τα κύτταρα του ζωικού πόλου διαιρούνται µεσηµβρινά και σχηµατίζουν οκτώ ίδια κύτταρα, τα µεσοµερή. Αντίθετα τα τέσσερα κύτταρα του φυτικού πόλου υπόκειται σε άνιση ισηµερινή διαίρεση, από την οποία προκύπτουν τέσσερα µεγάλα κύτταρα, τα µακροµερή και τέσσερα µικρά, τα µικροµερή. Στην πέντη διαίρεση, τα µεσοµερή διαιρούνται ισηµερινώς και δίνουν δύο ζώνες οκτώ κυττάρων, την an1 και την an2, τα µακροµερή διαιρούνται µεσηµβρινά παράγοντας οκτώ κύτταρα, ενώ τα µικροµερή δεν διαιρούνται σε αυτήν την φάση (άρα το έµβρυο έχει είκοσι οκτώ και όχι τριάντα δύο κύτταρα). Λίγο αργότερα διαιρούνται άνισα και τα µικροµερή και προκύπτει µία οµάδα τεσσάρων µεγάλων µικροµερών και τεσσάρων µικρών µικροµερών. Τα µικρά µικροµερή θα διαιρεθούν άλλη µία φορά κατά την διάρκεια της εµβρυογένεσης και θα σταµατήσουν έως το στάδιο της νύµφης. Στην έκτη διαίρεση, τα κύτταρα του ζωϊκού ηµισφαιρίου διαιρούνται µεσηµβρινά ενώ τα κύτταρα του φυτικού πόλου ισηµερινά. Και η έβδομη διαίρεση, γίνονται οι διαιρέσεις σε αντίθετο µοτίβο.

14 Eικόνα 4: H εμβρυογένεση του αχινού μέχρι το στάδιο του βλαστιδίου Σε αυτήν την φάση το έµβρυο είναι περίπου εκατό είκοσι κύτταρα τα οποία σχηµατίζουν µία κοίλη σφαίρα, το βλαστίδιο. Η κοιλότητα στο βλαστίδιο που περιέχει ένα παχύρευστο υγρό ονοµάζεται βλαστόκοιλο. Σε αυτό το στάδιο (ίσως και πολύ νωρίτερα, στο στάδιο των εξήντα κυττάρων) η µοίρα των περισσότερων κυττάρων έχει καθοριστεί και έχουν στην εξωτερική πλευρά τους βλεφαρίδες. Τα κύτταρα του φυτικού πόλου επιμηκύνονται και αποκτούν φιαλόμορφο σχήμα σχηµατίζοντας την φυτική πλάκα ενώ τα κύτταρα του ζωικού πόλου συνθέτουν και εκκρίνουν τα ένζυµα εκκόλαψης που καταστρέφουν την µεµβράνη γονιµοποίησης (στάδιο hatching blastula). Απ το σηµείο αυτό, τα έµβρυα ζούν σαν ελεύθεροι κολυµβιτικοί πλακτονικοί οργανισµοί. Όπως ήδη διατυπωθεί, η µοίρα των περισσότερων έχει καθοριστεί. Αυτό πρακτικά σηµαίνει ότι συγκεκριµένα κύτταρα θα οδηγηθούν στην δημιουργία συγκεκριµένων ιστών στην συνέχεια της εµβρυογένεσης, σε όλα τα έµβρυα και µε καθορισµένο τρόπο. Πιο συγκεκριμένα,

15 Εικόνα 5: Oι κυτταρικές γραμμές στο πρώιμο έμβρυο του αχινού H περιοχή των µικρών µικροµερών: Τα τέσσερα μικρά μικρομερίδια προκύπτουν κατά την άνιση πέμπτη αυλάκωση και θα διαιρεθούν μία ακόμη φορά κατά την εμβρυογένεση παράγοντας οχτώ απογόνους. Αυτά τα οκτώ προγονικά κύτταρα θα δώσουν σε επόµενα αναπτυξιακά στάδια το 40% των κυττάρων των κοιλωµατικών σάκων που έν τέλει θα αποτελέσουν µεγάλο µέρος του ενήλικου ζώου. Το επίπεδο της εξειδίκευσης τους δεν είναι γνωστό καθώς πρίν δημιουργηθούν οι κοιλωµατικοί σάκοι δεν έχουν βρεθεί γονίδια τα οποία να εκφράζονται συγκεκριµένα σε αυτά τα κύτταρα. Το ορθότερο είναι να θεωρηθούν ως πρωίµως διαχωρισµένα µεσοδερµικά κύτταρα, των οποίων ο µετεµβρυϊκός ρόλος είναι να σχηµατίσουν µεσοδερµικά στοιχεία του µελλοντικού ενήλικου σώµατος (Davidson et. al., 1998). Η περιοχή των σκελετογόνων κυττάρων ή µεγάλων µικροµέρων ή πρωτογενών µεσεγχυµατικών κυττάρων (PMCs): Τα κύτταρα αυτά που προκύπτουν από την πέμπτη διαίρεση είναι αυτονόµως εξειδικευµένα/καθορισµένα και θα δώσουν την σκελετογόνο κυτταρική γραµµή. Όλοι οι απόγονοι των PMCs εκτελούν σκελετογόνο δράση κατά την εµβρυογένεση, εκκρίνοντας πρωτεΐνες που συσσωρεύουν Cα +2 για την δημιουργία του σκελετού (Gilbert, 2010.). Η veg2 περιοχή: Η ζώνη αυτή έχει κύτταρα οι απόγονοι των οποίων θα δημιουργήσουν τμημήματα τριών διαφορετικών δοµών-στιβάδων. Από την περιοχή αυτή θα προκύψουν ενδοδερμικά κύτταρα που συνεισφέρουν στο σχηματισμό του πρόσθιου και μισού μέσου εντέρου. Επίσης θα προκύψουν τα δευτερογενή μεσεγχυματικά, μη σκελετογόνα κύτταρα (SMCs) από τα οποία θα σχηματιστούν τα χρωμοφόρα κύτταρα, κύτταρα του βλαστόκοιλου, μυϊκές ίνες του οισοφάγου καθώς και προγονικά κύτταρα του ενήλικου ατόμου (Angerer et. al., 2000).Τα veg2 κύτταρα είναι και αυτά

16 που θα σχηµατίσουν την φυτική πλάκα που εκκινεί την διαδικασία της εγκόλπωσης, για την πραγματοποίηση της γαστριδίωσης ενώ από τα SMCs εξαρτάται η επιτυχής ολοκλήρωση της διαδικασίας (Davidson et al., 1998). Εικόνα 6: Oι πρόγονοι των κυττάρων και η πορεία τους προς την διαφοροποίηση H περιοχή της φυτικής πλάκας: Αυτή η πρώιμα σχηματιζόμενη περιοχή προέρχεται από τα οχτώ βλαστομερίδια της περιοχής νeg2, που σχηματίζουν μία μορφή σαν δαχτυλίδι. Κατά το τέλος του σταδίου του βλαστιδίου τα κύτταρα αυτά σχηματίζουν τη φυτική πλάκα από όπου ξεκινά η γαστριδίωση. Ωστόσο, πρόκειται για μία προσωρινή περιοχή για το έμβρυο. Κατά το τέλος του σταδίου του βλαστιδίου εμφανίζεται στο κέντρο της φυτικής πλάκας μία μεσοδερμική περιοχή από όπου θα προκύψουν τα διαφοροποιημένα μεσοδερμικά κύτταρα κατά το στάδιο του γαστριδίου. Από την περιφερική περιοχή της φυτικής πλάκας θα προκύψουν ενδοδερμικά κύτταρα τα οποία θα δώσουν γένεση στο πρόσθιο και το μισό μέσο έντερο (Davidson et. al., 1998). H veg1 περιοχή: Όπως η veg2 έτσι και η veg1 περιοχή δίνει γένεση σε κύτταρα διαφόρων βλαστικών δερμάτων. Συγκεκριμένα, δίνει γένεση τόσο σε ενδόδερμα (οπίσθια και µέση περιοχή του εντερικού ενδοδέρµατος) όσο και στο στοματικό και αντιστοματικό εξώδερμα (Davidson et. al. 1998, Angerer et. al. 2000, Gilbert 2010). Η περιοχή του αντιστοµατικού εξωδέρµατος: Τα κύτταρα που θα δώσουν γένεση στο αντιστοµατικό εξώδερµα βρίσκονται στην µία πλευρά του

17 ραχιαιοκοιλιακού άξονα του εµβρύου. Όλοι οι απόγονοι αυτών των κυττάρων θα δώσουν ένα πλακώδες επιθήλιο που θα αποτελέσει όλο το τοίχωµα του ώριµου εµβρύου και της νύµφης εκτός των περιοχών της στοµατικής περιοχής και της βλεφαριδωτής ζώνης (Davidson et. al. (Development, 1998). Η περιοχή του στοµατικού εξωδέρµατος: Η περιοχή του στοµατικού εξωδέρµατος είναι ιδιαίτερου ενδιαφέροντος λόγω της πολυπλοκότητας των κυτταρικών σειρών και των ιστών που θα δώσει. Σε αντίθεση µε το αντιστοµατικό εξώδερµα που δίνει γένεση µόνο στο τοιχωµατικό επιθήλιο, το στοµατικό εξώδερµα θα δώσει ποικίλους λειτουργικά ιστούς. Αυτοί είναι οι ιστοί του στόµατος, το εξειδικευµένο επιθήλιο της στοµατικής περιοχής (stomodaeum) και οι νευρογενείς περιοχές. (Davidson et. al., 1998). Η περιοχή της βλεφαριδωτής ζώνης: Σχηματίζεται από την κυτταρική σειρά Ν1 και είναι ουσιαστικά Εικόνα 7: Οι πρώιμα διαφοροποιημένες περιοχές στο έμβρυο του αχινού μια λωρίδα εξωδερμικών κυττάρων μεταξύ στοματικού και αντιστοματικού εξωδέρματος, που στην μετέπειτα ανάπτυξη περιέχει πολλών ειδών νευρώνες.

18 Η. Νευρογένεση Η.1. Οι νευρογενείς περιοχές και η καθιέρωση τους Οι νευρογενείς περιοχές στο έµβρυο του αχινού είναι αποτέλεσµα της διαφοροποίησης και εξειδίκευσης προγονικών κυττάρων του εξωδέρµατος. Οι πιο σηµαντικές νευρογενείς περιοχές στο έµβρυο του αχινού, στις οποίες εντοπίζονται αργότερα διάφοροι τύποι νευρικών κυττάρων είναι: το εµπρόσθιο νευροεξώδερµα (ΑΝΕ) και το εξώδερμα της βλεφαριδωτής ζώνης (CBE). Στην καθιέρωση και εξειδίκευση αυτών των περιοχών σε συγκεκριµένες µόνο θέσεις του εµβρύου παίζουν σηµαντικό ρόλο πληθώρα σηµατοδοτικών µονοπατιών αλλά και µητρικοί παράγοντες καθορισµού. Οι δύο σηµαντικότερες διαδικασίες που επηρεάζουν και οριοθετούν τις νευρογενείς περιοχές είναι η καθιέρωση του εµπροσθοπίσθιου και του ραχιαικοιλιακού άξονα του εµβρύου. Κατά την εξέλιξη αυτών των διαδικασιών, η ρυθµιστική κατάσταση που είναι υπεύθυνη για την νευρογένεση περιορίζεται σε συγκεκριµένες περιοχές του εξωδέρµατος που αργότερα µπορεί να δώσουν νευρικό ιστό. Η.2. Νευρικός ιστός Φαίνεται το έµβρυο να ξεκινά με δύο ευρέως αλληλεπικαλυπτόµενες ρυθµιστικές περιοχές µε νευρογενές δυναµικό (του ΑΝΕ και τoυ CBE), κάθε µία απ τις οποίες εν συνεχεία περιορίζεται µέσω διαδοχικών σηµάτων. Η προστασία από αυτά τα σήµατα φαίνεται να είναι ο κοινός βασικός µηχανισµός που οδηγεί σε περιορισµένα και µε ακρίβεια τοποθετηµένα νευροεπιθήλια. Μέσα στο ΑΝΕ και το CBE σχηµατίζονται τα νευρικά κύτταρα. Το ΑΝΕ χωρίζεται σε δύο µέρη, έναν κεντρικό δισκό που καλείται ζωική πλάκα (animal plate) και µία οµάδα κύτταρων που τον περιβάλει, και ο σχηµατισµός νευρώνων εντός αυτού ελέγχεται κυρίως από τα γονίδια Six3 και FoxQ2. Τα πρώτα νευρικά κύτταρα που εµφανίζονται στο ΑΝΕ είναι σεροτονεργικοί νευρώνες που εντοπίζονται κύριως στην ραχιαία πλευρά του, λόγω της αναστολής του σχηµατισµού στην κοιλιακή από το Nodal. Αργότερα εµφανίζονται και µη σεροτονεργικοί νευρώνες γύρω από το animal plate. Αντίστοιχα στο CBE, κυρίως µέσω ελέγχου από τα Delta/Notch µονοπάτια, προκύπτουν σαράντα με πενήντα νευρικά κύτταρα µε διαπλεκόµενους άξονες (Angerer et. al., 2011).

19 Η.2.α. Εμπρόσθιο νευροεξώδερμα (ΑΝΕ) Η πρώτη διαδικασία που λαµβάνει χώρα είναι ο περιορισµός της νευρογενούς ρυθµιστικής κατάστασης σε µία µικρή περιοχή του εξωδέρµατος στον ζωικό πόλο του εµβρύου. Η περιοχή αυτή είναι που θα δώσει γένεση στο ANE και ο καθορισµός της είναι κυρίως αποτέλεσµα διαδικασίων που συµβαίνουν κατά την καθιέρωση του εµπροσθοπίσθιου άξονα. Στον αχινό ο καθορισµός του νευροεξωδέρµατος στην κατεύθυνση του εµπροσθοπίσθιου άξονα είναι εύκολο να µελετηθεί γιατί συµβαίνει ανεξάρτητα και νωρίτερα από τον αντίστοιχο στην κατεύθυνση του ραχιαιοκοιλιακού άξονα (Range et. al., 2011). Στο πρώιµο έµβρυο του αχινού, υπάρχει µία πανταχού παρούσα ρυθµιστική κατάσταση παρόµοια µε του ΑΝΕ που δύναται να προωθήσει την νευρογένεση σε όλο το έµβρυο. Μάλιστα στο στάδιο των τριάντα δύο κυττάρων, σχεδόν όλο το εµπρόσθιο µέρος του εµβρύου εκφράζει γονίδια ειδικά για την εξειδίκευση του ΑΝΕ, όπως το Six3 και το FoxQ2 Πιο συγκεκριµένα, το πρώτο βήµα στον περιορισµό του ANE στην εµπρόσθια περιοχή είναι η καταστολη του στο οπίσθιο µέρος του εµβρύου. Αυτό συµβαίνει πολύ νωρίς, σχεδόν από το στάδιο των δέκα έξι κυττάρων, όπου πραγµατοποιείται ταχεία καταστολή των ρυθµιστικών γονιδίων του ΑΝΕ από την Wnt/βcatenin σηµατοδότηση. Η Wnt/β-catenin σηµατοδότηση εκκινεί πολύ νωρίς από κύτταρα του φυτικού πόλου και δηµιουργεί ένα κύµα προς το εµπρόσθιο τµήµα του εµβρύου, αναστέλλοντας την Εικόνα 8: Η εξαρτώμενη από την Wnt σηματοδότηση καθιέρωση του εμπροσθοπίσθιου άξονα

20 εξειδίκευση προς ΑΝΕ των οπίσθιων βλαστοµεριδίων. Ουσιαστικά, στο οπίσθιο ήμισυ του εμβρύου δημιουργεί μια αρνητική ρυθμιστική κατάσταση που αποτρέπει την συσσώρευση των παραγόντων του ΑΝΕ, είτε αναστέλλοντας άμεσα την μεταγραφή τους είτε αναστέλλοντας έμμεσα τους πανταχού εκφραζόμενους μητρικούς ενεργοποιητές τους. Σε δεύτερη φάση, κύτταρα του οπίσθιου πόλου του εµβρύου στα οποία κατεστάλλει η δυναμική κατάσταση του ΑΝΕ, από την σηµατοδότηση Wnt/β-catenin, ξεκινούν να εκφράζουν και να εκκρίνουν τα προσδέµατα Wnt1 και Wnt8 προς τις εµπρόσθιες περιοχές (η αρχή της έκφρασης είναι περίπου στο στάδιο των εξήντα κυττάρων). Τα δύο αυτά προσδέµατα είναι αµφότερα µέλη Wnt σηµατοδοτικών µονοπατιών. Τα Wnt1 και Wnt8 προσδένονται σε υποδοχείς Fzl5/8 και πιθανώς µέσω του µονοπατιού της JNK κινάσης, σηµατοδοτούν µε στόχο την αναστολή/µειορύθµιση της ΑΝΕ ρυθµιστικής κατάστασης στο οπίσθιο µέρος του εξωδέρµατος. Έτσι το ΑΝΕ περιορίζεται ακόµα περισσότερο προς τα εµπρός. Πάραλληλα µε το Fzl5/8, λειτουργεί και ένα άλλο Wnt σηµατοδοτικό µονοπάτι, το Fzl1/2/7. Αυτό ενεργοποιείται από άλλα Wnt σήµατα και µεταδίδει το σήµα µέσω του µονοπατιού του Ca 2+ στο οποίο σηµαντικό ρόλο παίζει η κινάση PKC. Σε αντίθεση όµως µε το Fzl5/8/JNK, η σηµατοδότηση µέσω του Fzl1/2/7 είναι απαραίτητη για την διατήρηση και καθιέρωση της πρώιµης ρυθµιστικής κατάστασης προς εξειδίκευση του νευροεξωδέρµατος. Πιο συγκεκριµένα, η σηµατοδότηση Fzl1/2/7 δεν αποτελεί άµεσο ρυθµιστή της έκφρασης γονιδίων για την εξειδίκευση του ΑΝΕ, αλλά έµµεσα συµµετέχει σ αυτήν, ανταγωνιζόµενη τον Wnt εξαρτώµενο µηχανισµό περιορισµού του ΑΝΕ. Η Fzl1/2/7 σηµατοδότηση καταστέλλει τον Fzl5/8 εξαρτώµενο περιορισµό του ΑΝΕ άµεσα, µέσω της PKC κινάσης, και έµµεσα, µέσω καταστολής του Wnt/β-catenin σηµατοδοτικού µονοπατιού. Σε τελευταίο βήµα η Wnt σηµατοδότηση µέσω του Fzl5/8 υποδοχέα ενεργοποιεί στα εµπρόσθια κύτταρα του εξωδέρµατος την έκφραση του Dkk1. Ο Dkk1 είναι ένας εκκρινόµενος ανταγωνιστής των Wnt προσδεµάτων ο οποίος µπορεί να µπλοκάρει τον Wnt1/Fzl5/8-JNK εξαρτώµενο περιορισµό του ΑΝΕ. Εποµένως, η σηµατοδότηση Fzl5/8 αυτοπεριορίζεται στα όρια αυτών των πρόσθιων κυττάρων µέσω αυτού του αρνητικού επανατροφοδοτικού µηχανισµού. Τελικα, περίπου στο στάδιο του µεσεγχυµατικού βλαστιδίου ο περιορισµός του ΑΝΕ έχει ολοκληρωθεί και αποτελεί µία ξεχωριστή ρυθµιστικά περιοχή στο εµπρόσθιο άκρο του εµβρύου µε καλά καθορισµένα όρια.

21 Ζ.2.β. Εξώδερμα βλεφαριδωτής ζώνης (CBE) Μετά τον περιορισµό του ΑΝΕ, το µεγαλύτερο µέρος του υπόλοιπου εμβρύου διατηρεί µια ρυθµιστική κατάσταση που µπορεί να υποστηρίξει την ανάπτυξη «οπίσθιου» νευροεξωδέρµατος. Όπως και στην περίπτωση του ΑΝΕ, η περιοχή αυτή περιορίζεται τελικά σε µία στενή λωρίδα του εξωδέρµατος, πλάτους περίπου τεσσάρων κυττάρων. Ο περιορισµός σε αυτήν την περίπτωση είναι αποτέλεσµα των διαδικασιών που συµβαίνουν κατά τον σχηµατισµό του ραχιαιοκοιλιακού ή στοµατικούαντιστοµατικού άξονα του εµβρύου (Angerer et. al., 2011). To απαραίτητο στοιχείο για τον σχηµατισµό αυτού του άξονα είναι η ζυγωτική έκφραση του Nodal, ενός εκκρινόµενου σηµατοδοτικού µορίου της οικογένειας TGF-β. Το Nodal εκφράζεται στην µελλοντική στοµατική πλευρά του εµβρύου και η έκφραση του ενεργοποιείται από την διαβάθµιση οξειδοαναγωγής οφειλόµενη στην κλίση της κατανοµής µιτοχονδρίων µεταξύ στοµατικού και αντιστοµατικού εξωδέρµατος. Λόγω αυτής της διαβάθµισης, η ευαίσθητη στην οξειδοαναγωγή κινάση p38 βρίσκεται φωσφορυλιωµένη στην στοµατική πλευρά του εµβρύου όπου ενεργοποιεί το Nodal συνεργατικά µε άλλους παντοχού παρόντες µητρικούς παράγοντες, όπως η Univin και o SoxB1. To Nodal έχει άλλο ένα σηµείο ελέγχου στην έκφραση του, στο οποίο οφείλεται ο µεταγενέστερος καθορισµός του ραχιαικοιλιακού άξονα σε σχέση µε τον προσθοπίσθιο. Αυτό είναι το FoxQ2, ένα ειδικό γονίδιο του ΑΝΕ που αρχικά εντοπίζεται σχεδόν σε όλο το εξώδερµα και καταστέλλει την έκφραση του Nodal. Όταν όµως το ΑΝΕ, µέσω των προαναφερθέντων µηχανισµών, περιορισθεί στο ακραίο εµπρόσθιο τµήµα του εξωδέρµατος, η επιρροή του FoxQ2 πάνω στο Nodal αναστέλλεται και αυτό είναι πλέον ελεύθερο να εκφραστεί στο υπόλοιπο εξώδερµα. Η έκφραση και έκκριση του Nodal στο κοιλιακό εξώδερµα ενεργοποιεί τόσο τον ευατό του, όσο και τα γονίδια BMP2/4 (ο οποίο ενεργοποιεί το δίκτυο για την διαφοροποίηση του πλευρικoύ εξωδέρματος (Angerer et. al., 2000)), Chordin, Lefty και Gsc, όλα εξ αυτών πολύ σηµαντικά γονίδια για την καθιέρωση του ραχιαιοκοιλιακού άξονα και τoυ CBE.

22 Η ακριβής τοποθέτηση της βλεφαριδωτής ζώνης είναι αποτέλεσµα κατάλληλων αλληλεπιδράσεων µεταξύ των προϊόντων των παραπάνω γονιδίων. Ως µέλη της οικογένειας TGF-β, τα Nodal, BMP2/4, Chordin, Lefty διαχέονται από την κοιλιακή πλευρά όπου αρχικά εκκρίνονται προς την ραχιαία. Κάθε ένα από αυτά έχει διαφορετική συγκέντρωση και απόσταση διάχυσης. Το Nodal εκκινεί στα κύτταρα που θα δώσουν στοµατικό εξώδερµα, ενώ το BMP2/4 εντοπίζεται στο αντιστοµατικό εξώδερµα. Το Nodal περιορίζεται στην περιοχή που θα αποτελέσει το µελλοντικό στοµατικό εξώδερµα από την δράση του Lefty, το οποίο διαχέεται πιο ισχυρά σε µεγαλύτερη απόσταση και µπλοκάρει την Εικόνα 9: H καθιέρωση του ραχιοκοιλιακού άξονα περιορίζεται στην περιοχή του µελλοντικού ραχιαίου εξωδέρµατος καθώς κοιλιακά µπλοκάρεται από την Chordin. σηµατοδότηση του Nodal. Αντίστοιχα, το BMP2/4 Η περιοχή µεταξύ του στοµατικού εξωδέρµατος που δρά το Nodal περιοριζόµενο από το Lefty και του αντιστοµατικού που δρα το BMP2/4 περιοριζόµενο από την Chordin, δεν οδηγείται σε επιδερµική Εικόνα 10: Oι νευρογενείς περιοχές στο έμβρυο του αχινού

23 διαφοροποίηση. Έτσι διατηρείται η οπίσθια νευροεξωδερµική ρυθµιστική κατάσταση από την οποία αναδύεται η βλεφαριδωτή ζώνη έως το στάδιο του µεσεχγυµατικού βλαστιδίου. Θ. Ρυθµιστικό δίκτυο γονιδίων (GRN) Με αφορμή την μελέτη της γονιδιακής ρύθμισης της νευρογένεσης στον αχινό, είναι θεμητό να γίνει μια αναφορά γενικότερα στα ρυθμιστικά γονιδιακά δίκτυα και στον τρόπο λειτουργίας τους. Στην φύση λοιπόν υπάρχει κληρονομικό γενετικό πρόγραμμα για την ανάπτυξη, ουσιαστικά δηλαδή υπάρχει η μοναδική και αξιοσημείωτη ιδιότητα της έμβιας ύλης να καθορίζει τους πολυκύτταρους οργανισμούς σε γενικές γραμμές αλλά και κάθε είδος ιδιαίτερα (Oliveri et al, 2004). Ουσιαστικά, αυτό το πρόγραμμα είναι κωδικοποιημένο ως ένα τεράστιο δίκτυο λειτουργικά αλληλένδετων cis-ρυθμιστικών στοιχείων του DNA. Κάθε cis-ρυθμιστικό στοιχείο στο γονιδίωμα εκτελεί μια δεδομένη, συνήθως μοναδική, λειτουργία και τα περισσότερα γονίδια μπορούν να ελέγχονται από δέκα ή περισσότερα διακριτά ρυθμιστικά στοιχεία. Τυπικά ένα cis-ρυθμιστικό στοιχείο έχει μήκος μερικών εκατοντάδων ζευγών βάσεων, και περιλαμβάνει μια συστάδα ειδικών θέσεων-στόχων που αναγνωρίζονται από ρυθμιστικές πρωτεΐνες που προσδένονται στο DNA (δηλαδή παράγοντες μεταγραφής). Κατά μέσο όρο, τέσσερις έως οκτώ διαφορετικοί παράγοντες μεταγραφής μπορεί να αλληλεπιδράσουν με κάθε ρυθμιστικό στοιχείο, για μερικούς από τους οποίους υπάρχουν συχνά πολλαπλές θέσεις στόχοι. Είναι επίσης σαφές ότι τα cis-ρυθμιστικά στοιχεία είναι σαφώς και απότομα οριοθετημένα : η απόδειξη για αυτό προέρχεται από συγκρίσεις μεταξύ ειδών για τις εν λόγω ακολουθίες, οι οποίες αποκαλύπτουν εντυπωσιακά απότομες μεταβάσεις ανάμεσα στις συντηρημένες και μη συντηρημένες γενομικές αλληλουχίες στα σύνορα των συστάδων των στοιχείων και από το γεγονός ότι κάποιος μπορεί να χρησιμοποιήσει την απαίτηση για ομαδοποίηση των θέσεων στόχων για τον εντοπισμό λειτουργικών cis-ρυθμιστικών στοιχείων. Σε κάθε δεδομένο χωρικό ή χρονικό σημείο στον αναπτυσσόμενο οργανισμό, δηλαδή σε κάθε δεδομένο κύτταρο σε κάθε στάδιο της ανάπτυξης, η λειτουργική απόδοση της γονιδιωματικής ρυθμιστικής μηχανής εξαρτάται κυρίως από αυτό που ονομάζεται «trans-ρυθμιστική κατάσταση». Αυτό ορίζεται ως το σύνολο των παραγόντων μεταγραφής σε συγκεκριμένες συγκεντρώσεις στον πυρήνα σε μια δεδομένη χρονική στιγμή. Αργότερα στην ανάπτυξη η σχέση μεταξύ της γονιδιωματικής συσκευής και της τρέχουσας ρυθμιστικής κατάστασης είναι μερικές φορές πιο περίπλοκη από ό,τι στην αρχή, επειδή οι αποκρίσεις της ρυθμιστικής γονιδιακής

24 συσκευής μπορεί να διευκολύνονται ή τοπικά να μπλοκάρονται, ως αποτέλεσμα των διαμορφώσεων της χρωματίνης που προκύπτουν ως απάντηση σε προηγούμενες transρυθμιστικές καταστάσεις. Αλλά στις αρχές της ανάπτυξης, αυτά τα είδη των ρυθμιστικών αλληλεπιδράσεων δεν φαίνεται να παρουσιάζουν σημαντικά και ιδιαίτερα χαρακτηριστικά. Από την άλλη πλευρά, υπάρχουν πολύ άμεσες απόδειξεις ότι στην πρώιμη ανάπτυξη η μεταγραφική απόκριση εξαρτάται άμεσα μόνο από την τρέχουσα trans-ρυθμιστική κατάσταση. Έτσι, για παράδειγμα, στα έμβρυα του αχινού, κατάλληλα constracts εισάγoνται σε σχεδόν οποιαδήποτε θέση στο γονιδίωμα και αρκούν για να δημιουργηθεί το σωστό εμβρυϊκό πρότυπο γονιδιακής έκφρασης (βέβαια εάν περιέχουν τα σχετικά cis-ρυθμιστικές στοιχεία). Αλλά, η δραστηριότητα τους σε οποιοδήποτε αναπτυξιακό σημείο εξαρτάται μόνο από την παρουσία επαρκών επιπέδων ενεργοποιητικών ή κατασταλτικών παραγόντων μεταγραφής, είτε σε φυσιολογικές συνθήκες ή σε περίπτωση γονιδιακής διατάραξης π.χ. με morpholinos. Όλα τα αναπτυξιακά γεγονότα υπό τον ζυγωτικό έλεγχο (δηλαδή όλα τα γεγονότα μετά τα πολύ πρώιμα στάδια) προκύπτουν από την έκφραση των γονιδίων στους πυρήνες του εμβρύου. Ως εκ τούτου, δεδομένου ότι η trans-ρυθμιστική κατάσταση επηρεάζεται συγκεκριμένα από την έκφραση των γονιδίων που κωδικοποιούν μεταγραφικούς παράγοντες, για να καταστεί δυνατή η αιτιακή εξήγηση της πρώιμης ανάπτυξης, πρέπει να γίνει κατανοητή η δυναμική στον χρόνο και η συγκεκριμένη στο χώρο έκφραση συγκεκριμένων γονιδίων. Σε επίπεδο συστήματος απαιτούνται τουλάχιστον δεκάδες ρυθμιστικά γονίδια για να παράγουν μια συγκεκριμένη αναπτυξιακή ρυθμιστική κατάσταση, κάθε ένα γονίδιο από τα οποία ελέγχεται αποκλειστικά από τα cis-ρυθμιστικά στοιχεία του. Επειδή οι εισροές (inputs) σε αυτά τα cis-ρυθμιστικά στοιχεία είναι πάντα πολλαπλές, όπως και οι μεταγενέστεροι στόχοι-γονιδία που ελέγχουν (οutputs), η αναπόφευκτη συνέπεια είναι ότι η ρυθμιστική κατάσταση παράγεται από μεγάλα δίκτυα γονιδιακών ρυθμιστικών αλληλεπιδράσεων. Πιο συγκεκριµένα τα στοιχεία που αποτελούν ένα υποδίκτυο είναι κάποια ρυθµιστικά γονίδια µαζί µε τις ρυθµιστικές περιοχές που τα ελέγχουν οι οποίες με την σειρά τους αποτελούν στοιχεία απόκρισης για διάφορους µεταγραφικούς παράγοντες που εκφράζονται από άλλα γονίδια. Όµως ένας µεταγραφικός παράγοντας δεν ανήκει αποκλειστικά σε ένα µόνο υποδίκτυο όπως επίσης μπορεί ταυτόχρονα να ελέγχει και να ελέγχεται από άλλα γονίδια. Έτσι τα αναπτυξιακά GRN παρουσιάζουν µία συνολική αρχιτεκτονική επικαλυπτόµενων υποδικτύων και διαπλεκόμενων γονιδίων. Βέβαια λόγω αυτού του πολυ-παραγοντικού χαρακτήρα των υποδικτύων, κάθε ένα από αυτά έχει διαφορετική αρχιτεκτονική, εξειδικευµένη για την εργασία που επιτελεί.

25 Αν και τα αναπτυξιακά ρυθµιστικά δίκτυα γονιδίων (GRN) µοιάζουν περίπλοκα, στην πραγµατικότητα προσφέρουν μεγάλο όγκο πληροφορίας με έναν άµεσο και απλά οργανωµένo σχηματικά τρόπο συνδέοντας διάφορα φαινόµενα της ανάπτυξης µε το λεπτοµερές γονιδιακό πρόγραµµα που τα ελέγχει. Τέτοια GRN περιλαµβάνουν πληθώρα γονιδίων που είναι οργανωµένα σε πολλά υποδίκτυα, κάθε ένα από τα οποία ελέγχει µια πολύ συγκεκριµένη αναπτυξιακή διαδικασία όπως η χρονοχωροειδική εξειδίκευση οµάδων γονιδίων, ο έλεγχος σηµατοδοτικών µονοπατιών, η κυτταρική διαφοροποίηση και εξειδίκευση κ.α. Είναι προφανές οτί υπάρχει µεγάλος αριθµός ρυθµιστικών έργων, τα οποία διαφέρουν µεταξύ τους, και ότι το καθένα απαιτεί διαφορετικό υποδίκτυο. Κάθε υποδίκτυο έχει εξελιχθεί αυτόνοµα και σε διαφορετικό βαθµό από τα υπόλοιπα µέσα στον εξελικτικό χρόνο. Ως αποτέλεσµα τα GRN που ελέγχουν την ανάπτυξη των οργανισµών, είναι οργανωµένα µε συγκεκριµένη αρχιτεκτονική που έχει διατηρηθεί ανάµεσα ακόμη και σε εξελικτικά απομακρυσμένα είδη. Ένα ρυθμιστικό δίκτυο γονιδίων (GRN) επιτελεί μια λειτουργία, με την οποία η στατική γονιδιωματική ρυθμιστική ακολουθία μπορεί να μετατραπεί εννοιολογικά στη δυναμική διαδικασία της ανάπτυξης. Έτσι έως ότου αναπτυξιακά γεγονότα συσχετιστούν με σαφή τρόπο σε ένα GRN, παραμένουν εξωπραγματικά φαινόμενα που δεν συνδέονται με το κύκλωμα ελέγχου. Το καλύτερο παράδειγμα είναι η σηματοδότηση: μεσοκυττάρια γεγονότα σηματοδότησης παρέχουν συγκεκριμένες χωρικές εισροές σε όλα τα αναπτυξιακά GRNs, αλλά ο δεσμός μεταξύ του γεγονότος της σηματοδότησης και των συνεπειών του, θα παραμένει πάντα ένα μαύρο κουτί μέχρι να καθοριστεί η αρχική αφορμή της σηματοδότησης στο πλαίσιο του GRN, να διαφανούν συγκεκριμένες επιπτώσεις της στο GRN και να επιτευχθεί ο πολλαπλασιασμός αυτών των επιδράσεων της έτσι ώστε να μελετηθούν διεξοδικά. Μέσα σε ένα υποδίκτυο, και κατ επέκταση σε ένα GRN, όπως είναι αυτό της νευρογένεσης στο οποίο και επιχειρείται να εισαχθεί ο Coup-TF, υπάρχουν και απεικονίζονται πολλοί τύποι αλληλεπιδράσεων µεταξύ των γονιδίων. Στην φύση αυτών των αλληλεπιδράσεων στηρίζεται η χωρική και χρονική εξειδίκευση της γονιδιακής έκφρασης που θα οδηγήσει σε κάποιο συγκεκριµένο αναπτυξιακό αποτέλεσµα. Οι αλληλεπιδράσεις αυτές είναι: Η θετική ρυθµιστική ανατροφοδότηση µεταξύ δύο γονιδίων του δικτύου που λειτουργεί µε στόχο να «κλειδώσει» µία ρυθµιστική κατάσταση. Η ρυθμιστική ανατροφοδότηση (feedback) μπορεί να είναι και αρνητική Η διακυτταρική σηµατοδότηση που συµβάλλει πλειοτροπικά στον καθορισµό ποιας οµάδας κυττάρων θα αποκτίσει µια ρυθµιστική κατάσταση.

26 Η µεταγραφική καταστολή που αποτρέπει συγκεκριµένα αναπτυξιακά προγράµµατα να λειτουργήσουν σε «λανθασµένες» θέσεις. Η ρυθμιστική προσθιοτροφοδότηση (feedforward), Η διασταυρώμενη ρύθμιση (cross-regulatory) και Η διπλή αρνητική ρύθμιση (double negative gates). Οι τρόποι µε τους οποίους χτίζεται ένα ρυθµιστικό δίκτυο και εισάγονται γονίδια σε αυτό παρουσιάζονται στην εικόνα. Aπαραίτητος είναι ο συνδυασμός αναλυτικών τεχνικών όπως οι ακόλουθοι: ταυτόχρονου εντοπισμού της γονιδιακής έκφρασης στον χώρο και τον χρόνο δύο ή περισσότερων γονιδίων (π.χ. με την double FISH), τεχνικών διαταραχής της έκφρασης καθενός γονιδίου (π.χ. με ενέσεις με ΜΑSΟ σε γονιμοποιημένα αυγά) και τεχνικών ανάλυσης της επίδρασης της διαταραχής αυτής στην ποσοτική και χωροειδική έκφραση των υπολοίπων γονιδίων του δικτύου (π.χ. με QPCR και χρωμογόνο WMISH). Εικόνα 11: Σχηματική αναπαράσταση δόμηση ενός GRN

27 Πληροφορίες προερχόμενες από την εμβρυολογία και την μοριακή βιολογία είναι απαραίτητες για το σχεδιασμό της στρατηγικής επιλογής (π.χ. βάσει ομολογίας με συγγενικά είδη) των γονιδίων που θα μελετηθούν, επιλογής της τρόπου γονιδιακής διαταραχής και του αναπτυξιακού σταδίου που πρέπει να χρησιμοποιηθεί. Φαίνεται επίσης ότι η ύπαρξη γονιδίων γνωστής λειτουργίας είναι σηµαντική στην κατασκευή των GRΝ. Ουσιαστικά ο τελικός στόχος όλων των παραπάνω είναι να καθορισθεί η βιολογία και να εξηγηθεί ο μηχανισμός λειτουργίας και ελέγχου των διαρκώς εμπλουτιζόμενων με πληροφορία GRN. Η προσέγγιση που ακολουθείται στην παρούσα εργασία είναι το knockdown του ΡΙCoup-TF µε αντινοηµατικά ολιγονουκλεοτίδια, δηλ. με morpholino (MASOs: Morpholino Αnti-Sense Oligonucleotides) και παρατήρηση -µε βασική τεχνική την QPCR και την χρωμογόνο in situ υβριδοποίηση- της επίδρασης αυτού του γεγονότος στο ποσοτικό και χωροειδικό πρότυπο έκφρασης άλλων γονιδίων ή σε γενικότερες μορφογενετικές διαδικασίες της εµβρυογένεσης. Στην συγκεκριμένη περίπτωση για να βρεθεί η πιθανή σχέση του Coup-TF µε το υποδίκτυο της νευρογένεσης και να ενταχθεί σε αυτό, έπρεπε να επιλεγούν κάποια γνωστά γονίδια και να µελετηθεί η σχέση του µε αυτά. Δηλαδή, έπρεπε να επιλεγούν κάποια ρυθµιστικά γονίδια ή γονίδια σηµαντικών σηµατοδότικών µονοπατιών ή διακυτταρικής επικοινωνίας, τα οποία να κατέχουν ρόλο κλειδί για την πραγµατοποίηση του προγράµµατος της νευρογένεσης και πιο συγκεκριμένα στον σχηµατισµό των νευρικών περιοχών ή την διαφοροποίηση και την εξειδίκευση των κυττάρων αυτών των περιοχών προς νευρικό ιστό. Ι. Γονίδια εξειδικευμένα για την νευρογένεση Ι.1. Ο µεταγραφικός παράγοντας Coup-TF O COUP-TF είναι ένας µεταγραφικός παράγοντας που ανιχνεύθηκε πρώτη φορά στην όρνιθα. Ο ρόλος που του αποδόθηκε είναι η πρόσδεση στον υποκινητή του γονιδίου της ωαλβουµίνης το οποίο και ρυθµίζει θετικά εξού και το όνοµα: Chicken Oalboumin Upper Promoter Transcription Factor (Pastoric et. al. 1986, Wang et. al. 1987, Bagchi et. al. 1987). O COUP-TF είναι απαραίτητος για τη μεταγραφή του γονιδίου της ωαλβουμίνης και σε in vitro πειράματα (Sagami et. al. 1986, Tsai et. al. 1987, Wang et. al. 1989) Ωστόσο, αυτό επιτυγχάνεται όταν ο COUP-TF αλληλεπιδράσει με το μεταγραφικό παράγοντα S300-II ο οποίος δεν προσδένει στο DNA.

28 Μετά την ανακάλυψη του στην όρνιθα, οµόλογα γονίδια του COUP-TF αποµονώθηκαν και κλωνοποιήθηκαν προς µελέτη από διάφορους οργανισµούς, από την Drosophila έως και τον άνθρωπο, μέσα σε αυτούς είναι και ο αχινός. Στον άνθρωπο έχουν βρεθεί αντίστοιχα δύο γονίδια τα οποία κωδικοποιούν τις πρωτείνες COUP-TFI και II. O hcoup-tfi συμβάλλει στην καταστολή της έκφρασης της ερυθροποιητίνης, γονιδίων του ιού της ηπατίτιδας και του HIV καθώς και στην ανάπτυξη των νευραξόνων (Pereira et. al. 2000, Cooney et. al. 1991). Ένα ομόλογο της οικογένειας των γονιδίων COUP-TFs είναι το γονίδιο SpCOUP-TF, που έχει απομονωθεί από το είδος αχινού Strongylocentrotus purpuratus. Το γονίδιο αυτό εμφανίζει μεγάλη ομοιότητα αλληλουχίας με τα γονίδια COUP-TF άλλων ασπόνδυλων και σπονδυλωτών. Έτσι, μεταξύ του ανθρώπινου COUP-TFI και του SpCOUP- TF το 96% των αμινοξέων τους που αντιστοιχεί στην περιοχή πρόσδεσης στο DNA (DBD) είναι κοινό, καθώς και το 92% των αμινοξέων της περιοχής πρόσδεσης της ορμόνης (LBD) (Chan et. al. 1992). Οργανισμός Drosophila Ομόλογα γονίδια του Coup TF seven up (svp) S. purpuratus (sea urchin) SpCoup TF Zebrafish svp 44, svp 46, svp 40 Chicken Mouse Xenopus Rat Hamster Human Coup-TFII Coup-TFI, Coup-TFII xcoup-tfa, xcoup-tfιιβ, xcoup-tfiiia rcoup-tfi hmcoup-tfi hcoup-tfι, hcoup-tfii Πίνακας 1: Τα ομόλογα γονίδια του Coup-TF σε μια ποικιλία οργανισμών Tο cdna του COUP-TF απομονώθηκε από cdna ανθρώπινη βιβλιοθήκη (Wang et. al. 1988, 1989). H αλληλούχισή του απέδειξε ότι πρόκειται για ένα μέλος της

29 υπεροικογένειας των υποδοχέων των στεροειδών/θυρεοειδών ορμονών. Ωστόσο, αντίθετα με αυτούς τους υποδοχείς, για τους COUP-TFs δεν έχει ακόμη βρεθεί κάποιο πρόσδεμα και γι αυτό ονομάζονται ορφανοί. Tο γονίδιο COUP-TF αποτελείται σε όλους τους μέχρι σήμερα μελετημένους οργανισμούς από τρία εξώνια, τα δύο δε εσώνια διακόπτουν την κωδική περιοχή του γονιδίου σε συντηρημένες θέσεις. Ωστόσο, έχει βρεθεί ότι ο αχινός διαφοροποιείται από αυτό το μοντέλο καθώς το γονίδιο αποτελείται από τέσσερα εξώνια και τρία εσώνια. Συγκεκριμένα, έχει βρεθεί ότι το επιπλέον εξώνιο βρίσκεται μεταξύ του πρώτου και δεύτερου εξωνίου και έχει μέγεθος 63nt (Wang et. al. 1988, 1989) και µπορεί να υπόκειται σε εναλλακτικό µάτισµα µε αποκοπή αυτού, παράγοντας δύο ισοµορφές (την µεγάλη και την µικρή). Η πρωτεΐνη του COUP-TF χωρίζεται σε τέσσερις δοµικές/λειτουργικές περιοχές (Ritchie et. al. 1990) που ομοιάζουν με αυτές των υπόλοιπων πυρηνικών υποδοχέων: Την περιοχή Α/Β που αντιστοιχεί στο αµινοτελικό άκρο της πρωτεΐνης. Την περιοχή C, που έχει την χαρακτηριστική δοµή δύο δακτύλων ψευδαργύρου C2C2 και είναι υπεύθυνη για την πρόσδεση στο DNA, αναγνωρίζοντας την ευθεία επανάλληψη GTGTCA-A- AGGTCA. Την περιοχή D που αποτελεί µια συνδετική περιοχή-γέφυρα. Την περιοχή Ε η οποία είναι η περιοχή πρόσδεσης της ορµόνης. Eικόνα 12: H δομή των πυρηνικών υποδοχέων Tο επιπλέον εξώνιο που εντοπίζεται στον αχινό κωδικοποιεί ένα πεπτίδιο μεγέθους 21 αμινοξέων αμέσως μετά την περιοχή πρόσδεσης στο DNA. Συγκεκριμένα με εναλλακτικό μάτισμα των πρώιμων μεταγράφων κωδικοποιούνται δύο πρωτείνες, μία μεγάλη που φέρει το επιπλέον πεπτίδιο και μία μικρή η οποία δεν το περιέχει και ομοιάζει με τις COUP-TF πρωτείνες των άλλων οργανισμών. Το εναλλακτικό αυτό μάτισμα συναντάται σε όλα τα αναπτυξιακά στάδια (φάνηκε στα πειράματα RT-PCR της Διονυσίας Βουκελάτου στο εργαστήριο μας) πρώτη

30 φόρα για το γονίδιο COUP-TF του αχινού και έχει περιγραφεί και για τον οργανισμό C.elegans. H πρωτείνη COUP-TF είναι εξαιρετικά συντηρημένη μεταξύ των οργανισμών. Η 5 μη μεταφραζόμενη περιοχή, καθώς και η περιοχή Α/Β και η περιοχή C της πρωτεΐνης αντιστοιχούν στο πρώτο εξώνιο. Tο δεύτερο και τρίτο εξώνιο στον αχινό, φέρει την πληροφορία για την περιοχή-γέφυρα (D) που βρίσκεται ανάμεσα στην περιοχή πρόσδεσης στο DNA και στην περιοχή πρόσδεσης της ορμόνης (Ε). Tέλος, το τρίτο (τέταρτο στον αχινό) εξώνιο φέρει την πληροφορία για το υπόλοιπο τμήμα της πρωτεΐνης, την περιοχή που προσδένεται το πρόσδεμα δηλ. (Ε) και το καρβοξυτελικό άκρο της πρωτείνης, καθώς και την 3' μη μεταφραζόμενη περιοχή (Ritchie et. al. 1990). O COUP-TF δρα ως μεταγραφικός παράγοντας που επηρεάζει τη μεταγραφή πολλών γονιδίων και τις περισσότερες φορές την καταστέλλει. Bιοχημικές μελέτες αποδεικνύουν ότι οι COUP-TFs βρίσκονται ως διμερή και προσδένονται με μεγάλη συγγένεια στο στοιχείο απόκρισης τους που είναι η ευθεία επανάληψη GTGTCA-A- AGGTCA στο γονίδιο της ωαλβουμίνης. Ωστόσο, έχουν την ικανότητα να προσδένονται και σε άλλες ευθείες επαναλήψεις του προτύπο GGTCA που απέχουν μεταξύ τους από 0 έως και 12 νουκλεοτίδια (Cooney et. al. 1992). Aυτό υποδεικνύει ότι μπορούν να αλλάζουν στερεοδιάταξη ανάλογα με τη μορφή του στοιχείου απόκρισης (Kliewer et. al. 1992). Έχουν περιγραφεί πολλοί τρόποι με τους οποίους η πρωτεΐνη αυτή ασκεί τη δράση της ως καταστολέας αλλά και ως ενεργοποιητής. Α)Kαταστολέας Εικόνα 13: To ενεργοποιητικό σύμπλοκο του Coup-TF με άλλες πρωτεΐνες Ο COUP-TF ομοδιμερίζεται ή ετεροδιμερίζεται κυρίως με τον RXR και προσδένεται στην ευθέως επαναλαμβανόμενη ή παλίνδρομη αλληλουχία AGGTCA. ). Από πειράματα της Iωάννας Πέττα στο εργαστήριο μας για τον αχινό P.lividus φαίνεται ότι τα ετεροδιμερή της μικρής ισομορφής προσδένονται κανονικά στην ρυθμιστική περιοχή, ενώ τα ετεροδιμερή (μεγάλης-μικρής ισομορφής) δεν μπορούν. Μάλιστα όσο

31 αυξάνεται το ποσοστό της μεγάλης ισομορφής, τόσο μειώνεται το ποσοστό της μικρής και άρα το ποσοστό των λειτουργικών διμερών. Aν και πρωτοπεριγράφηκε ως ενεργοποιητής του γονιδίου της ωαλβουμίνης, τις περισσότερες φορές δρα καταστέλλοντας τη μεταγραφή γονιδίων που επάγουν άλλοι πυρηνικοί υποδοχείς ορμονών όπως ο υποδοχέας του ρετινοικού οξέος (RAR), της θυρεοειδούς ορμόνης (TR), της βιταμίνης D (VDR), του περοξισώματος (PPAR) και ο πυρηνικός παράγοντας 4 του ηπατικού κυττάρου (HNF4 ) (Cooney et. al. 1992, Ladias et. al. 1992, Leng et. al. 1996). Έχουν προταθεί τέσσερις μηχανισμοί μέσω των οποίων ασκεί την κατασταλτική του δράση (Park et. al. 2003, Cooney et. al. 1993). Ο COUP-TF ανταγωνίζεται τους άλλους μεταγραφικούς παράγοντες της οικογένειας των υποδοχέων στεροειδών ορμονών για την πρόσδεση στο στοιχείο απόκρισής τους. i) O COUP-TF συναγωνίζεται με τους άλλους υποδοχείς της οικογένειας για τη δημιουργία ετεροδιμερούς με το μεταγραφικό παράγοντα RXR. Έτσι περιορίζει τον ετεροδιμερισμό του RXR με τους άλλους μεταγραφικούς παράγοντες και ως εκ τούτου και την ενεργοποιητική τους δράση. ii) O COUP-TF προσδένοντας στο στοιχείο απόκρισής του καταστέλλει άμεσα τα γονίδια στόχους μέσω άμεσης ή έμμεσης αλληλεπίδρασης με τους γενικούς μεταγραφικούς παράγοντες. Πιθανόν, η καταστολή επιτυγχάνεται μέσω του μηχανισμού απακετυλίωσης των ιστονών. iii) Πραγματοποιεί trans-καταστολή όπου δεν προσδένεται άμεσα στο στοιχείο απόκρισης αλλά παρεμβάλλεται μεταξύ της περιοχής πρόσδεσης της ορμόνης ενός άλλου πυρηνικού ορμονικού υποδοχέα που βρίσκεται προσδεδεμένος στο DNA και των γενικών μεταγραφικών παραγόντων του υποκινητή, αποτρέποντας την ενεργοποίηση γονιδίων-στόχων. B)Eνεργοποιητής O COUP-TF μπορεί να δράσει και ως ενεργοποιητής της μεταγραφής. Έχουν περιγραφεί οι παρακάτω τρόποι μηχανισμοί (Park et. al. 2003). i) Άμεσα προσδένεται στο στοιχείο απόκρισης και ενεργοποιεί τη μεταγραφή. Mε αυτόν τον τρόπο δρα ο COUP-TFII όταν επάγει τη μεταγραφή του γονιδίου CYP7A. ii) Προσδένεται σε ένα ρυθμιστικό στοιχείo και έμμεσα μέσω άλλων μεταγραφικών παραγόντων επηρεάζει τη μεταγραφή των γονιδίωνστόχων (π.χ. PEPCK).

32 iii) iv) Eπάγει τη μεταγραφή μέσω αλληλεπίδρασης αφενός με άλλον μεταγραφικό παράγοντα (όπως τον Sp1) ο οποίος προσδένεται στο στοιχείο απόκρισής του στο DNA, αφετέρου με το γενικό μεταγραφικό παράγοντα TFIIB (π.χ. στο γονίδιο NGFI-Α) (Ing et. al. 1992). H επαγωγή της μεταγραφής των γονιδίων-στόχων συχνά επιτυγχάνεται μέσω άλληλεπίδρασης του COUP-TF με άλλους συνενεργοποιητές. H αλληλεπίδραση πραγματοποιείται στην καρβοξυτελική περιοχή και συγκεκριμένα στην περιοχή πρόσδεσης της ορμόνης της πρωτείνης COUP-TF (Pipaon et. al. 1999). Εικόνα 14: Η ενεργοποιητική δράση του Coup-TF Ο μεταγραφικός παράγοντας SpCOUP-TF εντοπίστηκε σε πυρηνικό εκχύλισμα εμβρύων αχινού Strongylocentrotus purpuratus και φάνηκε ότι σχημάτιζε in vitro συγκεκριμένα συμπλέγματα με ένα στοιχείο απόκρισης ορμονών. Αυτό το στοιχείο βρέθηκε στη ρυθμιστική περιοχή του γονιδίου της ακτίνης CyIIIb και ονομάζεται C1R. Το CyIIIb κωδικοποιεί μια ακτίνη κυτταροσκελετικού τύπου η οποία εντοπίζεται στο κυτταρόπλασμα. Η συσσώρευση του mrna της ακτίνης CyIIIb ρυθμίζεται στο επίπεδο της μεταγραφής και πρωτοπαρατηρείται 10 ώρες μετά τη γονιμοποίηση, και αυξάνει

33 μέχρι το στάδιο του πλουτέα (Niemeyer et. al. 1989). Το γονίδιο της ακτίνης CyIIIb εκφράζεται αποκλειστικά στο αντιστοματικό εξώδερμα, 1989). Παλαιότερες μελέτες προτείνουν ότι στον αναπτυσσόμενο αχινό, ο SpCOUP-TF προσδένεται στην ευθεία επανάλληψη AGGTCA της ρυθμιστικής περιοχής του CyIIIb γονιδίου της ακτίνης και καταστέλλει την έκφρασή του στο στοματικό εξώδερμα (Xu et. al. 1996). Το γονίδιο SpCOUP-TF εκφράζεται κατά τη διάρκεια της ωογένεσης και τα μετάγραφά του παραμένουν στο ωάριο ως μητρικό mrna. Το μητρικό mrna εντοπίζεται στη μια πλευρά του ωοκυττάρου (A) προς την περιοχή του φλοιού. Το ίδιο συμβαίνει και στο αυγό (B) (Vlahou et. al. 1996).Στο στάδιο των δύο κυττάρων, το mrna του SpCOUP-TF συγκεντρώνεται κυρίως στο ένα από τα δύο βλαστομερίδια και σε γωνία 90 μοιρών ως προς το επίπεδο αυλάκωσης. Κατά τη δεύτερη διαίρεση, το mrna ανιχνεύεται σε δύο από τα τέσσερα βλαστομερίδια. Μετά από δύο ακόμη διαιρέσεις το έμβρυο Εικόνα 15: H έκφραση του Coup-TF στο ωοκύτταρο (Α) και το αυγό (Β) βρίσκεται στο στάδιο Εικόνα 16: H πολύ πρώιμη έκφραση του Coup-TF σε δύο είδη αχινού των 16 κυττάρων και το mrna πλέον ανιχνεύεται σε 4 από τα 8 μεσομερίδια, σε 2 από τα 4 μακρομερίδια, ενώ ανιχνεύεται λιγότερο στα μικρομερίδια. Αυτό το πρότυπο δεν παρουσιάζεται όμως σε όλα τα είδη αχινού. Όπως φαίνεται στο είδος αχινού Lytechinus variegatus (Α-Ε) το COUP-TF mrna του ανιχνεύεται σε διαφορετικά σημεία, σχετικά με τα επίπεδα αυλάκωσης από ότι το mrna του αχινού Strongylocentrotus purpuratus (F-J). Συγκεκριμένα, στο στάδιο των δύο βλαστομεριδίων, η μεγαλύτερη συγκέντρωση του COUP-TF mrna ανιχνεύεται στο ένα από τα 2 κύτταρα σε γωνία 45 μοιρών ως προς το επίπεδο της πρώτης αυλάκωσης. Μετά τη δεύτερη αυλάκωση, μεγάλη ποσότητα mrna ανιχνεύεται στο ένα από τα τέσσερα βλαστομερίδια, με μικρότερο ποσοστό να ανιχνεύεται στα δύο γειτονικά του. Πρέπει να τονισθεί ότι τα δύο αυτά είδη η θέση του

34 στοματικού/αντιστοματικού άξονα του εμβρύου διαφέρει ως προς το πρώτο επίπεδο αυλάκωσης κατά 45 μοίρες. O εντοπισμός του mrna COUP-TF στα έμβρυα των δύο αυτών ειδών αχινού δείχνει ότι είναι πολύ πιθανό να είναι συνδεδεμένος με τη θέση του στοματικού/αντιστοματικού άξονα του εμβρύου (Vlachou et. al. 1996). Στο στάδιο του βλαστιδίου (Α), το SpCOUP-TF mrna εντοπίζεται αποκλειστικά στα εξωδερμικά κύτταρα στη μια πλευρά του τοιχώματος του βλαστόκοιλου, την υποτιθέμενη στοματική περιοχή. Στο στάδιο αυτό το ανιχνεύσιμο mrna είναι πιθανόν λιγότερο μητρικό και περισσότερο ζυγωτικό. Από το στάδιο του γαστριδίου (Β) και μετά όλα τα μετάγραφα του COUP-TF θεωρούνται Εικόνα 17: H έκφραση του Coup-TF σε διαφορετικά αναπτυξιακά ζυγωτικής προέλευσης στάδια στον αχινό S.purpuratus και ανιχνεύονται στo στοματικό εξώδερμα. Στο στάδιο του πλουτέα (Γ), το SpCOUP-TF mrna εντοπίζεται καθαρά στα εξωδερμικά κύτταρα που σχηματίζουν τη βλεφαριδωτή ζώνη (που είναι το προιόν των κυτταρικών αλληλεπιδράσεων μεταξύ των απογόνων των βλαστομεριδίων στο στοματικό και αντιστοματικό εξώδερμα) και στην έδρα (Vlachou et. al. 1996). Στο στάδιο της λάρβας (12 ημερών) ο COUP-TF ανιχνεύεται σε έναν περιορισμένο αριθμό κυττάρων στη βάση και στην κορυφή των προσθιοπλάγιων και οπίσθιων στοματικών βραχιόνων. Eπιπλέον, ανιχνεύεται και σε κύτταρα της βλεφαριδωτής ζώνης στο περίγραμμα της στοματικής επιφάνειας μεταξύ των βραχιόνων καθώς και στις αναπτυσσόμενες επωμίδες. Φαίνεται μάλιστα ότι οι θέσεις έκφρασης του COUP-TF αντιστοιχούν σε σεροτονεργικούς νευρώνες στο στάδιο των 12 ημερών και σεροτονινεργικούς και GABAεργικούς νευρώνες στο στάδιο των 28 έως 35 ημερών. Όσο αφορά το πειραματόζωο μας, στον Paracentrotus lividus φαίνεται το m- RNA να είναι παρόν σε όλο το αυγό και σε όλο το έμβρυο των δεκαέξι κυττάρων. Στο στάδιο του βλαστιδίου, φαίνεται να ενοπίζεται στην φυτική πλάκα και στο στοματικό εξώδερμα. Στο στάδιο του γαστριδίου, συσσωρεύεται στο στοματικό εξώδερμα και στο έντερο. Τέλος, στο στάδιο του πλουτέα, εντοπίζεται στην βλεφαριδωτή ζώνη και το έντερο (αποτελέσματα Λαμπρινής Καλομπόκη από το εργαστήριο μας).

35 Εικόνα 18: : H έκφραση του Coup-TF σε διαφορετικά αναπτυξιακά στάδια στον αχινό P.lividus Μελέτες που αφορούν την ενδοκυτταρική τοποθέτηση της πρωτείνης σε πρώιμα εμβρυικά στάδια, απέδειξαν ότι η μητρική πρωτείνη ανιχνεύεται στο κυτταρόπλασμα και στον πυρηνίσκο του ωοκυττάρου και στο κυτταρόπλασμα στο ώριμο αγονιμοποίητο αυγό. Μετά την γονιμοποίηση το μεγαλύτερο μέρος της πρωτείνης μεταναστεύει από το κυτταρόπλασμα στους πυρήνες. Στο στάδιο των δύο κυττάρων και κατά τη μεσόφαση, η πρωτείνη COUP-TF ανιχνεύεται στην περιφέρεια του εμβρυικού πυρήνα, όπου και παραμένει και σε επόμενα αναπτυξιακά στάδια με ένα μικρό ποσοστό της να ανιχνεύεται και στο κυτταρόπλασμα. Ωστόσο, κατά τη μιτωτική διαίρεση των χρωμοσωμάτων η πρωτείνη COUP-TF βρίσκεται συνδεδεμένη με τη συμπυκνωμένη χρωματίνη. Στο στάδιο των 2, 4, και 8 κυττάρων αντίστοιχα ο COUP-TF ανιχνεύεται στα χρωμοσώματα. Στο στάδιο των 16 κυττάρων όμως, τα μικρομερίδια βρίσκονται ακόμη στη φάση της μεσόφασης, οπότε και ο COUP-TF ανιχνεύεται στην περιφέρεια του πυρήνα σε αυτά. Ωστόσο, όταν και τα μικρομερίδια ξεκινούν τη μίτωση ο SpCOUP-TF ανιχνεύεται πλέον στα συμπυκνωμένα χρωμοσώματα. Στο στάδιο των 60 κυττάρων, ο SpCOUP-TF ανιχνεύεται σε κάποια κύτταρα στην πυρηνική περιφέρεια ενώ σε άλλα στη συμπυκνωμένη χρωματίνη (Vlahou et. al. 2000). Άρα η πρωτείνη COUP-TF πηγαινοέρχεται μεταξύ της πυρηνικής περιφέρειας και των χρωμοσωμάτων κατά τον κυτταρικό κύκλο. Εν κατακλείδι ο COUP-TF είναι ένας µεταγραφικός παράγοντας που από παλαιότερες µελέτες (και του εργαστηρίου µας) φαίνεται να έχει σηµαντική ρυθµιστική δράση σε διάφορες διεργασίες της εµβρυογένεσης, µία εκ των οποίων πιθανότατα είναι η νευρογένεση. Έτσι, διεξήχθησαν πειράματα για να ενταχθεί ο Coup-TF στο γονιδιακό ρυθµιστικό υποδίκτυο των νευρογενών περιοχών που περιλαμβάνει εξειδικευμένα γονίδια όπως το z81, το Hbn και το FoxG αλλά και να διαλευκανθεί µε ποιoύς πιθανούς τρόπους συµµετέχει στην διαδικασία της νευρογένεσης, κατά την ανάπτυξη του εµβρύου του αχινού.

36 Ι.2. Ο μεταγραφικός παράγοντας z81/zhhx1 Εικόνα 19: To φυλογενετικό δένδρο και η έκφραση του z81 στον H.pulcherrimus Ανάλυση της φυλογενετικής θέσης του z81/zfhx1 στον αχινό Hemicentrotus pulcherrimus αποκάλυψε ότι αυτό ανήκει στην οικογένεια πρωτεϊνών δακτύλου ψευδαργύρου με σύνδεση στην περιοχή E-box του DNA (Yaguchi et. al., 2012). Oι συγκεκριμένες πρωτεΐνες φέρουν ένα χαρακτηριστικό δομικό μοτίβο που χαρακτηρίζεται από συντονισμό ενός ή περισότερων ιόντων ψευδαργύρου έτσι ώστε να επέλθει συντονισμός της δομής. Το E-box (Enhancer Box) δε, που προσδένεται το z81/zfhx1 ως μεταγραφικός παράγοντας, είναι μια αλληλουχία DNA που βρέθηκε στην περιοχή των υποκινητών πολλών ευκαρυωτών και λειτουργεί ως περιοχή πρόσδεσης πρωτεϊνών και έχει βρεθεί ότι ρυθμίζει την γονιδιακή έκφραση σε νευρώνες, μύες και άλλους ιστούς. Η ειδική αλληλουχία DNA, CANNTG (όπου Ν οποιοδήποτε νουκλεοτίδιο) με μια παλινδρομική κανονική αλληλουχία CACGTG, αναγνωρίζεται και προσδένεται από μεταγραφικούς παράγοντες για να αρχίσει η γονιδιακή έκφραση. Όταν οι μεταγραφικοί παράγοντες δέσουν στον υποκινητή μέσω του E-box, άλλα ένζυμα δένουν στον υποκινητή και διευκολύνουν την μεταγραφή. Με βάση το φυλογενετικό δέντρο, είναι πολύ στενά συνδεδεμένο με τις πρωτεΐνες δακτύλου ψευδαργύρου των μη σπονδυλωτών (Saccoglossus-Zfhx και Αmphioxus-Zfhx, Σχήμα C). Μεταξύ των τεσσάρων τάξεων πρωτεϊνών Zfhx των σπονδυλωτών, αυτή η ομάδα των μη σπονδυλωτών, δευτεροστομίων είναι πιο στενά συνδεδεμένη με το Zfhx1 (Delta-EF; ZEB1) και Zfhx2 (SIP1; ZEB2) απ ότι με το Zfhx3 και Zfhx4. Tα ορθόλογα γονίδια εμφανίζουν παρόμοια δράση στην ανάπτυξη με χαρακτηριστικά παραδείγματα: 1. Το humansip1 που μεσολαβεί στις αποφάσεις κυτταρικής μοίρας μεταξύ νευροεξωδέρματος και ενδομεσοδέρματος σε ανθρώπινα πολυδύναμα κύτταρα (Chng et. al, 2010), 2. Οι παράγοντες mοusesip1 και mouseδef1, φαίνεται να δρουν συνεργιστικά και εκφράζονται συμπληρωματικά σε πολλούς ιστούς στην

37 εμβρυογένεση. Συγκεκριμένα, μεταξύ των άλλων εκφράζoνται σε φυσιολογικά έμβρυα ποντικού σε νευρικούς ιστούς από το στάδιο Ε7.5 (π.χ. στο νευροεξώδερμα και στο πρωτογενές εξώδερμα) μέχρι το στάδιο Ε11.5 (π.χ. στο διεγκέφαλο και στο μεσεγκέφαλο) (Miyoshi et. al., 2006). 3. Oι παράγοντες XenopusSIP1 και XenopusδΕF1 φαίνεται να έχουν αλληλοεπικαλυπτόμενες αλλά όχι ανταγωνιστικές δράσεις και διαφορική έκφραση στην εμβρυογένεση του Xenopus, ενώ παρουσιάζουν διαφορετικές ιδιότητες αλληλεπίδρασης και αποτελεσματικότητας καταστολής. Όσο αφορά, την νευρογένεση το XenopusSIP1 φαίνεται να μπορεί να επάγει νευρικούς μάρτυρες ενώ εκφράζεται επιλεκτικά στο πρώιμα αναπτυσσόμενο νευρικό σύστημα. Από την άλλη, η γονιδιακή μεταγραφή του XenopusδΕF1 ενεργοποιείται μόνο στην νευριδίωση και η έκφρασή του περιορίζεται στο παραξονικό μεσόδερμα. Από το στάδιο της πρώιμης εκβλάστησης της ουράς, τα δύο γονίδια συνεκφράζονται στην μεταναστευτική κρανιακή νευρική ακρολοφία, στον αμφιβληστροειδή και στο νευρικό σωλήνα (Van Grunsven et. al., 2006). To γονίδιο z81/zfhx1 στον αχινό Hemicentrotus pulcherrimus έπειτα από χρωμογόνο ISH δείχνει: Σχεδόν μηδενική έκφραση στο στάδιο του ώριμου βλαστιδίου (F, 16h), ενώ στο στάδιο του μεσεγχυματικού βλαστιδίου (G, 18h) η έκφραση του αρχίζει να γίνεται αισθητή στα μεσεγχυματικά κύτταρα του φυτικού πόλου. Στο στάδιο του πρώιμου γαστριδίου (Η, 24h) εκφράζεται σε μεμονωμένα κύτταρα της αντιστοματικής γωνίας της ζωικής πλάκας του εμπρόσθιου νευροεξωδέρματος και της μελλοντικής βλεφαριδωτής ζώνης και στα μεσεγχυματικά κύτταρα. Στο στάδιο του πρίσματος (Ι, 38h) εκφράζεται σε όλα τα προηγούμενα αλλά και στο εμπρόσθιο έντερο, ενώ λείπει από την έξω γωνία του κεντρικού τμήματος της ζωικής πλάκας.

38 Τέλος στο στάδιο του πρώιμου (J, K, 48h) και ώριμου (L, 72h) πλουτέα εκφράζεται ξεκάθαρα στους σερετονεργικούς νευρώνες του εμπρόσθιου νευροεξωδέρματος, σε διακεκομένες περιοχές της βλεφαριδωτής ζώνης, το κατώτερο χείλος του στόματος και στα οπίσθια μεσεγχυματικά κύτταρα. Στον αχινό Strongylocentrotus purpuratus το πρώιμο πρότυπο χωροχρονικής έκφρασης φαίνεται να είναι το ακόλουθο (Li et. al., 2013). H έκφραση του z81/zfhx1 ή όπως αλλιώς παρουσιάζεται βιβλιογραφικά sip1 (Smad interacting protein 1) στο στάδιο του πρώιμου βλαστιδίου (12h) εντοπίζεται τόσο στο στοματικό όσο και στο αντιστοματικό και πλευρικό Εικόνα 20: H έκφραση του z81 στον P.lividus μέχρι το στάδιο του πρώιμου γαστριδίου εξώδερμα. Επίσης, φαίνεται και έκφραση στην ζωική πλάκα. Η στοματική έκφραση εξασθενεί στο στάδιο του ώριμου βλαστιδίου (18h) και γίνεται συμπληρωματική της έκφρασης του Lefty που εκφράζεται στο στοματικό εξώδερμα. Στο στάδιο του μεσεγχυματικού βλαστιδίου (24h), η έκφραση διατηρείται στο αντιστοματικό και πλευρικό εξώδερμα, στην ζωική πλάκα και στα μεσεγχυματικά κύτταρα. Στο στάδιο του πρώιμου γαστριδίου (30h) εκφράζεται σε μεμονωμένα κύτταρα της αντιστοματικής γωνίας της ζωικής πλάκας του εμπρόσθιου

39 νευροεξωδέρματος και της μελλοντικής βλεφαριδωτής ζώνης και στα μεσεγχυματικά κύτταρα. Στο στάδιο του πρίσματος και του ώριμου πλουτέα (36 και 48h αντίστοιχα) η έκφραση εντοπίζεται πιο έντονα στο εμπρόσθιο έντερο και στην ζωική πλάκα (Materna et. al., 2006). Εικόνα 21: H έκφραση του z81 στον P.lividus στο στάδιο του ώριμου γαστριδίου Εικόνα 22: Διαγραμματική απεικόνιση της ποσοτικής έκφρασης του z81 από 0-30 ώρες μετά την γονιμοποίηση στον S.purpuratus Eικόνα 23: Διαγραμματική απεικόνιση της ποσοτικής έκφρασης του z81 από 0-48 ώρες μετά την γονιμοποίηση στον S.purpuratus

40 Από τα διαγράμματα (Li et. al. 2013, Materna et. al. 2006). φαίνεται ότι δεν υπάρχει μητρική έκφραση και ότι η έκφραση αρχίζει κάπου 8-9 ώρες μετά την γονιμοποίηση. Παρουσιάζεται δε μέγιστη έκφραση (1500 αντίγραφα ανά έμβρυο) γύρω στις 12 ώρες ενώ αργότερα στις 18 και 24 ώρες πέφτει αισθητά. Έπειτα γύρω στις 36 και 48 ώρες αντίστοιχα παρουσιάζεται μια μερική ανάκαμψη ( αντίγραφα ανά έμβρυο). Έχει αποδειχθεί ότι ο συγκεκριμένος μεταγραφικός παράγοντας εμπλέκεται με πολλά σηματοδοτικά μονοπάτια και χαρακτηριστικά μόρια της νευρογένεσης. Συγκεκριμένα, έχει αποδειχθεί πειραματικά ότι το συγκεκριμένο γονίδιο εκφράζεται παροδικά σε μεμονωμένα πρόδρομα νευρικά κύτταρα (που συνεκφράζουν Delta) που θα οδηγηθούν στον σχηματισμό σερετονεργικών νευρώνων στο εμπρόσθιο νευροεξώδερμα. Σταδιακά όμως εξασθενεί η έκφρασή του όταν η νευρική διαφοροποίση αρχίζει με την έκφραση μιας συνθετάσης της σερετονίνης, της tryptophan 5-hydroxylase (tph). Eπίσης, η απουσία του συγκεκριμένου μεταγραφικού παράγοντα δεν επηρεάζει την έκφραση ενός άλλου πρόδρομου μάρτυρα νευρικών κυττάρων, του Fez, ενώ αντιθέτως οδηγεί σε ενεργοποίηση της έκφρασης της tph και της synaptotagmin B (παν-νευρικός μάρτυρας). Απόρροια των παραπάνω είναι ότι στην περίπτωση καταστολής του z81/zhhx1, εμποδίζεται η διαφοροποίηση των σερετονεργικών νευρώνων και μειώνεται, ανάλογα της συγκέντρωσης του ΜΑSO για το z81/zhhx1, ο αριθμός των συγκεκριμένων νευρώνων. Η Wnt/β-catenin σηματοδότηση, όπως προαναφέρθηκε, οδηγεί τα βλαστομερή σε ενδοδερμικές και μεσοδερμικές μοίρες, ενώ περιορίζει το ΑΝΕ (αλλά δεν το επηρεάζει στο ζωικό πόλο). Έτσι καταστολή αυτής της σηματοδότησης, οδηγεί σε εκτεταμένη ζωική πλάκα και σε σχηματισμό πολλών σερετονεργικών νευρώνων (νωρίτερα θετικών σε z81/zfhx1) που διασκορπίζονται σε όλο το έμβρυο χωρίς συγκεκριμένο πρότυπο. Σερετονεργικοί νευρώνες δεν δημιουργούνται όμως ούτε στην περίπτωση της συγκαταστολής της Wnt/β-catenin σηματοδότησης και του γονιδίου z81/zfhx1 ούτε στην περίπτωση καταστολής του γονιδίου z81/zhhx1 σε έμβρυα με αφαιρεμένο τον φυτικό πόλο. Τα παραπάνω δείχνουν ξεκάθαρα ότι το z81/zfhx1 χρειάζεται για την διαφοροποίηση των σερετονεργικών νευρώνων, ενώ η Wnt/βcatenin σηματοδότηση οριοθετεί αυτούς τους νευρώνες στο εμπρόσθιο νευροεξώδερμα. H Nodal σηματοδότηση προερχόμενη από το στοματικό εξώδερμα περιορίζει την διαφοροποίηση των σερετονεργικών νευρώνων στην αντιστοματική πλευρά της ζωικής πλάκας, στοιχείο που φαίνεται από το ότι σε έμβρυα ενεμένα με Νodal ΜΑSO εμφανίζονται σε όλη την ζωική πλάκα κύτταρα θετικά για z81/zhhx1 και tph ενώ

41 αντίθετα αυτά τα κύτταρα απουσιάζουν εντελώς σε έμβρυα με καταστολή έκφρασης για το Lefty και με επακόλουθη εκτεταμένη έκφραση του Νodal. Ένα άλλο αντινευρικό σινιάλο πρόερχεται από την Delta/Notch σηματοδότηση και αποτρέπει την πλευρική δημιουργία νευρώνων, στοιχείο που φαίνεται από το ότι στα έμβρυα με κατεσταλμένη έκφραση του Delta, παρουσιάζονται πολύ περισσότερα κύτταρα που να εκφράζουν z81/zhhx1 και που αργότερα γίνονται μια πολυπληθής ομάδα σερετονεργικών νευρώνων. Το FoxQ2, χαρακτηριστικό γονίδιο του ΑΝΕ, φαίνεται να ενεργοποιεί τόσο το z81/zhhx1 όσο και και το Delta, ενώ το ίδιο φαίνεται να καταστέλλεται από την Wnt/βcatenin σηματοδότηση. Το z81/zhhx1 φαίνεται να αυτοκαταστέλλεται, καθώς χαρακτηριστικά στα έμβρυα με κατεσταλμένη έκφραση του z81/zhhx1 παρουσίαζονται πολύ περισσότερα κύτταρα θετικά για το εν λόγω γονίδιο. Όλα τα παραπάνω φαίνονται σχηματικά και στο παρακάτω διάγραμμα. Επίσης, φαίνεται και η σχέση ανάδρομης θετικής ανατροφοδότησης μεταξύ Fez και FoxQ2 (Yaguchi et. al., 2011). Fez function is required to maintain the size of the animal plate in the sea urchin embryo.). Τέλος, το Six3 φαίνεται να δρα ενεργοποιητικά τόσο για το FoxQ2, όσο για το Delta και το z81/zhhx1. (Wei et. al. 2009, Υaguchi et. al. 2008). Eικόνα 24: Σχηματική απεικόνιση του GRN με πρωταγωνιστή το z81

42 Ι.3. Ο μεταγραφικός παράγοντας Ηbn O συγκεκριμένος μεταγραφικός παράγοντας ανήκει στην οικογένεια πρωτεϊνών με ομοιοεπικράτεια (homeodomain proteins), δηλαδή με μια πρωτεϊνική δομική περιοχή που δένει σε DNA ή RNA και συνήθως εντοπίζεται σε μεταγραφικούς παράγοντες. Η συγκεκριμένη πτυχή αποτελείται από μια δομή έλικας-στροφής-έλικας μήκους εξήντα αμινοξέων, στην οποία τρεις άλφα έλικες συνδέονται με μηκούς μήκους θηλιές. Οι δύο αμινοτελικές άλφα έλικες είναι αντιπαράλληλες, ενώ η τρίτη και πιο μακρυά στο καρβοξυτελικό άκρο είναι σχεδόν κάθετη προς τον άξονα που καθορίζεται από τις δύο πρώτες. H τελευταία είναι που αναγνωρίζει και δένει στο DNA. Οι ομοιεπικράτειες δεσμέυονται στο Β-DNA ειδικά και μη,με την καρβοξυτελική έλικα αναγνώρισης να ευθυγραμμίζεται στην μεγάλη αύλακα και την μη δομημένη πεπτιδική «ουρά» στο αμινοτελικό άκρο να ευθυγραμμίζεται στην μικρή αύλακα. H έλικα αναγνώρισης και οι βρόγχοι μες την έλικα είναι πλούσιοι σε αργινίνη και λυσίνη, οι οποίες δημιουργούν δεσμούς υδρογόνου με την ραχοκοκαλιά του DNA. Tα διατηρημένα υδροφοβικά αμινοξέα στο κέντρο της έλικας αναγνώρισης στοχεύουν στην σταθεροποίηση του πακεταρίσματος της έλικας. Οι πρωτεΐνες ομοιεπικράτειας δείχνουν προτίμηση για την αλληλουχία 5'-ATTA-3', ενώ η ανεξάρτητη με την αλληλουχία σύνδεση συμβαίνει με εμφανώς χαμηλότερη συγγένεια.οι περισσότερες ομοιοεπικράτειες επάγουν την διαφοροποίηση αρχίζοντας καταρράκτες συνεργατικά ρυθμιζόμενων γονιδίων, ενώ άλλα γονίδια συσχετίζονται με την διατήρηση της πολυδυναμικότητας. Σύμφωνα με το παρακάτω φυλογενετικό δένδρο, ορθόλογα γονίδια του συγκεκριμένου γονιδίου έχουν βρεθεί τόσο σε πρωτοστόμια, δευτεροστόμια όσο και στα κνιδάρια (Μαzza et. al., 2010). Συγκεκριμένα στην μύγα D.melanogaster εκφράζεται στον εγκέφαλο του εμβρύου και στην κοιλιακή νευρική χορδή. Η έκφρασή του αρχίζει στο στάδιο του βλαστοδέρματος στα πρόσθια ραχιαία κεφαλικά primodia και συνεχίζει σε αυτά τα κύτταρα που σχηματίζουν τμήματα του εγκεφάλου σε ώριμα αναπτυξιακά στάδια (Walldorf et. al, 2000).

43 Eικόνα 25: To φυλογενετικό δένδρο που περιλαμβάνει τα ομόλογα Hbn γονίδια σε μια ποικιλία οργανισμών Στον S.purpuratus τo συγκεκριμένο γονίδιο εκφράζεται στο στάδιο του πρώιμου και μεσεγχυματικού βλαστιδίου και του γαστριδίου (τρεις πρώτες εικόνες των υβριδοποίησεων αντίστοιχα) στο εμπρόσθιο νευροεξώδερμα, ενώ στο στάδιο του πλουτέα εμφανίζεται στα στοματικά γάγγλια και σε διασκορπισμένα κύτταρα της ζωικής πλάκας. Επίσης, δεν φαίνεται να εκφράζεται στο αυγό (Burke et. al, 2006). Ποσοτικά δεδομένα συμπληρώνουν την εικόνα δείχνοντας μέγιστη έκφραση γύρω στις 30 ώρες, δηλ. στο στάδιο του μεσεγχυματικού βλαστιδίου (Wei et. al., 2009).

44 Πίνακας 2: Πίνακας που παρουσιάζει την χωροειδική έκφραση του Hbn από το αυγό μέχρι τον πλουτέα Εικόνα 26: Σχηματική απεικόνιση της ποσοτικής έκφρασης του Ηbn 0-72 ώρες μετά την γονιμοποίηση Εικόνα 27: H έκφραση του Hbn από το βλαστίδιο μέχρι τον πλουτέα. Το Ηbn φαίνεται να συνεντοπίζεται με ένα πολύ σημαντικό μόριο του ΑΝΕ, το FoxQ2, στο στάδιο του βλαστιδίου (τότε εξειδικεύεται και η περιοχή του ζωικού πόλου) ενώ στο στάδιο του γαστριδίου το Ηbn παρουσιάζεται Εικόνα 28: O συνεντοπισμός του Hbn και του FoxQ2 σε control και κατεσταλμένα για την Wnt σηματοδότηση έμβρυα.

45 περιφεριακότερα του FoxQ2 (Wei et. al., 2009). Σε έμβρυα κατεσταλμένα για την Wnt, Νodal και BMP2/4 και σηματοδότηση, παρουσιάζεται αναμενόμενα, με βάση όσα έχουν ήδη αναφερθεί, επέκταση της ζωικής πλάκας, και επομένως πιο εκτεταμένη έκφραση των γονιδίων του ΑΝΕ. Συγκεκριμένα, το FoxQ2 εκφράζεται στο ζωικό ήμισυ και το Ηbn στο υπόλοιπο του εμβρύου. Ως γνωστόν, η Wnt σηματοδότηση είναι απαραίτητη για την δημιουργία του στοματικού-αντιστοματικού προτύπου μέσω του Nodal, απομακρύνοντας τον καταστολέα αυτού, FoxQ2, από το πλευρικό εξώδερμα (Yaguchi et. al., 2008). To Νοdal, όπως έχει ήδη υποθεί, χρειάζεται μεταξύ των άλλων για την παραγωγή του BMP2/4 (Duboc et. al., 2004). το οποίο ενεργοποιεί το δίκτυο για την διαφοροποίηση του πλευρικoύ εξωδέρματος (Angerer et. al., 2000) και την παραγωγή της Chordin, η οποία εμποδίζει το BMP2/4 (Bradham et. al., 2009). Aπό όλα τα παραπάνω, φαίνεται ότι στο στάδιο του βλαστιδίου το πλευρικό εξώδερμα μετασχηματίζεται σε στοματικό και αντιστοματικό επιδερμικό εξώδερμα, ενώ η περιοχή του ζωικού πόλου παραμένει ανεπηρέαστη εκφράζοντας FoxQ2 (Tu et. al., 2006). και γονίδια όπως το Ηbn (Yaguchi et. al. 2008, Burke et. al 2006, Howard-Ashby et. al. 2006a, Howard-Ashby 2006b). To Six3, το οποίο είναι ένα γονίδιο που βρίσκεται στην κορυφή του ρυθμιστικού δικτύου της νευρογένεσης και που είναι απαραίτητο για την διαφοροποίηση και ανάπτυξη των νευρώνων, φαίνεται να ρυθμίζει θετικά το Ηbn όπως διαπιστώνεται τόσο από in situ υβριδοποιήσεις έπειτα από ενέσεις με Six3 mrna (P,Q) όσο και από πειράματα QPR σε Six3 morphants (Wei et. al., 2009). Εικόνα 29: H έκφραση του Hbn σε ενεμένα με Six3 mrna έμβρυα

46 Εικόνα 30: Διαγραμματική απεικόνιση της έκφρασης του Hbn σε control και ενεμένα με Six3 MASO έμβρυα Ι.4. Ο μεταγραφικός παράγοντας FoxG To συγκεκριμένο γονίδιο ανήκει στην οικογένεια των FOX (Forkhead box) πρωτεϊνών, που είναι είναι μια οικογένεια μεταγραφικών παραγόντων που παίζουν σημαντικό ρόλο στη ρύθμιση της έκφρασης των γονιδίων που εμπλέκονται στην κυτταρική ανάπτυξη, τον πολλαπλασιασμό, την διαφοροποίηση και τη μακροζωία. Πολλές FOX πρωτεΐνες είναι σημαντικές για την εμβρυϊκή ανάπτυξη. Οι FOX πρωτεΐνες έχουν επίσης πρωτοποριακή δραστικότητα στην μεταγραφή με το να είναι σε θέση να δεσμεύουν συμπυκνωμένη χρωματίνη κατά τη διάρκεια των διαδικασιών της κυτταρικής διαφοροποίησης. Το καθοριστικό χαρακτηριστικό των FOX πρωτεϊνών είναι το κουτί forkhead, μια αλληλουχία από 80 έως 100 αμινοξέα που σχηματίζουν ένα μοτίβο που δεσμεύεται στο DNA. Αυτό το μοτίβο forkhead είναι επίσης γνωστή ως φτερωτή έλικα, ονομασία που οφείλεται στην ομοιάζουσα με πεταλούδα εμφάνιση των βρόχων στη δομή της πρωτεΐνης αυτού του τομέα. Τα forkhead γονίδια είναι μια υποομάδα της κατηγορίας έλικα-στροφή-έλικα πρωτεϊνών, που έχουν δύο άλφα έλικες οι οποίες συνδέονται με μια μικρή αλυσίδα αμινοξέων. Σύμφωνα με το παρακάτω φυλογενετικό δένδρο, υπάρχει εξελικτική σχέση στην αλληλουχία πολλών FOX πρωτεϊνών μεταξύ αχινού, ανθρώπου και μύγας (Tu et. al., 2006). Πιο συγκεκριμένα, παρουσιάζεται ότι το ορθόλογο του SpFoxG στον άνθρωπο είναι το FoxG1C, το οποίο υπάρχει και με πολλά άλλα ονόματα επίσης όπως

47 FoxG1, και το οποίο φαίνεται να βρίσκεται στο χρωμόσωμα 14, να δρα κατασταλτικά και να έχει άμεσο ρόλο στην ανάπτυξη του εγκεφάλου. Πολλοί ερευνητές συνδέουν μεταλλάξεις σε αυτό το γονίδιο με το σύνδρομο Rett. (http://www.ncbi.nlm.nih.gov/gene?db=gene&cmd=showdetailview&termtosearch =2290). Επίσης και τα δύο ορθόλογα γονίδιο στην Drosophila melanogaster (DmCG2939 ή slp2 και DmCG16738 ή slp1) φαίνεται να δημιουργήθηκαν μέσω διπλασιασμού, να βρίσκονται διαδοχικά πάνω στο χρωμόσωμα 2, να περιλαμβάνουν πολλούς λειτουργικά επικαλυπτόμενους ενισχυτές και να μοιράζονται τα συνδυασμένα χαρακτηριστικά των «gap, segment polarity και secondary pair-rule» γονιδίων. Τα δυο γονίδια έχουν καθοριστικό ρόλο στην καθιέρωση και τμηματοποίσηση του μεσοδέρματος, αλλά εκφράζονται και στο εξώδερμα. Τα δύο γονίδια εκφράζοναι πρώτα στο κεφάλι, δρώντας ως gap γονίδια, αλλά η δράση τους στον κορμό είναι περισσότερο ως segment polarity και secondary pair-rule γονιδία. Τα gap γονίδια μαζί τα slp ορίζουν εφτά περιοχές και υποδιαιρούν το κεφάλι καθορίζοντας την δομή του ενήλικου κεφαλιού (Grossniklaus, 1994)(http://www.sdbonline.org/sites/fly/segment/slopyprd.htm,

48 Εικόνα 31: To φυλογενετικό δένδρο που παρουσιάζει τα FoxG ομόλογα γονίδια

49 Από πειράματα για την μελέτη της πρωίμης ποσοτικής έκφρασης των γονιδίων του στοματικού εξωδέρματος φαίνεται ότι (Li et. al., 2013). το FoxG δεν έχει μητρική έκφραση, εμφανίζεται για πρώτη φορά η ζυγωτική έκφραση στις δεκαπέντε με δεκαοχτώ ώρες μετά την γονιμοποίηση, δηλ. στο στάδιο του ώριμου βλαστιδίου, αυξάνεται συνεχώς η ζυγωτική έκφραση μέχρι τριάντα ώρες μετά την γονιμοποίηση, δηλ. μέχρι το στάδιο του πρώιμου γαστριδίου. Εικόνα 32: Διαγραμματική απεικόνιση της ποσοτικής έκφρασης του FoxG 0-30 ώρες μετά την γονιμοποίηση Όσο αφορά το πρώιμο χωρικό πρότυπο της έκφρασης του φαίνεται διαγραμματικά παρακάτω ότι: Στις δώδεκα ώρες μετά την γονιμοποίηση, δηλ. στο στάδιο του πρώιμου βλαστιδίου δεν εμφανίζεται πουθενά, Στις δεκαοχτώ και είκοσι τέσσερις ώρες μετά την γονιμοποίηση, δηλ. στο στάδιο του ώριμου και μεσεγχυματικού βλαστιδίου αντίστοιχα, εκφράζεται στο ζωικό στοματικό εξώδερμα, το οποίο φαίνεται να βρίσκεται στον ζωικό πόλο, αντιδιαμετρικά από το αντιστοματικό εξώδερμα ενώ ανάμεσα τους βρίσκεται το πλευρικό εξώδερμα/βλεφαριδωτή ζώνη. Το στοματικό εξώδερμα περιέχει την στοματική περιοχή και βρίσκεται κάτω από το εμπρόσθιο νευροεξώδερμα, ΑΝΕ (αλλιώς γνωστό ως apical organ).

50 Εικόνα 33: Σχηματική απεικόνιση της χωροειδικής έκφρασης του FoxG στις 12, 18 και 24 ώρες μετά την γονιμοποίηση Η ποσοτική έκφραση του συνεχίζει να αυξάνεται και μετά τις τριάντα ώρες, ώσπου στο στάδιο πλουτέα (εβδομήντα δύο ώρες μετά την γονιμοποίηση) εμφανίζειται το μέγιστο επίπεδο έκφρασης. Το πρότυπο της έκφρασης του στο στοματικό εξώδερμα παραμένει μέχρι το πρώιμο γαστρίδιο, ενώ μέχρι το τέλος της γαστριδίωσης η έκφραση του περιορίζεται στην βλεφαριδωτή ζώνη (Τu et. al., 2006). Εικόνα 34: H έκφραση του Fox από το αυγό μέχρι τον πλουτέα

51 Όπως φαίνεται στο παρακάτω δίκτυο, το οποίο αναφέρεται στην εμβρυική ανάπτυξη μέχρι τις 24 ώρες μετά την γονιμοποίηση, το Nodal μονοπάτι σηματοδότησης συμβάλλει στην σταδιακή οργάνωση του στοματικού εξωδέρματος με έναν έμμεσο μηχανισμό καταστολής. Δύο γονίδια που κωδικοποιούν τους καταστολείς Ets4 και Sip1 (ή αλλίως γνωστό ως z81/zhhx1 που αναφέρθηκε προηγουμένως), έχουν αποκλειστεί στο στοματικό εξώδερμα από δύο άλλα γονίδια που κωδικοποιούν καταστολείς, οι οποίοι ενεργοποιούνται ως άμεσοι στόχοι του Νodal. Ένα από αυτά τα γονίδια είναι το not, και το άλλο δεν είναι ακόμη άγνωστο (r-oral). Πριν από την μεταγραφική κάθαρση που επιτυγχάνεται με το not και r-oral, τα προϊόντα των Ets4 και Sip1 εμποδίζουν επιλεκτικά το Foxg, Gsc, και Bra. Δεδομένου ότι η καταστολή είναι κυρίαρχη, αυτά τα διπλά αρνητικά υποκυκλώματα (double negative gates) ευθύνονται για την καθυστερημένη έκφραση των γονιδίων στόχων του Nodal, Bra και Gsc. Επιπλέον, το Sip1 παρέχει χωρικό καθώς και χρονικό περιορισμό της έκφρασης του FoxG (το οποίο δεν ενεργοποιείται χωρικά με Nodal σηματοδότηση). Έτσι το FoxG εξακολουθεί να καταστέλλεται στο αντιστοματικό εξώδερμα από το Sip1, ενώ αφού η έκφραση του Sip είναι κατεσταλμένη στο στοματικό εξώδερμα του ζωικού πόλου, η μεταγραφή του Foxg επιτρέπεται εκεί. Το Foxg επίσης δέχεται κατασταλτική ρύθμιση από το Gsc και ενεργοποιητική ρύθμιση από έναν άγνωστο ενεργοποιητή όλου του εξωδέρματος (panecto activator) στην περιοχή του ζωικού στοματικού εξωδέρματος. Ο σχηματισμός του πλευρικού εξωδέρματος του ζωικού πόλου, συμβαίνει αφότου το στοματικό και αντιστοματικό εξώδερμα αποκτήσουν ταυτότητα. Το διάγραμμα δείχνει ότι ο περιορισμός της έκφρασης στο ζωικό πλευρικό εξώδερμα του Emx και Univin εξαρτάται από την καταστολή στο ζωικό στοματικό εξώδερμα, αντίστοιχα από το Not και Gsc. Λόγω της λεπτή διαφοράς στη χρονικότητα της έκφρασής τους, το Not καταστέλλει πρώιμα γονιδία του ζωικού πλευρικού εξωδέρματος, ενώ το Gsc καταστέλλει μετέπειτα γονίδια του ζωικού πλευρικού εξωδέρματος και της βλεφαριδωτής ζώνης, όπως το FoxG. Μαζί τα δύο γονίδια συμβάλλουν στον καθορισμό του ορίου μεταξύ του ζωικού στοματικού εξωδέρματος και του ζωικού πλευρικού εξωδέρματος/βλεφαριδωτής ζώνης.

52 Εικόνα 35: Διαγραμματική απεικόνιση του GRN του στοματικού εξωδέρματος και της βλεφαριδωτής ζώνης που περιλαμβάνει το FoxG +


54 Σκοπός της συγκεκριμένης ερευνητικής εργασίας ήταν η μελέτη του ρόλου και της θέσης του PlCOUP-TF στο ρυθμιστικό γονιδιακό δίκτυο της νευρογένεσης του αχινού Paracentrotus lividus, αλλά και η διερεύνιση των επιδράσεων του συγκεκριμένου μεταγραφικού παράγοντα σε συγκεκριμένα νευροειδικά γονίδια που εμπλέκονται στην δημιουργία νευρώνων.


56 Α. Δημιουργία ανιχνευτών για χρωμογόνο και διπλή φθορίζουσα in situ υβριδοποίηση Α.1. Συλλογή γαμετών, τεχνητή γονιμοποίηση και καλλιέργεια εμβρύων 1. Ένεση με 1ml 0,5Μ ΚCl στην περιστοματική περιοχή των ώριμων αχινών Paracentrotus lividus (από την περιοχή Ρίου Αχαΐας) στην αναπαραγωγική περίοδο τους, δηλ. από Νοέμβρη έως Μάιο. Συμβαίνει ουσιαστικά σύσπαση µυικών ινών και απελευθέρωση γαµετών από τις γονάδες. 2. Συλλογή γαμετών. Συλλέγονται τα ωάρια και τα σπερµατοζωάρια (τα ωάρια βάζοντας τους θυληκούς αχινούς ανάποδα, δηλ. µε την περιπρωκτική περιοχή προς το στόµιο του δοχείου και ρίχνοντας 100ml φιλτραρισµένο, θαλασσινό νερό από πάνω και τα σπερµατοζωάρια µε ένα πουαρ και βάζοντας τα σε πάγο. Φιλτράρεται µε τριπλή γάζα το θαλασσινό νερό µε τα ωάρια (για την κατακράτηση αγκαθιών κ.τ.λ.), αφού πρώτα έχει γίνει αλλαγή µια φορά στο νερό. Αφήνονται να καθιζάνουν τα ωάρια. Αφαιρείται το προηγούµενο νερό και προστίθεται καινούργιο, φιλτραρισµένο, θαλασσινό νερό. Επαναιωρούνται τα ωάρια. Για 1l καλλιέργειας εμβρύων χρειάζονται αυγών δηλ. 10ml συμπυκνωμένων αυγών και 1 σταγόνα συμπυκνωμένου σπέρματος! 3. Προσθήκη 10ml συμπυκνωμένων ωαρίων σε διάλυμα γονιμοποίησης. Το παραπάνω αποτελεί το 1/5 του τελικού όγκου της καλλιέργειας. (Το PABA βοηθά στην ρύθμιση του ph του διαλύματος γονιμοποίησης στο 8,2 και στην μη σκλήρυνση της μεμβράνης γονιμοποίησης, ενώ το Τris-HCl στην διατήρηση του συγκεκριμένου ph.) Προσθήκη μιας σταγόνας dry sperm. Aνάδευση για 10 λεπτά σε θερμοκρασία δωματίου για επίτευξη τεχνητής γονιμοποίησης. Διάλυμα γονιμοποίησης: Φιλτραρισμένο θαλασσινό νερό Σκόνη PABA (τελική συγκέντρωση 5mM) Πεχαμέτρηση στο ph 8,2 Προσθήκη Tris-HCl ph 8,2 (τελική συγκέντρωση 5mM) 4.Πέρασμα από Νitex (διαμέτρου 50μ) για την απομάκρυνση της μεμβράνης γονιμοποίησης.

57 5. Προσθήκη φιλτραρισμένου θαλασσινού νερού (τα υπόλοιπα 4/5 του όγκου της καλλιέργειας) και αντιβιοτικού penistrep (1ml/l καλλιέργειας). 6. Ανάπτυξη των εμβρύων στους 18 ο C υπό ανάδευση. 7. Συλλογή εμβρύων στα ακόλουθα αναπτυξιακά στάδια: Στάδιο αυγού (0 ώρες). Στάδιο 16 κυττάρων (3-4 ώρες μετά την γονιμοποίηση). Στάδιο πρώιμου βλαστιδίου (10 ώρες μετά την γονιμοποίηση). Στάδιο πρώιμου γαστριδίου (20 ώρες μετά την γονιμοποίηση). Στάδιο πρίσματος (25 ώρες μετά την γονιμοποίηση). Στάδιο πρώιμου πλουτέα (30-32 ώρες μετά την γονιμοποίηση). Α.2. Απομόνωση RNA (50-100mgr) από διαφορετικά αναπτυξιακά στάδια (phenolchloroform extraction) 1. Ψυχρή φυγοκέντρηση του 50ml falcon (που περιέχει τα συλεγμένα έμβρυα) για 10 λεπτά (13000rpm). 2. Aπομάκρυνση του υπερκείμενου θαλασσινού νερού. 3. Προσθήκη 1ml φαινόλης (Τripure, Roche) και ομογενοποίηση. 4. Παραμονή σε θερμοκρασία δωματίου για 10 λεπτά. 5. Προσθήκη 200μl χλωροφορμίου. Vortex για 15 δευτερόλεπτα. 6. Παραμονή σε θερμοκρασία δωματίου για 10 λεπτά. 7. Ψυχρή φυγοκέντρηση για 15 λεπτά (10700rpm). Κρατάμε την υδατική, ανώτερη φάση (περίπου 500μl). 8. Προσθήκη 500μl ισοπροπανόλης και ομογενοποίηση. 9. Παραμονή σε θερμοκρασία δωματίου για 15 λεπτά. 10.Ψυχρή φυγοκέντρηση για 10 λεπτά (10700rpm). 11. Αφαίρεση υπερκείμενου διαλύματος. 12. Προσθήκη 1ml 75% αιθανόλης. Vortex για δευτερόλεπτα. 13. Φυγοκέντρηση σε θερμοκρασία δωματίου για 5 λεπτά (8400rpm). 14. Αφαίρεση υπερκείμενου διαλύματος.

58 15. Σε θερμοκρασία δωματίου ξήρανση ιζήματος. 16. Προσθήκη 200μl RNAase free νερού. 17. Ομογενοποίηση για 30 λεπτά. 18. Αποθήκευση RNA στους -80 ο C. Το RNA θα αποτελέσει το υπόστρωμα για την παρακάτω αντίδραση. Α.3. RΤ-PCR με διαβαθμισμένη θερμοκρασία Αντιδραστήριο (Takara, Prime Script One Step RT-PCR kit Ver. 2) Όγκος Τελική Συγκέντρωση/Πυκνότητα/Ποσότητα Primer forward 15μM Primer reverse 15μM 0,5μl 0,5μl 0,3μΜ 0,3μΜ 2xbuffer 12,5μl 1x Enzyme mix (Ταq πολυμεράση, αντίστροφη μεταγραφάση) RNA βλαστιδίου 1μl - 100ng

59 RNAase free νερό Μέχρι τα 25μl Bήματα Θερμοκρασία Χρόνος ο C (σύνθεση cdna από mrna) ο C (απενεργοποίηση αντίστροφης μεταγραφάσης) ο C (αποδιάταξη) ο, 56,6 ο, 60 ο C (υβριδοποίηση 30 primers) ο C (πολυμερισμός) 2 (1 /1 kb) 6. Eπιστροφή στο βήμα 3 για 39 φορές ο C (τελειοποίηση άκρων, τελικός πολυμερισμός) 10

60 8. Τέλος Τα γονίδια που επιλέχθηκαν να µελετηθούν σε σχέση µε τον ΡΙCoup-TF, και των οποίων η εµπλοκή µε την νευρογένεση περιγράφηκε σε προηγούµενο υποκεφάλαιο, έχουν κατά κύριο λόγο µελετηθεί από άλλα εργαστήρια στον αχινό Strongylocentrotus purpuratus. Το δικό µας όµως πειραµατικό υλικό είναι ο αχινός Paracentrotus lividus που εντοπίζεται στην Μεσόγειο. Γι αυτό τον λόγο χρειάζεται να βρεθούν τα ορθόλογα γονίδια και να φτιαχτούν για αυτά κατάλληλοι primers. Η διαδικασία που ακολουθήθηκε είναι η παρακάτω: 1. Εύρεση του ακριβούς ονόµατος του γονιδίου ή του Official Gene ID και εισαγωγή του στην βάση δεδοµένων Spbase.org του αχινού Strongylocentrotus purpuratus. 2. Διασταύρωση ότι το αποτέλεσµα αφορά το σωστό γονίδιο το οποίο αναφέρεται στην βιβλιογραφία, µέσω των παραποµπών που προσφέρει η βάση δεδομένων. 3. Προβολή της αλληλουχίας του cdna για το εκάστοτε γονίδιο. 4. Αντιγραφή της αλληλουχίας και σύγκριση αυτής στην βάση δεδοµένων octopus (http://octopus.obs-vlfr.fr) που περιλαµβάνει διάφορες βάσεις δεδοµένων γονιδιωµατικού ή cdna υλικού από τον Paracentrotus lividus. Η βάση που χρησιµοποιήθηκε κατά κύριο λόγο ήταν η PlivESTall. 5. Εύρεση της αλληλουχίας µε την µεγαλύτερη οµολογία για το εκάστοτε γονίδιο στον Paracentrotus lividus. Εισαγωγή αυτής στο εργαλείο ORFinder του ΝCBI για να διαπιστώσουµε αν υπάρχει ανοικτό πλαίσιο ανάγνωσης που να δίνει πρωτεϊνικό προϊόν ίδιου µεγέθους µε αυτό που έχει µελετηθεί στον Strongylocentrotus purpuratus. Στην συνέχεια δίνεται η δυνατότητα να κάνουµε σύγκριση της αλληλουχίας για το επιθυµητό πλαίσιο ανάγνωσης και να βρούµε µέσω οµολογίας µε άλλους οργανισµούς αν κωδικοποιεί την σωστή πρωτεΐνη. Αφού βρεθεί το σωστό πλαίσιο ανάγνωσης, σηµειώνονται τα σηµεία έναρξης και λήξης της κωδικής αλληλουχίας που εντοπίσθηκαν πάνω στην cdna αλληλουχία του Paracentrotus lividus. 7. Τέλος εισήχθει η αλληλουχία του c-dna του Paracentrotus lividus στο εργαλείο κατασκευής primer (primer-blast) του NCBI και ορίσθηκαν περίπου οι θέσεις που πρέπει να υβριδοποιηθούν οι primers ώστε µε αντίδραση PCR να συντεθεί όλη η κωδική αλληλουχία. Προσδιορίσθηκαν διάφορες παράµετροι όπως το µήκος του προϊόντος και οι επιθυµητές Tm. Τελικά επιλέχθηκαν δύο ζεύγη primers για κάθε γονίδιο µε τις πλησιέστερες τιµές Tm. Οι αλληλουχίες των επιθυµητών ζευγών primers απεστάλησαν για σύνθεση στην εταιρεία VBC-Biotech (Service GmbH, Brehmstraβe

61 14A, A-1110 Wien). Οι primers απεστάλησαν ταχυδροµικώς από την εταιρεία σε ξηρή µόρφη σε φιαλίδιο µε οδηγίες για την ποσότητα mq-h2o που έπρεπε να προστεθεί για να έχουµε διάλυµα µε συγκέντρωση 100µΜ (stock solution). Στην συνέχεια προετοιµάστηκε working solution από κάθε primer σε eppendorf με τελική συγκέντρωση 15µΜ και αποθηκεύτηκε στους -20 ο C. Παρακάτω φαίνονται οι αλληλουχίες των primer και το αντίστοιχο μήκος του προϊόντος. PlΖ81 Πρώτο ζευγάρι με μέγεθος προϊόντος 1984nt Forward: 5 CGCGACAACAACTTGAAGCA 3 Reverse: 5 GCAACGACTGGTGTTGTGTC 3 Δεύτερο ζευγάρι με μέγεθος προϊόντος 1741nt Forward: 5 TCTTCATCAGCACGAGCGTT 3 Reverse: 5 CTTGAAAGCCTTGCCGCATT 3 PlFoxG Πρώτο ζευγάρι με μέγεθος προϊόντος 1894nt Forward: 5 GGTTCAGCTTCATTTTGCCCA 3 Reverse: 5 GATTCTCTGTGGAGCGGCTT 3 Δεύτερο ζευγάρι με μέγεθος προϊόντος 1726nt Forward: 5 TGCAAACGCTTCTTCGGAAT 3 Reverse: 5 CGTCTCGCACAGCTAAAACG 3 PlHbn Πρώτο ζευγάρι με μέγεθος προϊόντος 1733nt Forward: 5 TCTACTTGGGCGGAAAGCAG 3 Reverse: 5 ACGGTTCCGATGTCCATTCAA 3 Δεύτερο ζευγάρι με μέγεθος προϊόντος 1648nt Forward: 5 CAATGGAGGTCACGCAAAGC 3 Reverse: 5 ATACGGTTCCGATGTCCATTCA 3 Πίνακας 3: Tα δύο ζεύγη primers που χρησιμοποιήθηκαν για ΡΤ-PCR για κάθε γονίδιο Α.4. Ηλεκτροφόρηση DNA Μετά το πέρας της PCR απαιτείται έλεγχος των προϊόντων της αντίδρασης. Αυτό γίνεται µε ηλεκτροφόρηση σε πήκτωµα αγαρόζης για να φανεί το µέγεθος των προϊόντων, αλλά και οι σχετικές τους ποσότητες. Έτσι φαίνεται αν τα προϊόντα είναι τα επιθυµητά αλλά και αδρά η απόδοση της αντίδρασης. Ακολουθούνται τα παρακάτω βήµατα: 1. Παρασκευή πηκτώµατος αγαρόζης 1% w/v. Αυτό γίνεται συνήθως διαλύοντας 0,4gr ξηρής αγαρόζης σε 40ml ρυθµιστικού διαλύµατος TAE (Tris-base, acetic acid, EDTA) σε µία κωνική φιάλη. Η κωνική φιάλη θερµένεται σε φούρνο µικροκυµάτων και η αγαρόζη

62 που µοιάζει να διαλύεται, πολυµερίζεται. Όταν δεν παρατηρείται πλέον αδίαλυτη αγαρόζη σταµατά η θέρµανση και αφήνεται η φιάλη να ψυχθεί. 2. Όταν η θερµοκρασία γίνει ανεκτή στο εσωτερικό µέρος του καρπού προστίθενται 1µΙ βρωµιούχο αιθίδιο, πραγματοποιείται ανάδευση και χύσιμο του διαλύµατος σε σκαφάκι ηλεκτροφόρησης για να στερεοποιηθεί. Το βρωµιούχο αιθίδιο (EtBr) παρεµβάλλεται στις έλικες του DNA και φθορίζει όταν φωτιστεί µε υπεριώδες φως. 3. Όταν το πήκτωµα πήξει, το σκαφάκι μπαίνει στην συσκευή ηλεκτροφόρησης µε τα πηγαδάκια για τα δείγματα προς το ηλεκτρόδιο της καθόδου (-) και προστίθεται διάλυµα ΤΑΕ έως ότου το πήκτωµα να είναι πλήρως βυθισµένο. Τότε αφαιρείται και το καλούπι από το πήκτωμα. 4. Προετοιµάζονται τα δείγµατα προσθέτοντας σε eppendorf 9µΙ mq-h2o, 2µΙ 2xloading dye και 1µΙ από το εκάστοτε δείγµα, σε αυτήν την περίπτωση από το σωληνάκι της PCR, ή από τον µάρτυρα που είναι 1kb Ιadder. Πραγματοποιείται spin για να µαζευτεί αυτό το διάλυµα στον πάτο του eppendorf. 5. «Φορτώνεται» όλη η ποσότητα (12µΙ) σε κάθε αντίστοιχο πηγαδάκι, µε πρώτο συνήθως τον µάρτυρα. 6. Ενεργοποιείται η συσκευή της ηλεκτροφόρησης προσέχοντας η διεύθυνση κίνησης των νουκλεικών οξέων να είναι προς την άνοδο (+). Αρχικά συνήθως εφαρμοζέται δυναµικό 70V για να εισέλθει το δείγµα σωστά στο πήκτωµα και µετά µπορεί να ανεβεί το δυναµικό έως και τα 110V. 7. Μετά το πέρας λεπτών, όταν και παρατηρείται ότι η πρώτη ζώνη της χρωστικής έχει φτάσει σχεδόν στην άκρη του πηκτώµατος, σταµατά η ηλεκτροφόρηση. 8. Τοποθετείται το πήκτωµα πάνω σε λάµπες UV ακτινοβολίας και παρατηρούνται οι ζώνες των προϊόντων εξ αιτίας του φθορισµού του EtBr. Συγκρίνοντας τις ζώνες των προϊόντων µε τον µάρτυρα, συµπεραίνεται το µέγεθος τους. Φωτογραφίζεται το πήκτωµα. 9. Επιλέγονται τα προϊόντα από τις θερµοκρασίες που έδωσαν τις πιο αποδοτικές αντιδράσεις αλλά χωρίς παραπροϊόντα. Α.5. Καθαρισμός προϊόντων RT-PCR 1. Προσθήκη προϊόντος RT-PCR και mq νερό (μέχρι τα 100μl) σε κολώνες. 2. Προσθήκη 200μl ΝΤΙ χαοτροπικού αλατούχου διαλύματος για πρόσδεση του νουκλεικού οξέος στις κολώνες. 3. Φυγοκέντρηση για 1 λεπτό (11000g). Απόρριψη εκλούσματος. 4. Προσθήκη 700μl ΝΤ3 διαλύματος πλύσης με αιθανόλη. 5. Φυγοκέντρηση για 1 λεπτό (11000g). Απόρριψη εκλούσματος. 6. Ξηρή φυγοκέντρηση για 2 λεπτά (11000g). Απόρριψη εκλούσματος 7. Προσθήκη 50μl διαλύματος έκλουσης με χαμηλές ιονικές συνθήκες. 8. Παραμονή σε θερμοκρασία δωματίου για 2 λεπτά και μετά φυγοκέντρηση για 1 λεπτό (11000g). 9. Αποθήκευση στους -20 ο C. To kit ήταν της ΜΝ (Nucleospin Gel and PCR Clean-up kit). Α.6. Φωτομέτρηση νουκλεϊκών οξέων

63 Αφού καθαρισθούν τα προϊόντα της PCR, πρέπει να µετρηθεί η συγκέντρωσή τους για να γίνουν οι απαραίτητοι υπολισµοί για τα επόµενα βήµατα της πειραµατικής πορείας. Στην προκειµένη περίπτωση το επόµενο βήµα είναι η αντίδραση λιγάσης η οποία απαιτεί συγκεκριµένες ποσότητες DNA ενθέµατος και φορέα για να γίνει επιτυχώς. Η µέτρηση της συγκέντρωσης όλων των διαλυµάτων νουκλεϊκών οξέων της συγκεκριµένης εργασίας έγινε µε φωτοµέτρηση σε συσκευή Q5000 UV-Vismicro-volume spectrophotometer της QUAWELL. Η συσκευή αυτή χρησιµοποιεί λογισµικό υπολογιστή για την καταγραφή των µετρήσεων και τον καθορισµό διάφορων παραµέτρων. Τα βήµατα που ακολουθούνται για την φωτοµέτρηση είναι τα παρακάτω: 1. Αρχικά καθαρίζεται η κεφαλή τoυ μηχανήματος µε απιονισµένο νερό για να φύγουν τα σωµατίδια της σκόνης που µπορούν να παρεµβληθούν στην µέτρηση. 2. Στο σηµείο της µέτρησης προστίθενται 2µΙ mq-h2o, κατεβαίνει η κεφαλή και από το λογισµικό του φωτοµέτρου επιλέγεται η «µέτρηση νουκλεΐκών οξέων». Στην συνέχεια επιλέγεται η μέτρηση DNA (RNA σε άλλες περιπτώσεις) και πατώντας την ένδειξη «blank» µηδενίζεται το φωτόµετρο. 3. Καθαρίζεται η επιφάνεια µέτρησης µε βρεγµένο χαρτί ταµποναριστά και προστίθενται 2µΙ από το εκάστοτε δείγµα. Κατεβαίνει η κεφαλή, ονοµατίζεται το δείγµα και επιλέγεται το «measure». 4. Η συσκευή µετράει την απορρόφηση στα 230nm, στα 260nm και στα 280nm και το λογισµικό υπολογίζει την καµπύλη απορρόφησης, τον λόγο 260/280, τον λόγο 260/230 και την συγκέντρωση των δειγμάτων σε ng/µι. Α.7. Αντίδραση λιγάσης Το πρώτο στάδιο στην κλωνοποίηση των cdnas που συντέθηκαν µε τη RT-PCR, είναι η ένθεσή τους σε έναν πλασµιδιακό φορέα. Η ένθεση σε έναν τέτοιο φορέα εξυπηρετεί την εισαγωγή σε βακτήρια και την επιλογή των µετασχηµατισµένων (µε το κατάλληλο ένθεµα) βακτηρίων. Ο φορέας που χρησιµοποιήθηκε είναι ο pgem -T Easy o οποίος φέρει: ένα γονίδιο ανθεκτικότητας στην αµπικιλίνη, το συµπληρωµατικό γονίδιο της β-γαλακτοζιδάσης, lacz, για επιλογή των βακτηρίων που έχουν µετασχηµατισθεί από ανασυνδυασµένο πλασµίδιο, έναν πολυσυνδέτη εντός του lacz, µία ori και µία F1 ori περιοχή, τους υποκινητές Τ7 και SP6 εκατέροθεν της περιοχής ένθεσης.

64 pgem -T Easy Vector Sequence reference points: T7 RNA Polymerase transcription initiation site 1 multiple cloning region SP6 RNA Polymerase promoter ( 17 to +3) SP6 RNA Polymerase transcription initiation site 141 puc/m13 Reverse Sequencing Primer binding site lacz start codon 180 lac operator ß-lactamase coding region Εικόνα phage 36: f1 region O φορέας pgem-t Easy lac operon sequences , puc/m13 Forward Sequencing Primer binding site Για να γίνει επιτυχηµένα T7 RNA Polymerase η σύνδεση promoter φορέα-ένθεµατος ( 17 to +3) χρειάζεται περίπου τρεις φορές περισσότερο ένθεµα ώστε να υπάρχουν κατάλληλες συγκεντρώσεις άκρων προς σύνδεση. Μία συγκέντρωση ενθέµατος στην αντίδραση τρεις φορές µεγαλύτερη από του φορέα δίνει µια τιµή j/i~2-3 που δίνει πρόσδεση φορέα µε ένθεµα σε πολύ µεγάλη απόδοση σε σχέση µε τον αυτοπολυµερισµό του φορεά ή των ενθεµάτων. Γι αυτό πριν γίνει η αντίδραση της λιγάσης πρέπει από την συγκέντωση των προϊόντων της PCR να υπολογισθεί η ποσότητα που χρειάζεται να προστεθεί από το εκάστοτε προϊόν ώστε στον τελικό όγκο της αντίδρασης η τιμή του λόγου ενθέματος προς φορέα να είναι περίπου τρία. Η αντίδραση έγινε σε ξεχωριστό PCR tube για το κάθε cdna που επιλέχθηκε και περιελάµβανε τα παρακάτω: Αντιδραστήριο Όγκος αντίδρασης (10μl) Τελική Συγκέντρωση/Πυκνότητα c-dna 3,5μl Yπολογίστηκε από τον τύπο j/i

65 2xligation buffer (Ν.Ε. Βiolabs) 5μl 1x pgem Teasy Vector (Promega) 1μl 50ng/μl T4 DNA Ligase (3 Weiss units/µl) (Ν.Ε. Βiolabs) 0,5μl Τα σωληνάκια µε τις αντιδράσεις τοποθετήθηκαν στους 18 ο C overnight. Α.8. Κατασκευή τρυβλίων θρεπτικού υλικού για βακτηριακές καλλιέργειες Πριν τον µετασχηµατισµό των δεκτικών βακτηρίων µε τα προϊόντα της αντίδρασης λιγάσης, δηλαδή µε τους ανασυνδυασµένους φορείς, είναι απαραίτητο να φτιαχτούν τρυβλία µε κατάλληλο θρεπτικό υλικό για την ανάπτυξη των βακτηριακών καλλιεργειών. Για περίπου είκοσι plate προστίθενται σε µία κωνική φιάλητα παρακάτω: 500ml dd νερό 6,5gr nutrient E 7,5gr agar Στην συνέχεια καλύπτεται το στόµιο µε αλουµινόχαρτο και αποστειρώνεται. Όταν η θερµοκρασία του θρεπτικού LB πέσει αρκετά (για να µην καταστραφεί η amp) προσθέτουµε 500µΙ αµπικίλλινη αρχικής συγκέντρωσης 100mg/ml, ώστε να υπάρχει σε τελική συγκέντρωση 100µg/µΙ. Τέλος χύνεται το θρεπτικό υλικό όσο είναι ακόµα υγρό σε τρυβλία δίπλα σε φλόγα ώστε να έχουµε στείρες συνθήκες. Αφού το θρεπτικό υλικό στερεοποιηθεί πλήρως, απλώνεται οµοιόµορφα σε κάθε τρυβλίο 80µΙ X-gal µε την βοήθεια µίας πιπέτας Pasteur που έχει σχήµα Γ µε την βοήθεια της φλόγας. Αυτά τα τρυβλία είναι πλέον έτοιµα για ανάπτυξη και επιλογή των µετασχηµατισµένων αποικιών. Α.9. Mετασχηματισμός βακτηρίων E.coli Στόχος είναι να εισαχθούν σε δεκτικά βακτήρια οι ανασυνδυασµένοι φορείς που φέρουν ως ένθεµα το έκαστοτε cdna. Για να επιτευχθεί αυτό ακολουθείται η παρακάτω διαδικασία για κάθε ξεχωριστό προϊόν της αντίδρασης λιγάσης (για το cdna κάθε γονιδίου). 1. Προστίθενται 1ml υγρό θρεπτικό LB (το ίδιο µε αυτό των plate αλλά χωρίς άγαρ) σε ένα falcon των 5ml µε την χρήση αποστειρωµένης πιπέτας των 5ml µίας χρήσης και

66 πιστολιού αναρρόφησης. Η διαδικασία γίνεται σε αποστειρωμένες συνθήκες δίπλα σε φλόγα. 2. Μεταφέρονται τα falcon σε υδατόλουτρο στους 37 ο C για να αποκτήσει το θρεπτικό υλικό την κατάλληλη θερµοκρασία. 3. Βγαίνε τα eppendorf με 80μl δεκτικά βακτηριακά κύτταρα Ε.coli (N.E. Biolabs) από τους -80C και αφήνεται στον πάγο να ξεπαγώσει. 4. Μόλις ξεπαγώσουν τα βακτήρια, προστίθενται 5µΙ από την εκάστοτε αντίδραση λιγάσης στο eppendorf µε τα δεκτικά βακτήρια. 5. Αναδεύονται ήπια και παραμένουν στον πάγο για 40 λεπτά. 6. Γίνεται heatshock των βακτηρίων στους 42 ο C για 90 δευτερόλεπτα ακριβώς. 7. Τοποθετούνται τα βακτήρια πάλι στον πάγο για 5 λεπτά. 8. Προστίθενται τα δεκτικά βακτήρια στο θρεπτικό υλικό που ήταν στο υδατόλουτρο και επωάζονται στους 37 ο C για 1 ώρα. Αναδεύονται ήπια κάθε 15 λεπτά. 9. Λαµβάνονται από τo falcon 50 και 200µΙ δεκτικά κύτταρα και επιστρώνονται οµοιόµορφα στα τρυβλία µε την ίδια τεχνική που απλώθηκε το X-gal. Λαµβάνονται δύο διαφορετικοί όγκοι για να φανεί ποιός θα δώσει την σωστή πυκνότητα αποικιών. 10. Επωάζονται τα τρυβλία στους 37 ο C στον επωαστικό θάλαµο overnight. Α.10. Επιλογή μετασχηματισμένων βακτηρίων (bιue white screening) Αφού αναπτυχθούν αποικίες στα τρυβλία πρέπει να επιλεχθούν αυτές που προέρχονται από µετασχηµατισµένα βακτήρια τα οποία έχουν λάβει ανασυνδυασµένο πλασµιδιακό φορέα. Αυτά τα βακτήρια περιέχουν ως ένθεµα στο πλασµίδιο το επιθυµητό cdna για το εκάστοτε γονίδιο.

67 Τα βακτήρια τα οποία δεν έχουν πάρει καθόλου πλασµίδιο δεν αναπτύσονται στο θρεπτικό υλικό καθώς δεν έχουν ανθεκτικότητα στην αµπικιλλίνη. Τα βακτήρια που έχουν µετασχηµατισθεί λόγω του γονιδίου ανθεκτικότητας στην αµπικιλλίνη του φορέα, δύναται να σχηµατίσουν αποικίες. Τα βακτήρια που έχουν πάρει πλασµίδιο αλλά δεν είναι ανασυνδυασµένο, σχηματίζουν µπλέ αποικίες γιατί εκφράζουν το lacz που λείπει από το βακτηριακό χρωμόσωμα και υπάρχει στο πλασμίδιο. Έτσι µπορούν και διασπούν το υπόστρωµα Χ-gal δίνοντας µπλέ προϊόν. Τα βακτήρια µε ανασυνδιασµένο πλασµίδιο δεν έχουν ενεργή β-γαλακτοζιδάση και γι αυτό οι αποικίες τους είναι λευκές. Αυτές είναι και οι αποικίες που επιλέγονται να αναπτυχθούν γιατί περιέχουν το φορέα µε το κατάλληλο ένθεµα. Οι καλλιέργειες που θα επιλεγούν, θα αναπτυχθούν και σε νέο στερεό θρεπτικό υλικό και σε υγρό θρεπτικό για να γίνει η αποµόνωση του πλασµιδίου. Τα τρυβλία που θα εναποτίθενται οι επιλεγµένες αποικίες είναι ίδια µε αυτά που περιγράφθηκαν παραπάνω µε την διαφορά ότι δεν έχουν επιστρωθεί µε X-gal. Παροµοίως το υγρό θρεπτικό θα είναι σε αποστειρωµένα falcon των 15ml που θα περιέχουν 3ml υγρό θρεπτικό LB µε 3µΙ αµπικιλλίνη. Κατά την επιλογή ακολουθούµε τα παρακάτω βήµατα: 1. Για κάθε διαφορετικό cdna επιλέγεται ένα τρυβλίο LB-amp+, σηµειώνεται το όνοµα του αντίστοιχου γονιδίου και χωρίζεται σε 8 µε 10 περιοχές ανάλογα µε τον αριθµό των αποικιών/κλώνων που θα επιλεχθούν. Αριθµείται κάθε περιοχή. 2. Όσος είναι ο αριθµός των περιοχών του τρυβλίου, τόσα falcon µε υγρό θρεπτικό υλικό φτιάχνoνται και αριθµούνται σε αντιστοιχία.

68 3. Με λεπτό βακτηριολογικό αποστειρωµένο κρίκο µίας χρήσης επιλέγεται µία άσπρη αποικία από τις καλλιέργειες που επωάστηκαν στους 37 ο C το προηγούµενο βράδυ. 4. Ακουµπάται προσεκτικά ο κρίκος σε µία από τις περιοχές του νέου τρυβλίου ώστε κάποια βακτήρια να προσκοληθούν και στην συνέχεια προσεκτικά βυθίζεται στο υγρό θρεπτικό υλικό του falcon µε τον ίδιο αριθµό. 5. Πραγματοποιείται χτύπημα του κρίκου στον πάτο του falcon έτσι ώστε να αποκολληθούν όσο περισσότερα βακτήρια γίνεται και έπειτα κλείνεται το falcon. 6. Η παραπάνω διαδικασία επαναλαµβάνεται για κάθε αποικία που θα επιλεγεί και γίνεται κοντά σε φλόγα για να επικρατήσουν στείρες συνθήκες. 7. Τα τρυβλία αυτά που καλούνται και «master plates» τοποθετούνται στον επωαστικό θάλαµο στους 37 ο C overnight και τα falcon στον περιστρεφόµενο επωαστικό θάλαμο (για να οξυγονώνονται) στην ίδια θερµοκρασία και για το ίδιο διάστηµα. Την επόµενη ηµέρα τα τρυβλία που έχουν αναπτυχθεί οι αποικίες σφραγίζονται µε parafilm και τοποθετούνται στους 4 ο C, ενώ τα falcon στα οποία το θρεπτικό έχει θολώσει λόγω της ανάπτυξης των βακτηρίων, θα χρησιµοποιηθούν για αποµόνωση πλασµιδίων. Α.11. Απομόνωση πλασμιδίων (Mini-preps) Η αποµόνωση των πλασµιδίων από τα βακτήρια που αναπτύχθηκαν στο υγρό θρεπτικό υλικό έγινε µε το kit NucleoSpin Plasmid Easy Pure της εταιρείας MN. Τα βήµατα που ακολουθήθηκαν ήταν τα παραρκάτω: 1. Χρησιμοποιείται ίσος αριθμός eppendorf με αυτό των υγρών καλλιεργειών και ονομάζονται αντίστοιχα. 2. Γίνεται φυγοκέντρηση των falcon για 5 λεπτά στην µέγιστη ταχύτητα για να καθιζάνουν τα βακτήρια. 3. Αφαιρείται προσεκτικά το υπερκείµενο για να µην χαθεί το ίζηµα των βακτηρίων. 4. Επαναιωρείται το ίζηµα µε προσθήκη 250µΙ από το διάλυµα Α1 και γίνονται διαδοχικές αναρροφήσεις. 5. Μεταφέρεται το κάθε επαναιώρηµα στο αντίστοιχο eppendorf. 6. Προστίθενται 250µΙ από το Α2 δίαλυµα που είναι ισχυρά βασικό (SDS-Alkaline buffer) για να γίνει λύση των κυττάρων και γίνεται ανακίνηση 6-7 φορές. 7. Αφήνονται τα δείγµατα σε θερµοκρασία δωµατίου για 5 λεπτά για να γίνει πλήρως η λύση. 8. Προστίθενται 300µΙ Α3 διάλυµατος που είναι όξινο και εξουδετερώνει το ph και γίνεται ανακίνηση και πάλι. 9. Γίνεται φυγοκέντρηση για 10 λεπτά (11.000g) για να καθιζάνουν οι µεµβράνες, οι πρωτεΐνες και το χρωµοσωµικό DNA.

69 10. Γίνεται συλλογή του υπερκείµενου, που περιέχει τα πλασµίδια, µε προσοχή για να µην συλλεχθεί και το ίζηµα και µεταφέρεται στις κολώνες του kit. Τοποθετούνται οι κολώνες σε eppendorfs. 11. Γίνεται φυγοκέντρηση στις κολώνες για 1 λεπτό (11.000g) για να δεσµευτεί το πλασµιδιακό DNA σε αυτές. Απομακρύνεται το έκλουσμα. 12. Προστίθενται 500µΙ AW διάλυµα πλύσης το οποίο έχει προθερµανθεί στους 50 ο C. 13. Γίνεται φυγοκέντρηση για 1 λεπτό (11.000g) και απορρίπτεται το έκλουσμα. 14. Προστίθενται 600µΙ Α4 διάλυμα πλύσης. 15. Γίνεται φυγοκέντρηση για 1 λεπτό (11.000g) και απορρίπτεται το έκλουσμα. 16. Γίνεται ξήρη φυγοκέντρηση για 2 λεπτό (11.000g) για να φύγουν τα υπολείµµατα διαλυµάτων. 17. Μεταφέρονται οι κολώνες σε νέα eppendorf. 18. Προστίθενται 100µΙ ΑΕ διάλυµα έκλουσης και αφήνονται οι κολώνες σε θερµοκρασία δωµατίου για 1 λεπτό να επωαστούν. 19. Γίνεται φυγοκέντρηση για 1 λεπτό (11.000g) και διατηρείται το έκλουσµα το οποίο και περιέχει αποµονωµένο και καθαρισµένο το πλασµίδιο µε το cdna. Α.12. Kατάτμηση με ένζυμα περιορισμού Αφού αποµονωθούν τα πλασµίδια πρέπει να ελεγχθούν αν έχουν πάρει ως ένθεµα το επιθυµητό cdna. Αυτό γίνεται µε πέψη των πλασµιδίων µε ένζυµο περιορισµού και έλεγχο των προϊόντων µε ηλεκτροφόρηση. Τα πλασµίδια έχουν τις κατάλληλες θέσεις περιορισµού στον πολυσυνδέτη έτσι ώστε αν κοπεί στην προκειµένη περίπτωση µε το ένζυµο EcoR1 (και δεν έχει το ένθεµα θέση περιορισµού για το συγκεκριμένο ένζυμο), να παραχθούν δύο προϊόντα. Το ένα θα έχει το µήκος του πλασµιδίου και το άλλο του ενθέµατος. Έτσι συγκρίνοντας το µήκος του ενθέµατος µε αυτό του επιθυμητού cdna συμπεραίνεται αν πρόκειται για αυτό. Σε ξεχωριστό eppendorf για κάθε αποµονωµένο πλασµίδιο σηµειώνεται ο αριθµός της καλλιέργειας και το όνοµα του cdna σε αντιστοιχία και προστίθενται τα παρακάτω:

70 Aντιδραστήριο Όγκος Τελική Συγκέντρωση/Πυκνότητα DNA (plasmid) - 0,5-1μgr 10xEcoR1 buffer (N.E. Biolabs) 2μl 1x EcoR1 enzyme (20000 units/ml) (N.E. Biolabs) mq water 0,5μl Μέχρι τα 20 μι Επώαση σε υδατόλουτρο στους 37 ο C για 2 ώρες. Στην συνέχεια µε τον τρόπο που περιγράφθηκε παραπάνω ηλεκτροφορείται 1µΙ από κάθε αντίδραση για να εκτιµηθούν τα αποτελέσµατα. Τα αποµονωµένα πλασµίδια που βρέθηκε ότι περιέχουν το σωστό ένθεµα για το κάθε cdna φωτοµετρήθηκαν για να υπολογιστεί η συγκέντρωσή τους. Στην συνέχεια µεταφέρθηκαν σε νέο eppendorf µε το κατάλληλο όνοµα cdna και αριθµό κλώνου και 1-2µg από αυτά απεστάλησαν για αλληλούχιση. Α.13. Αλληλούχιση ενθεμάτων Η αλληλούχιση έχει τρεις κυρίως στόχους: Την επιβεβαίωση ότι το ένθεµα στο πλασµίδιο είναι το επιθυµητό cdna. Την εύρεση της διεύθυνσης ένθεσης για να επιλεγεί ο υποκινητής που δίνει νοηµατικό ή αντινοηµατικόµετάγραφο. Την επιλογή από τους κλώνους που περιέχουν το ίδιο ένθεµα, αυτών που έχουν υποστεί τις λιγότερεςµεταλλάξεις στο cdna. Η εταιρεία που ανέλαβε την αλληλούχιση πραγματοποίησε στα εργαστήρια της την τεχνική Sanger και τελικά έστειλε για κάθε κλώνο δύο χρωµατογραφήµατα, ένα από τον primer M13 forward και ένα από τον M13 reverse. Για την επεξεργασία των χρωµατογραφηµάτων και την κατασκευή των ολοκληρωµένων αλληλουχιών χρησιµοποιήθηκε το πρόγραµµα ebiox. Έκτος των παραπάνω µε το ebiox βρέθηκε η κατεύθυνση της ένθεσης του cdna στον φορέα και έγινε σύγκριση των αλληλουχιών διαφορετικών κλώνων µεταξύ τους. Αρχικά από τα δυο χρωµατογραφήµατα γίνετα κατασκευή της πλήρους αλληλουχίας και σύγκριση µε την αναµενόµενη αλληλουχία από την βάση δεδοµένων του Paracentrotus lividus. Στην συνέχεια µε in silico µετάφραση για όλα τα πιθανά αναγνωστικά πλαίσια γίνεται εύρεση του ανοιχτού αναγνωστικού πλαισίου που δίνει

71 την πρωτεΐνη σωστού µήκους. Ανάλογα µε την διεύθυνση του σωστού αναγνωστικού πλαισίου βρίσκεται και η κατεύθυνση της ένθεσης του cdna στο φορέα. Αφού γίνει αυτή η διαδικασία για όλους τους κλώνους του ίδιου cdna, οι αλληλουχίες τους (νουκλεοτιδικές και πρωτεϊνικές) συγκρίνονται µεταξύ τους και επιλέγεται αυτή µε τις λιγότερες αλλαγές στο cdna που δίνει ως αποτέλεσµα η βάση δεδοµένων για τον P.lividus Α.14. Αποθήκευση κλώνων Οι κλώνοι που απεστάλησαν για αλληλούχιση και ήταν οι κατάλληλοι, αποθηκεύτηκαν για µελλοντική χρήση στους -80 ο C. Για να γίνει αυτό ακολουθήθηκαν τα παρακάτω βήµατα: 1. Κατασκευή single colonies από τις «master plates» µε τους κλώνους. Με αποστειρωµένο βακτηριολογικό κρίκο µίας χρήσης απομονώνονται βακτήρια από µία περιοχή της master plate που έχει τον σωστό κλώνο. Σε τρυβλίο LB-amp+ γράφεται το όνοµα του cdna και ο αριθµός του κλώνου. Απλώνονται τα βακτήρια στο τρυβλίο. Παραμένει το τρυβλίο στον επωαστικό στους 37 ο C overnight. 2. Δηµιουργία παγωµένου stock. Από τα τρυβλία που επωάζονταν το προηγούµενο βράδυ, απομονώνεται µία µοναδιαία αποικία από κάθε κλώνο. Σε σωληνάκι των 3ml που έχει σηµειωθεί ο αριθµός κλώνου, όνοµα cdna και ηµεροµηνία, προστίθενται 0,5ml LB και 0,5µΙ αµπικιλλίνη. Βουτιέται στο θρεπτικό υλικό, ο κρίκος µε τον οποίο ελήφθη η αποικία. Επωάζoνται overnight τα σωληνάκια σε κινούµενο επωαστικό στους 37 ο C. Την επόµενη ηµέρα προστίθενται στα σωληνάκια 0,5ml διάλυµατος γλυκερόλης 20% και αποθηκεύονται στους -80 ο C. Α.15. PCR Αφού επιλεγούν οι καταλληλότεροι κλώνοι, πρέπει να πολλαπλασιαστούν τα ενθέµατα από τα αποµονωµένα πλασµίδια για να γίνει in vitro µεταγραφή µε µεγαλύτερη απόδοση. Αυτό γίνεται µε µία αντίδραση PCR για το κάθε ένθεµα, µε

72 κοινούς όµως εκκινητές οι οποίοι προσδένονται πάνω σε θέσεις του πλασµιδιακού φορέα, εξωτερικά του ενθέµατος. Εντός του τµήµατος που πολλαπλασιάζεται µε αυτούς τους primer είναι και οι υποκινητές (T7 και SP6) οι οποίοι είναι εκατέρωθεν του ενθέµατος. Οι primer αυτοί είναι οι M13 forward και M13 reverse και έχουν βέλτιστη θερµοκρασία υβριδοποίησης στους 58 ο C. Σε κάθε αντίδραση προστέθηκαν τα παρακάτω: Aντιδραστήριο Όγκος Συγκέντρωση/Πυκνότητα Polymerase (Taq)(N.E. Βiolabs) 10xReaction Buffer (standard for Taq) Primer rev (M13)(15μΜ) Primer for (M13) (15μΜ) 0,5μΙ 5μΙ 1μΙ 1μΙ 1x 0,3μM 0,3μM NTP mix (10mM) 1,5μΙ 0,3mM DNA (plasmid) - 1-3ngr MgCl2 (50mM) 1μΙ 1mM (Χρειάζονται 2.5mM. Τα 1,5 mm περιέχονται στο buffer.) mq water Μέχρι τα 50 μι Bήματα Θερμοκρασία Χρόνος ο C (ενεργοποίηση πολυμεράσης) ο C (αποδιάταξη) 20

73 3. 58 ο C (υβριδοποίηση primers) ο C (πολυμερισμός) 2 (1 /1 kb) 5. Eπιστροφή στο βήμα 2 για 35 φορές (τελειοποίηση άκρων, τελικός πολυμερισμός) ο C Τέλος M13 for: 5 CGC CAG GGT TTT CCC AGT CAC GAC 3 M13 rev: 5 TCA CAC AGG AAA CAG CTA TGAC 3 Πίνακας 4: To ζεύγος primers M13 Τα προϊόντα της PCR ηλεκτροφορήθηκαν, καθαρίστηκαν και φωτοµετρήθηκαν όπως έχει περιγραφεί παραπάνω. Α.16. In vitro μεταγραφή Μετά την αλληλούχιση είναι γνωστή η κατεύθυνση που έχει εισέλθει το έκαστοτε cdna στον πλασµιδιακό φορέα και ως εκ τούτου είναι υπολογίσιμο τι µετάγραφο θα δώσει κάθε ένας από τους δύο υποκινητές. Από την πλευρά του Μ13

74 forward primer υπάρχει ο υποκινητής της T7 RNA pol, ενώ από την πλευρά του Μ13 reverse primer υπάρχει ο υποκινητής της SP6 RNA pol. Ο στόχος µε την in vitro µεταγραφή είναι να κατασκευασθούν αντινοηµατικοί RNA ανιχνευτές από τα cdnas, που θα έχουν την δυνατότητα να υβριδοποιούνται με τα ενδογενή µετάγραφα των εµβρύων του αχινού. Άρα έχοντας βρεί µέσω του αναγνωστικού πλαισίου, ποιά κατεύθυνση δίνει νοηµατικό µετάγραφο, επιλέγεται να γίνει η µεταγραφή µε το ένζυµο που δίνει το αντινοηµατικό. Η in vitro µεταγραφή έγινε µε το kit mmessage mmachine της Ambion. Όλα τα αναλώσιµα αλλά και τα διαλύµατα που χρησιµοποιούνται σε αυτό το στάδιο, καθώς και σε κάθε πειραµατική διαδικασία που γίνεται χρήση RNA, επιβάλλεται να είναι RNAase free. Για να επιτευχθεί αυτό όλα τα στερεά αναλώσιµα που δεν είναι ήδη RNAase free πρέπει να βράσουν για 20 λεπτά σε dd νερό που έχει 200µΙ DEPC /λίτρο, και στην συνέχεια να αποστειρωθούν. Στα υγρά αντίθετα πρέπει να προστεθούν 100µΙ/λίτρο και να μπουν για αποστείρωση. Το DEPC (Diethylpyrocarbonate) αναστέλλει την RNAase µε οµοιοπολική µετατροπή, που απαιτεί θερµότητα, των καταλοίπων ιστιδίνης, λυσίνης, κυστεΐνης και τυροσίνης. Για κάθε επιλεγµένο cdna έγινε διαφορετική αντίδραση in vitro µεταγραφής σε eppendorf που περιείχε τα παρακάτω: Aντιδραστήριο Όγκος Τελική Συγκέντρωση/ Πυκνότητα DNA 500ngr NTPmix (10x) 2μI 1Χ 10xBuffer 2μI 1Χ Enzyme 2μI RNAse inhibitor 0,5μI RNAse free water Mέχρι τα 20μI Τα eppendorfs µε τις αντιδράσεις επωάζονται σε υδατόλουτρο στους 37 ο C για 2 ώρες. Στην συνέχεια προστίθεται 1µΙ DNAase σε κάθε αντίδραση και επωάζονται στους 37 ο C για 15 λεπτά. Η DNAase θα κόψει το DNA ώστε να µείνουν µόνο τα RNA µετάγραφα.

75 Μεταφέρονται eppendorfs σε υδατόλουτρο στους 70 ο C βαθµούς για 5 λεπτά για να σταµατήσει η λειτουργία της DNAase. Στην συνεχεία τοποθετούνται για 5 λεπτά στον πάγο. Πριν καθαρισθούν τα προϊόντα της in vitro µεταγραφής πρέπει να ελεγθούν αν είναι τα επιθυµητά µετάγραφα. Ο έλεγχος γίνεται µε ηλεκτροφόρηση που διαφέρει από αυτήν του DNA στην προετοιµασία των δειγµάτων. Δηλαδή, σε ένα eppendorf για κάθε δείγµα ποστίθεται: 1µΙ RNA 4µΙ DEP νερό 5µΙ από το 2xloading buffer για ηλεκτροφόρη RNA που παρέχεται µε το kit (περιέχει φορµαµίδιο για αποδιάταξη) Αφού προετοιµαστούν τα δείγµατα επωάζονται στους 70 ο C για 5 λεπτά ώστε να γίνει αποδιάταξη. Μαζί µε τα δείγµατα προετοιµάζεται και ο µάρτυρας που είναι συνολικό RNA extract από έµβρυα αχινoύ 16 κυττάρων και στο gel δίνει δυο ζώνες, του 18s rrna και του 28s rrna. Το καθάρισµα γίνεται σε στήλες πακεταρισμένου sephadex. Με αποστειρωµένη Pasteur προστίθεται το υλικό και αφαιρείται το DEP νερό στο οποίο ήταν διαλύµενα τα σφαιρίδια του. Όταν η κολώνα γεµίσει µέχρι πάνω, γίνεται φυγοκέντρηση για 1 λεπτό στα 1000g για να αποµακρυνθεί το επιπλέον νερό. Στην συνέχεια φορτώνεται το δείγµα στο κέντρο της κολώνας, γίνεται φυγοκέντρηση για 2 λεπτά στα 1000g και συλλέγεται το καθαρισµένο RNA σε RNAase-free eppendorf. Τέλος γίνεται φωτομέτρηση στο καθαρισµένο RNA στην ρύθµιση «RNA» του φωτοµέτρου. Α.17. Σήμανση των αντινοηματικών μεταγράφων Για να εντοπισθούν οι RNA ανιχνευτές όταν θα υβριδοποιηθούν εντός των εµβρύων πρέπει να σημανθούν. Η σήµανση στην προκειµένη περίπτωση γίνεται µε χηµική αντίδραση και ένωση µορίων DIG και DNP απευθείας πάνω στο RNA. Στην συνέχεια τα αντιγόνα µπορεί να εντοπισθούν µε αντισώµατα. Όλοι οι RNA ανιχνευτές σηµάνθηκαν σε αντιδράσεις που έγιναν σε PCR tubes. Τα kits που χρησιµοποιήθηκαν για την σήµανση ήταν το Label IT Digoxin Labeling Kit και το Label IT DNP Labelling Kit της εταιρείας Mirus.To πρωτόκολλο που ακολουθείται είναι το παρακάτω: 1. Σε PCR tube προστίθεται 1µg RNA υπολογίζοντας τον όγκο που απαιτείται από την µέτρηση του φωτοµέτρου (~1-2µΙ).

76 2. Συµπληρώνεται µε DEP νερό έως τελικό όγκο 8µΙ και γίνεται αποδιάταξη του RNA στους 70 ο C για 5 λεπτά. 3.Τοποθετούνται τα tubes στον πάγο για 2 λεπτά. 4. Προστίθενται 1µΙ 10xLabeling Buffer και 1µΙ DIG ή DNP reagent. 5. Επωάζονται τα tubes στους 37 ο C στον επωαστικό θάλαµο για 2 ώρες. 6. Προστίθενται 20µΙ DEP νερό. 7. Περνά το δείγµα δύο φορές από κολώνα sephadex για καθαρισµό και γίνεται συλλογή του ιχνηθετηµένου ανιχνευτή. ΠΡΟΣΟΧΗ!: Δεν γίνεται σε αυτό το στάδιο φωτομέτρηση του προϊόντος της αντίδρασης για προσδιορισµό της συγκέντρωσης του γιατί κάποιο συστατικό προκαλεί εσφαλµένες µετρήσεις. Ο κατασκευαστής υποστηρίζει ότι ο καθαρισµός δίνει έως και 100% της ποσότητας του RNA που προστέθηκε προς σήµανση. Β. Γονιδιακή καταστολή σε γονιμοποιημένα αυγά με ενέσεις με ΜΑSO Για να αποκτηθούν μονιμοποιημένα έµβρυα αχινού στο επιθυμητό στάδιο (για χρήση σε FISH σε διαφορετικά αναπτυξιακά στάδια) πρέπει πρώτα να γίνει συλλογή των γαμετών, τεχνητή γονιμοποίηση και καλλιέργεια των εμβρύων όπως αναφέρθηκε πριν. Όταν όμως πρόκειται να γίνει καταστολή του PlCoup-Tf με morpholinos και έπειτα χρωμογόνος in situ υβριδοποίηση, το πρωτόκολλο τροποποιείται σε ένα σημείο. Συγκεκριμένα η μόνη διαφορά είναι ότι μετά την συλλογή των γαμετών, στα γονιμοποιημένα ωάρια (σε 75 mi θαλασσινό νερό) με πιπέτα Pasteur προστίθενται 4 σταγόνες 0,5Μ citric acid για χημική απομάκρυνση του jelly coαt, γίνεται ανάδευση για 1 λεπτό, προστίθενται 18 σταγόνες Tris-HCl για αποκατάσταση του ph στο 8,3 για την επίτευξη γονιμοποίησης και γίνεται μηχανική αφαίρεση του jelly coαt που περιβάλλει τα ωάρια µε πέρασµα από γάζα. Στην συνέχεια τα ωάρια αυτά µεταφέρονται σε µικρά πλαστικά τρυβλία για να γίνει η γονιµοποίηση αλλά και να ενεθούν µε MASO (Morpholino anti-sense oligonucleotide). (Τα καπάκια έχουν επεξεργαστεί χημικά με την προσθήκη για 2 λεπτά θειικής πρωταμίνης και έχουν αποκτήσει αντίθετο φορτίο από αυτό της μεμβράνης των αυγών ώστε να συγκρατούν κολλημένα στον πάτο τα έμβρυα). Τα MASOs είναι ανάλογα νουκλεϊκών οξέων που αντί για τον δακτύλιο της πεντόζης έχουν ένα δακτύλιο morpholine. Τα MASOs διατηρούν συµπληρωµατικότητα µε τα νουκλεϊκά οξέα και µπορούν να προσδένονται στις συµπληρωµατικές τους

77 αλληλουχίες χωρίς να εκκινούν µηχανισµούς καταστροφής των δίκλωνων υβριδίων. Ταυτόχρονα όµως τα MASOs είναι ανθεκτικά στους ενδογενείς µηχανισµούς καταστροφής των κυττάρων, οπότε έχουν πολύ µεγάλο χρόνο ηµιζωής. Στις περισσότερες περιπτώσεις, όπως και στον Coup-TF τα MASOs είναι συµπληρωµατικά µε την αλληλουχία στις θέσεις έναρξης της µετάφρασης των µεταγράφων που στοχεύουν και δεν της επιτρέπουν να συµβεί. Κατ αυτόν τον τρόπο προκαλείται καταστολή (knockdown) της έκφρασης των αντίστοιχων πρωτεϊνών και των φαινοτύπων που οφείλονται σε αυτές. Τα ωάρια χωρίζονται σε 2 όµαδες, τα control και τα morphant έμβρυα: Για να αποκτηθούν control έμβρυα, τα ωάρια τοποθετούνται κάτω από το µικροσκόποιο και προστίθενται τρεις σταγόνες αραιωµένου σπέρµατος και παρακολουθείται η γονιµοποίηση. Όταν εµφανιστεί η µεµβράνη γονιµοποίησης στα περισσότερα από αυτά, τότε μπαίνουν σε θάλαµο στους 18 ο C για να αναπτυχθούν. Για να αποκτηθούν τα morphant έμβρυα, γονιµοποιούνται µε τον ίδιο τρόπο αλλά στην συνέχεια δέχονται microinjection ένα-ένα µε ΜΑSO έναντι του PlCoup-TF. Στην συνέχεια και αυτά τοποθετούνται σε θάλαµο στους 18 ο C για να αναπτυχθούν. Για 100μΙ injection solution: 20μΙ γλυκερόλη 20μΙ 1Μ PlCoup-Tf ΜΑSO (τελική συγκέντρωση 0,2mM) με αλληλουχία 5'ACTGCGATGGCGTTGAGGGAATCGAT3' 60μΙ mq νερό Έπειτα ανάδευση, φιλτράρισμα και spin για 10 δευτερόλεπτα. Μετά από είκοσι με εικοσι τέσσερις ώρες που τα control έµβρυα βρίσκονται στο στάδιο του γαστριδίου και τα morphants στο στάδιο του βλαστιδίου λόγω καθυστερημένης ανάπτυξης, συλλέγονται σε πηγαδάκια σε microtiter plates. Σε κάθε ζεύγος πηγαδιών, με control και morphant έμβρυα, θα µελετηθεί η έκφραση ενός εκ των γονιδίων για τα οποία κατασκευάστηκαν ανιχνευτές. Γ. Μονιμοποίηση εμβρύων για χρωμογόνο και διπλή φθορίζουσα in situ υβριδοποίηση Πρίν ξεκινήσει η χρωμογόνος in situ υβριδοποίηση στην οποία εξετάζεται η επίδραση της καταστολής του PlCoup-Tf με morpholinos στα υπό εξέταση γονίδια, πρέπει να µονιµοποιηθούν τα έµβρυα (τόσο τα control όσο και τα morphants) με τα

78 οποία θα γίνει το πείραµα. Για να επιτευχθεί αυτό ακολουθείται η παρακάτω διαδικασία: ΠΡΟΣΟΧΗ!: Όλη η διαδικασία γίνεται κάτω από το στερεοσκόπιο για να µην ροφώνται τα έµβρυα. 1. Αφού συλλεχθούν τα έµβρυα στην microtiter plate, γεµίζεται όλο το πηγαδάκι µε ASW (Artificial Sea Water). 2. Προστίθεται µία σταγόνα PFA 8% in ASW για να νεκρωθούν τα έµβρυα, να σταµατήσουν να κολυµπούν και να κατακαθίσουν στον πάτο του πηγαδιού. 3. Αφαιρείται το µισό του όγκου του πηγαδιού (περίπου 150µΙ) και προστίθενται PFA 8% µέχρι να γεµίσει το πηγαδάκι. 4. Αφήνονται τα έµβρυα σε θερμοκρασία για 1 ώρα ενώ συχνά αναταράσσονται. 5. Μετά το πέρας 1 ώρας και αφού τα έµβρυα καθιζάνουν, αφαιρείται όσο περισσότερο από το υπερκείµενο γίνεται και γεμίζεται το πηγαδάκι ξανά µε ASW. 6. Αφαιρείται και πάλι όσο περισσότερο γίνεται από το υπερκείµενο και προστίθενται 100% ΜeOH έως ότου γεµίσει το πηγαδάκι. 7. Επαναλαµβάνεται 3 φορες το βήµα 6 προσέχοντας στην αναρρόφηση γιατί ο σχηµατισµός αλάτων πολλές φορές εγκλωβίζει τα έµβρυα. 8. Κολλάται προστατευτικό αυτοκόλλητο πάνω στην microtiter plate και περιβάλλεται µε parafilm για την αποφυγή επαφής με τον αέρα. 9. Αποθηκεύονται τα έµβρυα στους -20 ο C για µελλοντική χρήση. Υλικά για την µονιµοποίηση: Artificial Sea Water (ASW): Για ποσότητα διαλύµατος 250ml ζυγίζονται και προσθέτονται σε DEP νερό υπό ανάδευση τα παρακάτω. Aντιδραστήριο KCl Ποσότητα 0,19gr NaCl 7,54gr

79 MgCl2.6H2O 1,73gr CaCl2.2H2O (Προστίθεται τελευταίο) 0,4gr MgSO4.7H2O 1,36gr EPPS 0,63gr Στην συνέχεια γίνεται ph µέτρηση και προσαρµογή του ph στα~8,2 µε χρήση ΝaΟΗ 1Μ. PFA 8% in ASW 1. Προστίθενται 4gr PFA σε falcon με 50ml νερό. 2. Θερµαίνεται στους 65 ο C στο υδατόλουτρο για αρκετή ώρα και γίνεται συχνά Vortex. 3. Όταν διαλυθεί πλήρως, αφήνεται ψυχθεί σε θερµοκρασία δωµατίου. 4.Προστίθενται 1ml 1Μ ΕPPS ph 8. 5.Αποθηκεύεται στους -20 ο C. Η παραπάνω διαδικασία ακολουθείται και για FISH για διαφορετικά αναπτυξιακά στάδια, μόνο που επειδή απαιτείται μεγαλύτερος όγκος μονιμοποιημένων εμβρύων η πορεία γίνεται σε σωληνάκια των 5ml. Δ. Χρωμογόνος in situ υβριδοποίηση H χρωμογόνος in situ υβριδοποίηση έχει στόχο τον ποιοτικό εντοπισµό της έκφρασης ενός γονιδίου σε µία περιοχή του εµβρύου. Αυτό επιτυγχάνεται µε υβριδοποίηση των σηµασµένων αντινοηµατικών RNA ανιχνευτών στις κυτταρικές περιοχές που υπάρχουν µετάγραφα των αντίστοιχων γονιδίων. Στην συνέχεια οι ανιχνευτές αυτοί που φέρουν DIG (διγοξιγενίνη), εντοπίζονται από αντισώµατα που είναι συνδεδεµένα µε το ένζυµο της αλκαλικής φωσφατάσης. Τελικά το ένζυµο αποφωσφωρυλιώνει την διαλυτή, διάφανη χρωστική BCIP στις περιοχές που έχουν υβριδοποιηθεί οι ανιχνευτές, η οποία με την σειρά της αντιδρά μέσω μιας αντίδρασης οξειδοαναγωγής με την διαλυτή, κίτρινη χρωστική NBT. To τελικό αποτέλεσμα είναι η παραγωγή µπλέ χρωστικής, η οποία κατακριµνίζεται στις περιοχές υβριδοποίησης των

80 ανιχνευτών. Η πειραµατική διαδικασία µπορεί να χωριστεί σε τρεις ηµέρες πειραµάτων: Ηµέρα 1 η Σηµαντικό είναι να τηρούνται RNAase-free συνθήκες, να αφήνονται τα έµβρυα να καθιζάνουν πριν το επόµενο βήµα και ότι όλοι οι χειρισµοί να γίνονται σε θερµοκρασία δωµατίου. 1. Αφαιρείται όσο περισσότερη µεθανόλη γίνεται (στην μεθανόλη ήταν αποθηκευµένα τα έµβρυα) και γεµίζεται το πηγαδάκι µε ΜΟPS Βuffer για να ξεπλυθούν τα έμβρυα από το µονιµοποιητικό διάλυμα. H παραμονή στο συγκεκριμένο διάλυμα διαρκεί περίπου 15 λεπτά. 2. Πραγματοποιούνται άλλα δύο πλυσίµατα µε MOPS Βuffer αφού έχουν καθιζάνει τα έµβρυα. 3. Αφαιρείται όσο περισσότερο από το MOPS Βuffer γίνεται και προστίθεται Ηybe Βuffer µε DEP νερό µέχρι να γεµίσει το πηγαδάκι για να ξεπλυθεί από το MOPS Βuffer. Τα έµβρυα στο Ηybe Βuffer είναι πολύ δυσδιάκριτα. 4. Αφαιρείται και πάλι όσο περισσότερο από το υπερκείµενο γίνεται και προστίθενται ξανά Ηybe Βuffer µε DEP νερό. Σηµείωση: Γίνονται πλύσεις µε δύο Ηybe Βuffer µε DEP νερό γιατί το δίαλυµα αυτό έχει φορµαµίδιο που είναι αποδιατακτικός παράγοντας και πρέπει να είναι σε ποσοστό~70% κατά την προυβριδοποίηση και την υβριδοποίηση. 5. Καλύπτεται η plate µε αυτοκόλλητο και μπαίνει σε φούρνο στους 50 ο C για προυβριδοποίηση για 5 µε 6 ώρες. 6. Σε eppendorf προστίθενται σε αναλογία 1:1 το προθερμασμένο (για 5 λεπτά) 2xΗybe Βuffer (δηλ. με κατάλληλη ποσότητα RNA ανιχνευτή ώστε σε τελικό όγκο 100µΙ να έχουµε συγκέντρωση~0,3-0,5ng/µι). Eπωάζονται στους 50 ο C για 3 μέρες. Ηµέρα 2 η Δεν απαιτούνται πλέον RNAase-free συνθήκες. 1. Μετά το πέρας των 3 ημερών, αφαιρούνται από το πηγαδάκι πολύ προσεκτικά 50µΙ του Ηybe Βuffer µε ανιχνευτή και προστίθενται 200µΙ Ηybe Βuffer µε mq νερό χωρίς t- RNA. Στην συνέχεια ξανακλείνεται µε αυτοκόλλητο η plate και μπαίνει στον φούρνο στους 50 ο C για 1 ώρα.

81 2. Επαναλαµβάνεται 2 φορές το βήµα 1 μόνο που αφαιρείται όσο το δυνατό περισσότερο υπερκείμενο. 3. Αφαιρείται σχεδόν όλο το υπερκείµενο και γεµίζεται το πηγαδάκι µε MOPS Βuffer. Παραμένουν τα έμβρυα σε αυτό το διάλυμα για περίπου 15 λεπτά. 4. Επαναλαµβάνεται το βήμα 3 αφαιρώντας όσο µεγαλύτερη ποσότητα υπερκείμενου γίνεται. 6. Αφαιρείται όσο περισσότερο από το ΜΟPS Βuffer γίνεται, γεµίζεται το πηγαδάκι µε Blocking Βuffer και επωάζονται τα έµβρυα σε αυτό για ½ µε 1h. 7. Ταυτόχρονα γίνεται blocking του Αnti-Dig αντισώµατος το οποίο είναι συνδεδεμένο με αλκαλική φωσφατάση (Roche) σε eppendorf µε Blocking Buffer σε αναλογία 1:1500 αντίσωµα/βuffer. 8. Τελικά αφαιρείται όσο περισσότερο γίνεται από το Blocking Buffer και προστίθενται 200µΙ από το διάλυµα Blocking Buffer-αντισώµατος. 9. Κλείνεται η plate µε αυτοκόλλητο και παραμένει στους 4 ο C overnight. Ηµέρα 3 η 1. Ξεπλένεται το διάλυµα του αντισώµατος αφαιρώντας όσο περισσότερο από το υπερκείµενο γίνεται και γεµίζοντας το πηγαδάκι µε MOPS Βuffer. 2. Επαναλαµβάνεται το βήµα 1 4 φορές. 3. Αφαιρείται όσο περισσότερο από το MOPS Βuffer γίνεται και γεμίζεται το πηγαδάκι µε AP Βuffer που προσφέρει το απαραίτητο μαγνήσιο για την δράση της φωσφατάσης. 4. Επαναλαβάνεται το βήµα 3 1 φορά. 5. Γίνονται 2 πλύσεις όπως παραπάνω με το διάλυµα AP/levamisol/Tween. Το levamisol απενεργοποιεί τις ενδογενείς φωσφατάσες των εμβρύων. 6. Αφαιρείται όσο περισσότερο γίνεται από το υπερκείµενο και προστίθενται µΙ Dye. 7. Περιβάλλεται η plate με αλουµινόχαρτο γιατί η χρωστική είναι φωτοευαίσθητη. Αφήνεται σε θερμοκρασία δωματίου. 8. Ανα διαστήµατα γίνεται παρατήρηση αν τα έµβρυα έχουν βάψει. Όταν και µόνο όταν βάψουν τα control έµβρυα, σταµατάται την αντίδραση.

82 9. Αν περάσει µεγάλο χρονικό διάστηµα και δεν έχει γίνει αυτό, αλλάζεται η χρωστική (αφαιρούνται 200µΙ παλιάς και προστίθενται 200µΙ νέας χρωστικής). 10. Όταν τα έµβρυα βάψουν, αφαιρείται όση περισσότερη από την χρωστική γίνεται και γεµίζεται το πηγαδάκι µε TBST/EDTA, για να σταµατήσει η αντίδραση. Το EDTA ως χηλικό αντιδραστήριο δεσμεύει τα ίοντα μαγνησίου του ΑΡ που είναι απαραίτητα για την οξειδοαναγωγική αντίδραση μετατροπής της άχρωμης ουσίας σε μπλε χρωστική. 11. Επαναλαµβάνεται το βήµα 10 άλλες 2 φορές. 12. Τέλος γίνονται 2 ξεπλύματα µε TBST σε όγκο 200µΙ. Υλικά για την χρωμογόνο in situ υβριδοποίηση: MOPS Βuffer (για τελικό όγκο 1ml) Αντιδραστήριο Όγκος Συγκέντρωση/Πυκνότητα 1M MOPS ph=7 100µΙ 0,1Μ 5M NaCl 100µΙ 0,5Μ 20% Tween 20 5µΙ 0,1% H2O (µε DEP για πριν 795µΙ την υβριδοποίηση,με mq για µετά) Hybridization (Hybe) Βuffer (για τελικό όγκο 1ml) Αντιδραστήριο Όγκος Συγκέντρωση/Πυκνότητα

83 100% Formamide 1M MOPS ph=7 700µΙ 70% 100µΙ 0,1Μ 100mg/ml BSA 10µΙ 1mg/ml 5M NaCl 100µΙ 0,5Μ 50µg/ml trna 5µΙ 250ng/ml 20% Tween 20 5µΙ 0,1% H2O (DEP ή mq αντίστοιχα όπως 80µΙ παραπάνω) Blocking Βuffer: Διαλύεται σε MOPS Βuffer, Ρerkin Εlmer Βlocking Reagent ώστε να δημιουργηθεί τελική συγκέντρωση του 0,5%w/v. AP buffer (για τελικό όγκο 50ml): Αντιδραστήριο Όγκος Συγκέντρωση/Πυκνότητα 1M Tris-HCl ph=9,5 5ml 0,1Μ 5M NaCl 1ml 0,1M 1M MgCl2 2,5mΙ 0,05Μ mq H2O 41,5ml

84 Διάλυµα AP/levamisole/Tween (για τελικό όγκο περίπου 5,2 ml): Αντιδραστήριο Όγκος Συγκέντρωση/Πυκνότητα AP buffer 5,2ml 1Μ Levamisole 26µΙ 20% Tween 20 26µΙ Dye (για τελικό όγκο 1ml): Αντιδραστήριο Όγκος Συγκέντρωση/Πυκνότητα Dimethylformamide 1M Tris-HCl ph=9,5 100µΙ 10% 100µΙ 0,1Μ 1M MgCl2 50µΙ 50mM 5M NaCl 20µΙ 0,1Μ 1M Levamisole 1µΙ 1mM NBT (NitroBlue 4,5µΙ Tetrazolium chloride, Roche)

85 BCIP (5-Bromo- 4-Chloro-3- Indolyl- Phosphate, Roche) 3,5µΙ mq-h2o 721µΙ Ε. Διπλή φθορίζουσα in situ υβριδοποίηση (double FISH) Με την τεχνική αυτή επιτυγχάνεται εντοπισμός DNA ή RNA. Συγκεκριμένα, γίνεται επιλογή συμπληρωματικής RNA αλληλουχίας για ανίχνευση του mrna στον ιστό, μια μέθοδος που χρησιμοποιείται όταν η γονιδιακή ενεργότητα χρειάζεται να ελεγχθεί. Το πιο σημαντικό όμως είναι μπορεί να επιτευχθεί ταυτόχρονη ανάλυση δύο ή και περισσότερων γονιδίων στο ίδιο δείγμα, χρησιμοποιώντας τις διαφορετικές ιδιότητες διέγερσης (excitation) και εκπομπής (emission) των φθoροχρωμάτων. Αυτή η τεχνική είναι γρήγορη, ακριβής, με υψηλή αvάλυση εικόνας ακόμα και για γονίδια με χαμηλά επίδεδα έκφρασης και με μεγάλη ευελιξία στην χρήση των ψευδοχρωμάτων. Τα βελτιστοποιημένα πρωτόκολλα έχουν κάποια κοινά χαρακτηριστικά: διατήρηση της μορφολογίας των ιστών, διαπερατότητα των ιστών για τους ανιχνευτές, αποτελεσματική σύνδεση των ανιχνευτών, μείωση του μη ειδικού σήματος. Για την επίτευξη των παραπάνω, καθοριστικοί είναι οι εξής παράμετροι: η μονιμοποίηση, η διαπερατότητα, οι συνθήκες υβριδοποίησης και ο μετά την υβριδοποίηση χειρισμός.

86 Περιληπτικά, ακολούνται τα εξής βήματα: 1. Σύνδεση του αντισώματος με το αντιγόνο (DIG ή DNP) που βρίσκεται πάνω στον αντινοηματικό ανιχνευτή. 2. Το αντίσωμα φέρει υπεροξειδάση. Το συγκεκριμένο ένζυμο όταν επωασθεί με Tyramide (TSA reagent), καταλύει την δημιουργία ελευθέρων ριζών TSA. 3. Oι ελεύθερες ρίζες TSA δημιουργούν ομοπολικούς δεσμούς με τα κατάλοιπα τυροσίνης των ενδογενών πρωτεϊνών κοντά στην υπεροξιδάση. Οι μη συνδεδεμένες ρίζες TSA δημιουργούν διμερή που απομακρύνονται με πλύσεις. Έτσι, όπου είναι εντοπισμένο το mrna, εκεί και μόνο εντοπίζεται το ένζυμο και το σήμα χωρίς να διαχεέται καθόλου. Η διαδικασία είναι η ακόλουθη: 1 η και 2 η μέρα Είναι ίδια με την πορεία που ακολουθείται στην χρωμογόνο in situ υβριδοποίηση με την μόνη διαφορά ότι όλες οι διαδικασίες πραγματοποιούνται σε eppendorf και όχι σε plate και σε όγκο 200μΙ περίπου. Επίσης το Anti-Dig (Roche) είναι συνδεδεμένο με υπεροξειδάση (και όχι με αλκαλική φωσφατάση) και αραιώνεται στο Blocking Reagent της Perkin Elmer. 3 η μέρα 1. Ξεπλένεται το διάλυµα του αντισώµατος αφαιρώντας όσο περισσότερο από το υπερκείµενο γίνεται και προσθέτοντας 200μΙ MOPS Βuffer. Σε αυτό το διάλυμα παραμένουν τα έμβρυα για 15 λεπτά. 2. Επαναλαµβάνεται το βήµα 1 4 φορές. 3. Ξεπλένεται το MOPS Βuffer αφαιρώντας όσο περισσότερο από το υπερκείµενο γίνεται και προσθέτοντας 200μΙ Αmplification Diluent (Perkin Elmer). Σε αυτό το διάλυμα παραμένουν τα έμβρυα για 15 λεπτά. 4. Ξεπλένεται το Αmplification Diluent αφαιρώντας όσο περισσότερο από το υπερκείµενο γίνεται και γεµίζοντας με 200μΙ Cy3 (Perkin Elmer)-Αmplification Diluent σε αναλογία 1:500 i. Σε αυτό το διάλυμα παραμένουν τα έμβρυα για 15 λεπτά. Από εδώ και στο εξής διατηρούνται τα έμβρυα στο σκοτάδι. 5. Ξεπλένεται το Cy3-Αmplification Diluent αφαιρώντας όσο περισσότερο από το υπερκείµενο γίνεται και γεµίζοντας με 200μΙ MOPS Βuffer. Σε αυτό το διάλυμα παραμένουν τα έμβρυα για 15 λεπτά.

87 6. Επαναλαµβάνεται το βήµα 5 4 φορές. 7. Ξεπλένεται το MOPS Βuffer αφαιρώντας όσο περισσότερο από το υπερκείµενο γίνεται και γεµίζοντας με 200μΙ 1% H2O2 για την απενεργοποίηση του ενζύμου. Σε αυτό το διάλυμα παραμένουν τα έμβρυα για 30 λεπτά. 8. Ξεπλένεται το διάλυμα του H2O2 αφαιρώντας όσο περισσότερο από το υπερκείµενο γίνεται και γεµίζοντας με 200μΙ MOPS Βuffer. Σε αυτό το διάλυμα παραμένουν τα έμβρυα για 15 λεπτά. 9. Επαναλαµβάνεται το βήµα 8 4 φορές. 10. Αφαιρείται όσο περισσότερο από το ΜΟPS Βuffer γίνεται, και προστίθενται 200 μι Blocking Reagent της Perkin Elmer και επωάζονται τα έµβρυα σε αυτό για ½ µε 1 ώρα. 7. Ταυτόχρονα γίνεται blocking του Αnti-DΝΡ αντισώµατος το οποίο είναι συνδεδεμένο με αλκαλική φωσφατάση (Perkin Elmer) σε eppendorf µε Blocking Reagent της Perkin Elmer σε αναλογία 1:1500 αντίσωµα/βuffer. 8. Τελικά αφαιρείται όσο περισσότερο γίνεται από το Blocking Buffer και προστίθενται 200µΙ από το διάλυµα Blocking Buffer-αντισώµατος. 9. Παραμένουν τα έμβρυα στους 4 ο C overnight. 4 η μέρα 1. Ξεπλένεται το διάλυμα του αντισώματος αφαιρώντας όσο περισσότερο από το υπερκείµενο γίνεται και γεµίζοντας με 200μΙ MOPS Βuffer. Σε αυτό το διάλυμα παραμένουν τα έμβρυα για 15 λεπτά. 2. Επαναλαµβάνεται το βήµα 1 4 φορές. 3. Ξεπλένεται το MOPS Βuffer αφαιρώντας όσο περισσότερο από το υπερκείµενο γίνεται και προσθέτοντας 200μΙ Αmplification Diluent (Perkin Elmer). Σε αυτό το διάλυμα παραμένουν τα έμβρυα για 15 λεπτά. 4. Ξεπλένεται το Αmplification Diluent αφαιρώντας όσο περισσότερο από το υπερκείµενο γίνεται και γεµίζοντας με 200μΙ Cy5 (Perkin Elmer)-Αmplification Diluent σε αναλογία 1:500 ii. Σε αυτό το διάλυμα παραμένουν τα έμβρυα για 15 λεπτά. 5. Ξεπλένεται το Cy5-Αmplification Diluent αφαιρώντας όσο περισσότερο από το υπερκείµενο γίνεται και γεµίζοντας με 200μΙ MOPS Βuffer. Σε αυτό το διάλυμα παραμένουν τα έμβρυα για 15 λεπτά.

88 6. Επαναλαµβάνεται το βήµα 5 4 φορές. Σε κάθε περίπτωση μετά τις υβριδοποίσεις, τα έμβρυα διατηρούνται στο ψυγείο (εάν έχουν φθορόχρωμα, προστατευμένα από το φως) σε διάλυμα 1:1 γλυκερόλη/ MOPS Βuffer. Όταν είναι να παρατηρηθούν σε φωτονικό (μετα από χρωμογόνο υβριδοποίηση) ή σε συνεστιακό μικροσκόπιο (μετά από φθορίζουσα), σε μια καλυπτρίδα προστίθενται περίπου 15μΙ αραιωμένων εμβρύων. Στην περίπτωση της φθορίζουσας υβριδοποίσης, προστίθεται και 1μΙ DAPI (working solution) για να διακριθούν οι πυρήνες. Έπειτα καλύπτονται με καλυπτρίδα προσέχωντας να διασφαλίζεται η μορφολογία και η τρισδιάστατη δομή των εμβρύων. Ζ. Απομόνωση RNA (περίπου 1,5 μgr) από μικρό αριθμό control και ενεμένων εμβρύων για Q-PCR Για την ποσοτική εκτίμηση της επίδρασης της καταστολής του PlCoup-TF στα γονίδια της νευρογένεσης ήταν απαραίτητη η απομόνωση RNA από control και ενεμένα έμβρυα (20 ώρες περίπου μετά την γονιμοποίηση) και η χρήση αυτού ως υπόστρωμα για Q-PCR. Η διαδικασία που ακολουθήθηκε ήταν η παρακάτω: 1. Συλλογή των εμβρύων (από τα πλαστικά καπάκια που αναπτύσσονταν) σε eppendorf. 2. Φυγοκέντρηση για 5 λεπτά (300g) και απομάκρυνση του υπερκείμενου θαλασσινού νερού. 3. Ελαφρύ χτύπημα του eppendorf. Προσθήκη 350μΙ RLT (διαλύματος λύσης). Vortex ή πιπετάρισμα για ομογενοποίηση. 4. Προσθήκη (στο διάλυμα των λυμένων κυττάρων) ενός όγκου 70% αιθανόλης, δηλ. 350μΙ.Πιπετάρισμα και ελαφρύ χτύπημα του eppendorf. 5. Μεταφορά σε κολώνα του kit που από κάτω φέρει 2mI tube. Φυγοκέντρηση για 15 δευτερόλεπτα (8000g). Απόρριψη εκλούσματος. 6. Προσθήκη 350μΙ RW1 (διαλύματος πλύσης) στην κολώνα. Φυγοκέντρηση για 15 δευτερόλεπτα (8000g). Απόρριψη εκλούσματος. 7. Προσθήκη 10μΙ DNAase I σε 70μΙ RDD (για πέψη DNA). Απαλή ανακίνηση. Προσθήκη αυτού στην κολώνα. Αναμονή σε θερμοκρασία δωματίου για 15 λεπτά. 8. Προσθήκη 350μΙ RW1 (διαλύματος πλύσης) στην κολώνα. Φυγοκέντρηση για 15 δευτερόλεπτα (8000g). Απόρριψη εκλούσματος. 9. Προσθήκη 500μΙ RPE (διαλύματος πλύσης) στην κολώνα. Φυγοκέντρηση για 15 δευτερόλεπτα (8000g). Απόρριψη εκλούσματος.

89 10. Προσθήκη 500μΙ 80% αιθανόλης (διαλύματος πλύσης) στην κολώνα. Φυγοκέντρηση για 2 λεπτά (8000g). Απόρριψη εκλούσματος και tube. 11. Ξηρή φυγοκέντρηση για 5 λεπτά (full spead). Απόρριψη εκλούσματος και tube. 12. Προσθήκη 25 μι DEP νερό (για έκλουση) στην κολώνα. Φυγοκέντρηση για 1 λεπτό (full spead). 13. Φύλαξη στους -80 ο C. H παραπάνω διαδικασία πραγματοποιήθηκε με το Qiagen RNAase Micro Kit και χρησιμοποίηθηκαν περίπου 500 έμβρυα σε κάθε ομάδα control ή ενεμένων εμβρύων για κάθε μελετηθέν γονίδιο, με 3ngr RNA/έμβρυο (ή αλλιώς 1,5μgr συνολικά) και περίπου 250 κύτταρα/βλαστίδιο (ή αλλιώς κύτταρα συνολικά) και 400 κύτταρα/γαστρίδιο (ή αλλιώς κύτταρα συνολικά). Η. Q-PCR από RNA control και ενεμένων εμβρύων Θερμοκρασία Χρόνος 37 ο C ο C 5 4 ο C Χρησιμοποιώντας ως υπόστρωμα το απομονωμένο RNA control και ενεμένων εμβρύων, φτιάχτηκαν cdnas για μελλοντική χρήση σε QPCR πειράματα. Συγκεκριμένα ακολουθήκε η παρακάτω πορεία: 1. Φυγοκέντρηση υπό κενό των δειγμάτων έως ότου επέλθει ξήρανση. Επαναδιάλυση σε 13 μι DEP νερό με συνεχές ελαφρύ χτύπημα του eppendorf σε θερμοκρασία δωματίου για 30 λεπτά. 2. Για την αποδιάταξη των δευτερογενών δομών, απαιτείται παραμονή των δειγμάτων στους 65 ο C για 3 λεπτά και έπειτα στον πάγο. Αφού προστεθούν τα παρακάτω αντιδραστήρια, ακολουθείται το πρόγραμμα που περιγράφεται.

90 Aντιδραστήριο (στον πάγο) Όγκος Diluted RNA Enzyme mix Oligo dt primer (50 μμ) 5xBuffer 13μΙ 1μI 1μI 4μΙ Random 6mers (100μΜ) 1μI To c-dna μπορεί να χρησιμοποιηθεί ως υπόστρωμα για την Q-PCR που περιλαμβάνει τα ακόλουθα αντιδραστήρια και ακολουθεί το παρακάτω πρόγραμμα. Τα πειράματα QPCR πραγματοποίηθηκαν και σε άλλες θερμοκρασίες, όμως αυτές που παρουσιάζονται είναι οι πιο αποδοτικές. Επίσης χρησιμοιήθηκε με λιγότερη επιτυχία και ένα δεύτερο ζευγάρι primer για κάθε γονίδιο. Παρακάτων παρουσιάζονται οι αλληλουχίες των primer που χρησιμοποήθηκαν τελικά. Aντιδραστήριο SyBr Green 2x (KAPA) ΒSA (2,5mg/mI) Primer F (10μΜ) Primer R (10μΜ) Όγκος 5μΙ 1μΙ 0,2μΙ 0,2μΙ cdna ή mq Η2Ο 2μΙ mq Η2Ο Mέχρι τα 10μΙ

91 Bήματα Θερμοκρασία Χρόνος Activate Taq 01:30 ή 02:00 95 ο C Cycling 00:02 95 ο C 00:20 57 ο C ή 59 ο C 00:01 ή 00:04 72 ο C Dissociation 00:00 95 ο C 00:15 65 ο C 00:00 95 ο C Cooling 00:30 40 ο C z81 For: 5 AACTCCTGCGATTCTGGTCA 3 Rev: 5 TGTCCAACTTGCCTCAAACG 3 FoxG For: 5 AGAGTCGTTCAGCGGAGATT 3 Rev: 5 TCGGGACCCCTTCTACCTTA 3 Hbn For: 5 AATGGACCTTGTGAGCTGGA 3 Rev: 5 CTTTCTCAGCAGGCGACATC 3 Coup-TF For: 5'GCCAGTTGGAGGTTAGATGTTA3' Rev: 5'CTGCGGTAATGTGTTGTTTGGA3' Ub For: 5'-CACTGGCAAGACCATCACCC-3' Rev: 5'-GAGAGAGTGCGGCCATCCTC-3' Πίνακας 5: To ζεύγος primers κάθε γονιδίο που χρησιμοποιήθηκε στην Q-PCR Η SyBr Green περιέχει και τα υπόλοιπα απαραίτητα αντιδραστήρια για την αντίδραση, όπως την πολυμεράση και τα νουκλεοτίδια, και προστίθενται τελευταία για την αποφυγή του φωτός και της επίδρασης της θερμοκρασίας δωματίου στο ένζυμο. Επίσης η προστιθέμενη ποσότητα υποστρώματος εξαρτάται από την αραίωσή του και το mq Η2Ο προστίθενται αντί για το υπόστρωμα για να ελεγχεί ο πιθανός σχηματισμός παραπροϊόντών. Επίσης, όπου υπάρχουν δύο επιλογές για θερμοκρασίας,

92 οι πρώτες τιμές αναφέρονται στα γονίδια της ουμπικουιτίνης (γονίδιο αναφοράς), του FoxG και Coup-TF, ενώ οι δεύτερες στο Hbn και z81. Tα προϊόντα των αντιδράσεων στάλθηκαν για sequencing στην εταιρεία VBC μετά από καθαρισμό για απομάκρυνση της SyBr.


94 Α. Προετοιμασία ανιχνευτών για χρωμογόνο και διπλή φθορίζουσα in situ υβριδοποίηση Για την κατασκευή σημασμένων RNA ανιχνευτών πραγματοποιήθηκε μια σειρά πειραμαμάτων όπως κλωνοποίηση των c-dnas, in vitro μεταγραφή και σήμανση με αντιγόνα όπως το Dig. Στο τέλος κάθε βήματος γινόταν έλεγχος των αποτελεσμάτων της εκάστοτε διαδικασίας για την επιτυχή συνέχιση των πειραμάτων. Α.1. Αποτελέσματα διαβαθμισμένης RT-PCR Χρησιμοποίηθηκαν 2 ζεύγη primers για κάθε γονίδιο και το καθένα ζεύγος εξετάσθηκε σε 3 διαφορετικές θερμοκρασίες όπως ειπώθηκε. Εικόνα 37: Tα προϊόντα της διαβαθμισμένης RT-PCR Επιλέχθηκαν για την συνέχεια της πειραματικής πορείας, λόγω σωστού μεγέθους και μεγάλης απόδοσης, τα εξής προϊόντα αντίστροφης μεταγραφής: Z1, Z2, Z3: Mε μήκος 1984 nts που αντιπροσωπεύει το z81. Φαίνεται πως και οι τρεις θερμοκρασίες λειτουργούν αποδοτικά με το πρώτο ζευγάρι. H6: Mε μήκος 1648 nts που αντιπροσωπεύει το Ηbn. Φαίνεται πως η θερμοκρασία των 60 ο C λειτουργεί αποδοτικά στο δεύτερο ζευγάρι. F4, F5, F6: Mε μήκος 1726 nts που αντιπροσωπεύει το FoxG. Φαίνεται πως και οι τρεις θερμοκρασίες λειτουργούν αποδοτικά με το δεύτερο ζευγάρι. Ως μάρτυρας χρησιμοποιήθηκε 1kb ladder.

95 Α.2. Aποτελέσματα κατάτμησης με ένζυμα περιορισμού και της αλληλούχισης των κλώνων Προκειμένου να ελεγθεί εάν κλωνοποιείται η σωστή αλληλουχία κάθε γονιδίου κατατμήθηκαν τα ανασυνδυασμένα πλασμίδια με ένζυμο περιορισμού που υπάρχει σε δύο θέσεις του πολυνδέτη εκατέρωθεν του ενθέματος. Έπειτα τα προϊόντα της πέψης απεστάλησαν για αλληλούχιση. Εικόνα 38: Tα προϊόντα της κατάτμησης με ένζυμο περιορισμού σε πήκτωμα αγαρόζης Oι κλώνοι που βρέθηκε μετά από αλληλούχιση ότι περιέχουν το σωστό ένθεμα είναι ο Ζ12 (z81), ο F11 (FoxG) και ο Η1 (Hbn) και με αυτούς συνεχίσθηκε η πειραματική πορεία (οι υπόλοιποι εικονιζόμενοι φαίνονταν να έχουν το σωστό μήκος και να μην έχουν πολλά παραπροϊόντα και γι αυτό στάλθηκαν για αλληλούχιση, όμως δεν είχαν σωστή αλληλουχία). Ως μάρτυρας χρησιμοποιήθηκε 1kb ladder. *O Coup-TF είχε ήδη υποστεί αντίστροφη μεταγραφή, κλωνοποιηθεί σε βακτηριακό φορέα και επιλεγεί ο σωστός κλώνος από άλλα μέλη του εργαστηρίου. Μετά από αλληλούχιση προσδιορίσθηκαν οι παρακάτω σωστές αλληλουχίες: Για το c-dna του z81 (κλώνος Ζ12 CTGWAACWMATATAGGGCGATTGGGCCCGACGTCGCATGCTCCCGGCCGCCATGGCGGCC GCGGGAATTCGATTCAACGACTGGTGTTGTGTCACTGGTTGTTTTTGTTTTCTTAAGTTT TGAGATGTCCGTTTTCTGTCCGTCTTTCTGTTGTTTGCATACAGTAGATGCCACAATTTG CAAAACCTTTTTCACAGCATCGTTTGCAGGACTTGTCAGAGGAGTTGTGCTTCCGTTTTC CTGCGTCTCATTGCTTGGTTGACCTTGAACAGAACCATCAGCGTTTGGTATCTTGATGTG AAGAGGAGTCATGTAAGCTGTTGAACCACTCTTTGGCTCAGTTAAAGGTCTGGATTCACT AGTGTCTAAGTCACTGACAGGAGATTGCAAAACTGGCGAGGGAAGGCTGTTGATTACTTT GACAGGAGGAACTCCTGCGATTCTGGTCAGGGCTGGAGGTTGCTCCTTCACAGGTGAGCA CTTTTTGCTGCTTATGTGAGAGCTGTAGGAACCAGAGTGTGAGAAGCGTTTGAGGCAAGT



98 Eπίσης φτιάχτηκαν με το πρόγραμμα DNADynamo οι ακόλουθοι γενετικοί χάρτες βάσει της κατεύθυνσης ένθεσης των γονιδίων. Εικόνα 39: O γενετικός χάρτης που αποκαλύπτει την φορά ένθεσης του Ηbn στον πλασμιδιακό φορέα Εικόνα 40: O γενετικός χάρτης που αποκαλύπτει την φορά ένθεσης του FoxG στον πλασμιδιακό φορέα Εικόνα 41: O γενετικός χάρτης που αποκαλύπτει την φορά ένθεσης του z81 στον πλασμιδιακό φορέα

99 Φαίνεται λοιπόν ότι για την παραγωγή αντινοηματικών RNA ανιχνευτών πρέπει να χρησιμοποιηθεί η Sp6 pol για το Ηbn και η Τ7 pol για τα δύο άλλα γονίδια. Α.3. Αποτελέσματα PCR Oι σωστοί κλώνοι πολλαπλασιάσθηκαν με την μέθοδο της PCR. Εικόνα 42: Tα προϊόντα της PCR σε πήκτωμα αγαρόζης Μετά από αντίδραση PCR φαίνονται τα κατάλληλα προϊόντα: z81: 1984 nts, FoxG: 1726 nts, Hbn: 1648 nts, Coup-TF: 1500 nts Ως μάρτυρας χρησιμοποιήθηκε 1kb ladder.

100 Α.4. Αποτελέσματα in vitro μεταγραφής Τα προϊόντα της PCR υποβλήθηκαν σε in vitro μεταγραφή για την παραγωή των αντινοηματικών RNA ανιχνευτών. Εικόνα 43: Tα προϊόντα της in vitro μεταγραφής σε πήκτωμα αγαρόζης Μετά από αντίδραση PCR φαίνονται τα κατάλληλα προϊόντα: z81: 1984nt, FoxG: 1726nt, Hbn: 1648nt, Coup-TF: 1500nt O µάρτυρας είναι συνολικό RNA extract από έµβρυα αχινoύ 16 κυττάρων και στο gel δίνει δυο ζώνες, του 18s rrna και του 28s rrna.

101 Β. Συνεντοπισμός της έκφρασης του PlCOUP-TF και των γονιδίων της νευρογένεσης σε ώριμα αναπτυξιακά στάδια Β.1. Ιστοειδικός εντοπισμός της έκφρασης του PlCOUP-TF και του Plz81 σε ώριμα αναπτυξιακά στάδια Β.1.α. Ιστοειδική έκφραση του PlCOUP-TF σε ώριμα αναπτυξιακά στάδια Στο στάδιο του βλαστιδίου (Α), παρουσιάζεται έντονη έκφραση στη φυτική πλάκα, τα μεσεγχυματικά κύτταρα και το ήμισυ του εμβρύου που θα αποτελέσει στην συνέχεια το στοματικό εξώδερμα. Βεβαίως διαφαίνεται παρουσία μεταγράφων σε κάποιες συγκεκριμένες περιοχές του μελλοντικού ΑΝΕ και της βλεφαριδωτής ζώνης. Στο στάδιο του γαστριδίου (Β), συσσωρεύεται στο στοματικό εξώδερμα, σε συγκεκριμένες περιοχές του μελλοντικού ΑΝΕ και της βλεφαριδωτλης ζώνης, στο έντερο, στη βάση του αρχεντέρου και τα σκελετογόνα κύτταρα. Στο στάδιο του πλουτέα (C), φαίνεται ξεκάθαρα έντονη έκφραση στη βλεφαριδωτή ζώνη, το ΑΝΕ, το στόμα, το αρχικό, μέσο και τελικό τμήμα του εντέρου, την έδρα και τα οπίσθια μεσεγχυματικά κύτταρα. Β.1.β. Ιστοειδική έκφραση του Plz81 σε ώριμα αναπτυξιακά στάδια Στο στάδιο του βλαστιδίου (Α), παρατηρείται έντονη έκφραση στο αντιστοματικό και πλευρικό εξώδερμα/βλεφαριδωτή ζώνη, στο μελλοντικό ΑΝΕ και στα μεσεγχυματικά κύτταρα. Στο στάδιο του γαστριδίου (Β) εκφράζεται σε μεμονωμένα κύτταρα της αντιστοματικής γωνίας του ΑΝΕ και της μελλοντικής Εικόνα 44: Ιστοειδικός εντοπισμός της έκφρασης του PlCOUP-TF και του Plz81 σε ώριμα αναπτυξιακά στάδια βλεφαριδωτής ζώνης, στο εμπρόσθιο έντερο και στα μεσεγχυματικά κύτταρα. Στο στάδιο του πλουτέα (C), η έκφραση εντοπίζεται σε όλο έντερο και στην ζωική πλάκα του εμπρόσθιου νευροεξωδέρματος, σε διακεκομένες περιοχές

102 της βλεφαριδωτής ζώνης και στα οπίσθια μεσεγχυματικά κύτταρα. Β.1.γ. Συνεντοπισμός της έκφρασης του PlCOUP-TF και του Plz81 σε ώριμα αναπτυξιακά στάδια Στο στάδιο του βλαστιδίου (Α), συνεντοπισμός της έκφρασης των δύο γονιδίων παρατηρείται στη φυτική πλάκα, τα μεσεγχυματικά κύτταρα και σε κάποιες συγκεκριμένες περιοχές του μελλοντικού ΑΝΕ και της βλεφαριδωτής ζώνης. Στο στάδιο του γαστριδίου (Β), συνέκφραση παρατηρείται σε συγκεκριμένες περιοχές του μελλοντικού ΑΝΕ και της βλεφαριδωτής ζώνης και τα σκελετογόνα κύτταρα. Στο στάδιο του πλουτέα (C), διακρίνεται συνεντοπισμός σε διακεκομένες περιοχές της βλεφαριδωτής ζώνης, στο ΑΝΕ, στο έντερο και τα οπίσθια μεσεγχυματικά κύτταρα. Β.1.δ. Διαφοροποίηση της έκφρασης PlCOUP-TF και του Plz81 σε ώριμα αναπτυξιακά στάδια Το Plz81 φαίνεται σε όλα τα στάδια και σε όλες τις περιοχές να συνεντοπίζεται με το PlCOUP-TF, εκτός από το στάδιο του βλαστιδίου όπου το πρώτο εντοπίζεται στο αντιστοματικό εξώδερμα και το δεύτερο στο στοματικό εξώδερμα. Β.2. Ιστοειδικός εντοπισμός της έκφρασης του PlCOUP- TF και του PlHbn σε ώριμα αναπτυξιακά στάδια Β.2.α. Ιστοειδική έκφραση του PlCOUP-TF σε ώριμα αναπτυξιακά στάδια O συγκεκριμένος μεταγραφικός παράγοντας παρουσιάζει παρόμοια ιστοειδική έκφραση με παραπάνω σε όλα τα στάδια. Εικόνα 45: Ιστοειδικός εντοπισμός της έκφρασης του PlCOUP-TF και του PlΗbn σε ώριμα αναπτυξιακά στάδια Β.2.β. Ιστοειδική έκφραση του PlHbn σε ώριμα αναπτυξιακά στάδια Στο στάδιο του βλαστιδίου (Α), η έκφραση παρατηρείται στο μελλοντικό ΑΝΕ. Στο στάδιο του γαστριδίου (Β) εκφράζεται επίσης στo μελλοντικό ΑΝΕ. Στο στάδιο του πλουτέα (C), η έκφραση εντοπίζεται στα

103 στοματικά γάγγλια και σε διασκορπισμένα κύτταρα της ζωικής πλάκας. Β.2.γ. Συνεντοπισμός της έκφρασης του PlCOUP-TF και του PlHbn σε ώριμα αναπτυξιακά στάδια Στο στάδιο του βλαστιδίου (Α), συνεντοπισμός παρατηρείται σε κάποιες συγκεκριμένες περιοχές του μελλοντικού ΑΝΕ. Στο στάδιο του γαστριδίου (Β), συνέκφραση φαίνεται σε συγκεκριμένες περιοχές του μελλοντικού ΑΝΕ επίσης. Στο στάδιο του πλουτέα (C), εντοπίζεται έκφραση και των δύο γονιδίων σε διασκορπισμένα κύτταρα της ζωικής πλάκας. Β.2.δ. Διαφοροποίηση της έκφρασης PlCOUP-TF και του PlHbn σε ώριμα αναπτυξιακά στάδια Το PlHbn φαίνεται σε όλα τα στάδια και σε όλες τις περιοχές να συνεντοπίζεται με το PlCOUP-TF. Στο στάδιο του βλαστιδίου, γαστριδίου και πλουτέα όμως, φαίνονται κάποια κύτταρα του μελλοντικού νευροεξωδέρματος να εκφράζουν είτε το ένα είτε το άλλο γονίδιο μόνο. Τέλος, στο στάδιο του πλουτέα, δεν φαίνεται έντονη έκφραση του PlCOUP-TF στα στοματικά γάγγλια. Β.3. Ιστοειδικός εντοπισμός της έκφρασης του PlCOUP-TF και του PlFoxG σε ώριμα αναπτυξιακά στάδια Β.3.α. Ιστοειδική έκφραση του PlCOUP-TF σε ώριμα αναπτυξιακά στάδια O συγκεκριμένος μεταγραφικός παράγοντας παρουσιάζει παρόμοια έκφραση με παραπάνω σε όλα τα στάδια. Eικόνα 46: Ιστοειδικός εντοπισμός της έκφρασης του PlCOUP-TF και του PlFoxG σε ώριμα αναπτυξιακά στάδια Β.3.β. Ιστοειδική έκφραση του PlFoxG σε ώριμα αναπτυξιακά στάδια Στο στάδιο του βλαστιδίου (Α), εκφράζεται στο ζωικό στοματικό εξώδερμα, το οποίο περιέχει την στοματική περιοχή και βρίσκεται κάτω από το εμπρόσθιο νευροεξώδερμα, ΑΝΕ (αλλιώς γνωστό ως apical organ). Στο

104 στάδιο του γαστριδίου (Β), η έκφραση του περιορίζεται στην βλεφαριδωτή ζώνη. Στο στάδιο του πλουτέα (C), η έκφραση εντοπίζεται σε συγκεκριμένες περιοχές της βλεφαριδωτής ζώνης. Β.3.γ. Συνεντοπισμός της έκφρασης του PlCOUP-TF και του PlFoxG σε ώριμα αναπτυξιακά στάδια Στο στάδιο του βλαστιδίου (Α), συνεντοπισμός παρατηρείται σε κάποιες συγκεκριμένες περιοχές του στοματικού εξωδέρματος. Στο στάδιο του γαστριδίου (Β), συνέκφραση εντοπίζεται σε πολλές περιοχές της βλεφαριδωτής ζώνης. Στο στάδιο του πλουτέα (C), φαίνεται συνεντοπισμός σε πολλές περιοχές της βλεφαριδωτής ζώνης. Β.3.δ. Διαφοροποίηση της έκφρασης PlCOUP-TF και του PlFoxG σε ώριμα αναπτυξιακά στάδια Στο στάδιο του βλαστιδίου, τα μετάγραφα του PlCOUP-TF φαίνεται να έχουν ευρύτερη εξάπλωση από τα μετάγραφα του PlFoxG π.χ. στην φυτική πλάκα και παρ όλο που συνεκφράζονται στο στοματικό εξώδερμα (αυτό δεν φαίνεται να συμβαίνει σε όλα τα κύτταρα αυτής της περιοχής). Στο στάδιο του γαστριδίου επίσης το PlCOUP-TF φαίνεται να έχει ευρύτερη εξάπλωση από το PlFoxG π.χ. στο έντερο και φαίνεται να συνεκφράζονται σε όλη βλεφαριδωτή ζώνη, με την μόνη διαφορά ότι το PlFoxG φαίνεται με εντονότερη έκφραση στο ΑΝΕ από το PlCOUP-TF. Στο στάδιο του πλουτέα όμως, φαίνονται κάποια κύτταρα της βλεφαριδωτής ζώνης να εκφράζουν είτε το ένα είτε το άλλο γονίδιο μόνο, ενώ πάλι το PlCOUP-TF φαίνεται να έχει ευρύτερη εξάπλωση από το PlFoxG π.χ. στο έντερο. *H επεξεργασία των φωτογραφιών έγινε με το προγραμμα ImageJ.

105 Γ. Εντοπισμός της ιστοειδικής έκφρασης των γονιδίων της νευρογένεσης σε control και ενεμένα με PlCOUP-TF MASO έμβρυα Γ.1. Εντοπισμός της ιστοειδικής έκφρασης του Plz81 σε control και ενεμένα με PlCOUP-TF MASO έμβρυα Στο στάδιο του γαστριδίου (Α) στα control έμβρυα εκφράζεται το Plz81 σε μεμονωμένα κύτταρα της αντιστοματικής γωνίας του ΑΝΕ και της μελλοντικής βλεφαριδωτής ζώνης, στο εμπρόσθιο έντερο και στα μεσεγχυματικά κύτταρα. Στο στάδιο του βλαστιδίου/πρώιμου γαστριδίου (Β) έχουν παραμείνει τα ενεμένα έμβρυα, παρ όλο που είναι της ίδιας αναπτυξιακής ηλικίας με τα control, και εμφανίζουν μια διάφανη περιοχή, χωρίς έκφραση του συγκεκριμένου γονιδίου και μια περιοχή που παρουσιάζεται έκφραση του Plz81. Και οι δύο ομάδες εμβρύων είναι στην αναπτυξιακή Eικόνα 47: Εντοπισμός της ιστοειδικής έκφρασης του Plz81 σε control και ενεμένα με PlCOUP-TF MASO έμβρυα ηλικία των 20 ωρών μετά την γονιμοποίηση. Γ.2. Εντοπισμός της ιστοειδικής έκφρασης του PlΗhn σε control και ενεμένα με PlCOUP-TF MASO έμβρυα Στο στάδιο του γαστριδίου (Α) στα control έμβρυα εκφράζεται το PlHbn στο μελλοντικό ΑΝΕ. Στο στάδιο του βλαστιδίου/πρώιμου γαστριδίου (Β) έχουν παραμείνει τα ενεμένα έμβρυα, παρ όλο που είναι της ίδιας αναπτυξιακής ηλικίας με τα control, και δείχνουν πολύ μειωμένη, σχεδόν μηδενική έκφραση του συγκεκριμένου γονιδίου. Και οι δύο ομάδες εμβρύων είναι στην αναπτυξιακή ηλικία των 20 ωρών μετά την γονιμοποίηση. Eικόνα 48: Εντοπισμός της ιστοειδικής έκφρασης του PlΗbn σε control και ενεμένα με PlCOUP-TF MASO έμβρυα

106 Γ.3. Εντοπισμός της ιστοειδικής έκφρασης του PlFoxGσε control και ενεμένα με PlCOUP-TF MASO έμβρυα Στο στάδιο του γαστριδίου (Α) στα control έμβρυα εκφράζεται το PlHbn στην βλεφαριδωτή ζώνη. Στο στάδιο του βλαστιδίου/πρώιμου γαστριδίου (Β) έχουν παραμείνει τα ενεμένα έμβρυα, παρ όλο που είναι της ίδιας αναπτυξιακής ηλικίας με τα control, και δείχνουν πολύ μειωμένη έκφραση του συγκεκριμένου γονιδίου. Και οι δύο ομάδες εμβρύων είναι στην αναπτυξιακή ηλικία των 20 ωρών μετά την γονιμοποίηση. Εικόνα 49: Εντοπισμός της ιστοειδικής έκφρασης του PlΗbn σε control και ενεμένα με PlCOUP-TF MASO έμβρυα

107 Δ. Ποσοτικοποίηση των μεταγράφων των γονιδίων της νευρογένεσης σε control και ενεμένα με PlCOUP-TF MASO έμβρυα Αφού πραγματοποιήθηκε καταστολή της έκφρασης του Coup-TF με MASO σε αυγά, έγινε και ποσοτικός έλεγχος των μεταγράφων των γονιδίων της νευρογένεσης σε control και ενεμένα με PlCOUP-TF MASO έμβρυα. Gene embryos 1 st run(a) 2 nd run(a) 1 st run(b) 2 nd run(a) 1 st run(c) 2 nd run(c) COUP-TF control 35,14 30,92 34,9 35,53 34,16 34,26 COUP-TF control 36,84 31,09 33,22 33,51 33,31 32,12 COUP-TF morpho 33,76 31,28 30,77 30,48 31,18 30,1 COUP-TF morpho 33,3 30,51 31,21 29,55 31,72 29,92 FoxG control 25,02 20,75 27,72 25,47 23,88 21,62 FoxG control 25,27 20,85 28,3 25,18 23,9 21,07 FoxG morpho 24,81 22,68 26,11 24,58 26,89 25,64 FoxG morpho 24,54 23,06 25,73 24,78 27,09 24,94 Hbn control 25,86 21,33 28,98 26,21 26,01 23,59 Hbn control 25,62 21,52 28,8 26, ,76 Hbn morpho 25,51 23,58 28,13 26,97 28,71 26,36 Hbn morpho 24,93 23,97 28,5 26,71 28,14 26,46 z81 control 23,96 20,22 27,7 25,69 23,82 21,3 z81 control 24,57 20,04 27,37 25,61 24,31 21,48 z81 morpho 22,02 19,98 21,68 20,17 23,24 21,21 z81 morpho 21,96 20,03 21,73 19,97 23,23 21,25 ub control 18,46 13,75 21,23 19,25 18,88 16,12 ub control 18,68 14,16 21,19 18,99 18,96 16,27 ub morpho 13,2 11,68 13,96 13,1 15,31 14,3 ub morpho 12,86 11,46 14,07 12,63 15,45 14,15 Πίνακας 12: Παρουσιάζει αναλυτικά τις τιμές των Cp (ή Ct), δηλ. τους κύκλους που εμφανίζεται κατά την αντίδραση της πολυμεράσης ανιχνεύσιμο φθορίζον προϊόν για τα διάφορα γονίδια σε control και ενεμένα με PlCOUP-TF MASO έμβρυα. Οι τιμές αφορούν τρία ανεξάρτητα πειράματα (Α, Β, C: βιολογικό triplicate). Επίσης, κάθε Q-PCR δοκιμασία πραγματοποιήθηκε δύο φορές (τεχνικό duplicate) για την αποφυγή λανθασμένων αποτελεσμάτων λόγω τεχνικών λαθών. Η στατιστική ανάλυση έγινε σύμφωνα με το paper του Schmittgen (2008) και για την κανονικοποίηση χρησιμοποιήθηκε ένα housekeeping gene, η ουμπικουιτίνη.

108 1,000E+00 couptf couptf foxg foxg hbn hbn z81 z81 control morpho control morpho control morpho control morpho 1,000E-01 1,000E-02 1,000E-03 1,000E-04 1,000E-05 1,000E-06 Eικόνα 50: Ραβδόγραμμα που δείχνει τις μέσες τιμές 2^-dCt για τα μετάγραφα των διάφορων γονιδίων σε control και ενεμένα με PlCOUP-TF έμβρυα. Και οι δύο ομάδες εμβρύων είναι στην αναπτυξιακή ηλικία των 20 ωρών μετά την γονιμοποίηση. 6,000E+01 5,000E+01 4,000E+01 3,000E+01 2,000E+01 1,000E+01 0,000E+00 couptf foxg hbn z81

109 Εικόνα 51: Pαβδόγραμμα που δείχνει τον λόγο των μεταγράφων των διαφόρων γονιδίων σε control έμβρυα προς τα μετάγραφα των αντίστοιχων γονιδίων σε ενεμένα με PlCOUP-TF MASO έμβρυα, δηλ. το πόσες φορές περισσότερη έκφραση παρατηρείται στα control σε σχέση με τα ενεμένα έμβρυα. Και οι δύο ομάδες εμβρύων είναι στην αναπτυξιακή ηλικία των 20 ωρών μετά την γονιμοποίηση. Όπως αποκαλύπτεται από τα παραπάνω δεδομένα, το mrna του Plz81 μειώνεται στα ενεμένα έμβρυα σε σχέση με τα control κατά τέσσερις φορές περίπου σύμφωνα με το δεύτερο ραβδόγραμμα αλλά λιγότερο συγκριτικά με τα υπόλοιπα γονίδια. Επίσης, το mrna του PlHbn μειώνεται δραματικά, περίπου σαράντα φορές, στα ενεμένα έμβρυα σε σχέση με τα control. Παρομοίως, το mrna του PlFoxG μειώνεται εντυπωσιακά, περίπου πενήντα φορές, στα ενεμένα έμβρυα σε σχέση με τα control. Τέλος, τα μετάγραφα του PlCOUP-TF παρουσιάζουν μείωση κατά τέσσερις φορές στα ενεμένα έμβρυα σε σχέση με τα control. Για την επιβεβαίωση ότι πολλαπλασιάστηκαν οι σωστές αλληλουχίες, απεστάλησαν τα προϊόντα της Q-PCR για αλληλούχιση. Ub GAGCMTACAGTGMCCATCGAGATGTAAAAGCCAAGATCCAAGACAAAGAAGGCATCC CTCCCGATCAGCAGCGTCTTATCTTYGCTGGAAAGCAACTCGAGGATGGCCGCACTCTC MMAG FoxG GCCGKSGTAYGCTGCTGCTGCAGCGGCTGCCGCGGCTGAGCCAGGCATGTCGTACCGG AGAGCCGGGTGGTTATGATGAGCTGGGTGGGGGTAAGGTAGAAGGGGTCCCGAR Hbn GTAACAAAASYARCATGACGGATCCAACTCTCTCACTCGTTTCCCATCTCCATCCCGAAA CTGAACATGATGTCGCCTGCTGAGAAAGA z81 GAGCGGAKCTCTTMAGGTGAGCACTTTTTGCTGCTTATGTGAGAGCTGTAGGAACCAG AGTGTGAGAAGCGTTTGAGGCAAGTTGGACAA Coup-Tf CCGTCAACRTAYATACSCAGGCTAGGTGAGGCGACCCTGCCCTTCAGATTGACCCGCCA AGAAACTTCTTAGGAAATCCAAACAACACATTACCGCAG Πίνακας 13: Οι αλληλουχίες των προϊόντων της Q-PCR ύστερα από αλληλούχιση χρησιμοποιώντας μόνο τους for primers.


111 Μετά από μια σειρά ποικίλων πειραμάτων επιτεύχθηκε ο αρχικός στόχος της εργασίας. Σκοπός της συγκεκριμένης ερευνητικής δουλειάς ήταν η μελέτη του ρόλου και της θέσης του PlCOUP-TF στο ρυθμιστικό γονιδιακό δίκτυο της νευρογένεσης του αχινού Paracentrotus lividus, χρησιμοποιώντας τεχνικές όπως η double FISH, η χρωμογόνος WMISH και η Q-PCR για τα νευροειδικά γονίδια ύστερα από γονιδιακή καταστολή (με MASO) της έκφρασης του Coup-TF σε έμβρυα αχινού. Τα αποτελέσματα για κάθε γονίδιο είναι επιθυμητό να αξιολογηθού ξεχωριστά οι επιδράσεις του συγκεκριμένου μεταγραφικού παράγοντα στα συγκεκριμένα νευροειδικά γονίδια που εμπλέκονται στην δημιουργία νευρώνων διαφοροποιούνατι αισθητά. Όσο αφορά το Plz81, στον Paracentrotus lividus τα αποτελέσματα της χρωμογόνου και φθορίζουσας in situ υβριδοποίησης στα control έμβρυα συμφωνούν με τα αποτελέσματα από χρωμογόνο in situ υβριδοποίηση στα συγγενικά είδη Hemicentrotus pulcherrimus (Yaguchi et. al.,dev. Biology, 2012) και Strongylocentrotus purpuratus (Li et. al., Dev. Biology, 2013). Αξίζει να σημειωθεί ότι στο στάδιο του βλαστιδίου παρουσιάζονται διαφορές στο πρότυπο έκφρασης μεταξύ των δύο τελευταία προαναφερθέντων αχινών και το πρότυπο σε αυτό το στάδιο στον Paracentrotus lividus μοιάζει με το αντίστοιχο στον Strongylocentrotus purpuratus. Βάσει των αποτελεσμάτων των δοκιμασιών Q-PCR, φαίνεται ότι η καταστολή της έκφρασης του PlCOUP-TF, μειώνει τα επίπεδα των μεταγράφων του συγκεκριμένου γονιδίου. Η ποσοτική μείωση κατά τέσσερις φορές δεν είναι δραματική όπως συμβαίνει με τα δύο άλλα γονίδια, κάτι το οποίο συνάδει και με την ποιοτική εικόνα της χρωμογόνου in situ υβριδοποίησης στα ενεμένα έμβρυα. Συγκεκριμένα, φαίνεται στα ενεμένα έμβρυα μια περιοχή με έκφραση και αυτή μάλλον είναι το αντιστοματικό εξώδερμα, στην οποία έτσι και αλλιώς εκφράζεται το Plz81 και δεν συνεκφράζεται και άρα δεν επηρεάζεται από το PlCOUP-TF στο στάδιο του βλαστιδίου. Για να την επιβεβαίωση αυτής της υπόθεσης, θα έπρεπε μελλοντικά να μαρκαριστεί η στοματική περιοχή π.χ. με Lefty. Bέβαια, διαφαίνεται στην χρωμογόνο in situ υβριδοποίηση και μια περιοχή με πολύ μειωμένη έκφραση και αυτή μάλλον αφορά τόσο όλες τις περιοχές που δεν εκφράζεται έτσι και αλλιώς το γονίδιο όσο και τις περιοχές που συνεκφράζεται με το PlCOUP-TF (π.χ. φυτική πλάκα, μεσεγχυματικά κύτταρα και κάποιες συγκεκριμένες περιοχές του μελλοντικού ΑΝΕ και της βλεφαριδωτής ζώνης). Επίσης για την επιβεβαίωση αυτής της ερμηνείας, θα ήταν επιστημονικά ορθό στο μέλλον να χρησιμοποιηθούν markers π.χ. για την βλεφαριδωτή ζώνη ώστε να διευκρινιστεί το είδος του ιστού απ όπου εξαλείφεται η έκφραση. Το PlHbn παρουσιάζει το ίδιο πρότυπο έκφρασης σε όλα τα στάδια στα φυσιολογικά έμβρυα εν συγκρίσει με τα πειράματα που υπάρχουν στην βιβλιογραφία για τον Strongylocentrotus purpuratus (Burke et. al, Dev. Biology, 2006). Με τα πειράματα Q-PCR, φαίνεται ότι η καταστολή της έκφρασης του PlCOUP-TF, μειώνει τα επίπεδα των μεταγράφων του συγκεκριμένου γονιδίου. Η ποσοτική μείωση κατά σαράντα φορές είναι εντυπωσιακή, στοιχείο το οποίο συνάδει και με την ποιοτική

112 εικόνα της χρωμογόνου in situ υβριδοποίησης στα ενεμένα έμβρυα. Σε αυτά τα έμβρυα παρουσιάζεται πλήρης σχεδόν εξάλειψη της έκφρασης του γονιδίου στην περιοχή του μελλοντικού ΑΝΕ στο στάδιο του βλαστιδίου του καθυστερημένου αναπτυξιακά morphant. Σε εκτεταμένες περιοχές του ΑΝΕ παρουσιάζεται συνεντοπισμός του PlHbn και του PlCOUP-TF σε κανονικές συνθήκες σύμφωνα με την double FISH. Τα αποτελέσματα για το συγκεκριμένο γονίδιο είναι τα πιο ξεκάθαρα και αξιόπιστα λόγω της πολύ εστιασμένης έκφρασης του γονιδίου σε φυσιολογικά έμβρυα και η πλήρης εξάλειψη αυτής στα ενεμένα έμβρυα. Το πρότυπο έκφρασης του PlFoxG στα πειράματα που διεξήχθησαν στο εργαστήριο μας δεν διαφέρει από αυτό που παρουσιάζεται βιβλιoγραφικά για τον Strongylocentrotus purpuratus (Τu et. al., Dev.Biology, 2006). Με τα πειράματα Q-PCR, φαίνεται ότι η καταστολή της έκφρασης του PlCOUP-TF, μειώνει δραματικά τα επίπεδα των μεταγράφων του συγκεκριμένου γονιδίου στα ενεμένα έμβρυα. Η ποσοτική μείωση κατά πενήντα φορές είναι εντυπωσιακή, όμως δεν είναι συμβατή με την εικόνα της υβριδοποίσησης όπου παρουσιάζεται μια μικρή περιοχή με έκφραση. Αυτές οι περιοχές λογικά είναι οι θέσεις που δεν παρατηρείται συνεντοπισμός του PlFoxG και PlCOUP-TF, όπως για παράδειγμα σε κάποιες περιοχές του στοματικού εξωδέρματος. Βέβαια το μεγαλύτερο μέρος του εμβρύου δεν παρουσιάζει έκφραση και αυτό γιατί το PlFoxG υπό φυσιολογικές συνθήκες απουσιάζει και από πολλές περιοχές π.χ. την φυτική πλάκα αλλά γιατί συνεκφράζεται και επηρεάζεται μάλλον από τον PlCOUP-TF (σε πολλές περιοχές του στοματικού εξωδέρματος). Το τελευταίο δεδομένο του εκτεταμένου συνεντοπισμού και της επακόλουθης επιρροής του PlFoxG από το PlCOUP- TF, δικαιολογεί την τρομερή ποσοτική μείωση των μεταγράφων του PlFoxG στα ενεμένα έμβρυα. Τα μετάγραφα του PlCOUP-TF στην FISH παρουσιάζουν το ίδιο χωροειδικό πρότυπο με το αντίστοιχο της χρωμογόνου in situ υβριδοποίησης (που έχει πραγματοποιηθεί στο παρελθόν στο εργαστήριο μας) σε όλα τα στάδια. Αξίζει να σημειωθεί, κάτι το οποίο ισχύει και για τα υπόλοιπα γονίδια, ότι καλύτερες ενδείξεις για την ιστοειδική έκφραση ενός γονιδίου λαμβάνονται από την χρωμογόνο in situ υβριδοποίηση, ενώ καλύτερες ενδείξεις για τον συνεντοπισμό των γονιδίων από την double FISH. Με τα πειράματα Q-PCR, φαίνεται ότι οι ενέσεις με PlCOUP-TF ΜΑSO στα γονιμοποιημένα αυγά μειώνουν όπως είναι λογικό τα επίπεδα των μητρικών του μεταγράφων. Η μείωση κατά τέσσερις φορές περίπου δεν είναι τραγική, πιθανόν λόγω της καταστροφής μεγάλου ποσοστού του αρχικού MASO καθώς θεωρείται ότι η σταθερότητα και η δράση του MASO διατηρείται το πολύ μέχρι το στάδιο του γαστριδίου. Συμπερασματικά, φαίνεται ότι ο PlCOUP-TF κατέχει μια θέση στο ρυθμιστικό γονιδιακό δίκτυο της νευρογένεσης στον αχινό. Συγκεκριμένα, φαίνεται να δρα ενεργοποιητικά και για τα τρία γονίδια που μελετήθηκαν. Bέβαια επειδή ο συγκεκριμένος μεταγραφικός παράγοντας δρα συνήθως κατασταλτικά, για να έχει

113 ενεργοποιητική δράση, θα πρέπει να δρα μέσω καταστολέα. Είναι πολύ πιθανό λοιπόν το εξής σχήμα: ο PlCOUP-TF να καταστέλλει καταστολέα που με την σειρά του καταστέλλει τα εν λόγω γονίδια στις νευρογενείς εξωδερμικές περιοχές, ΑΝΕ και βλεφαριδωτή ζώνη (double negative gate). Εικόνα 52: To υποτιθέμενο GRN με πρωταγωνιστή τον Coup-TF Στο παραπάνω διάγραμμα, φαίνεται η υποθετική θέση του PlCOUP-TF στο συνολικό ρυθμιστικό δίκτυο και στο υποδίκτυο της νευρογένεσης και αναφέρεται σε διαφορετικές εμβρυικές περιοχές και αναπτυξιακές χρονικές στιγμές. Τα πειράματα για τα υπόλοιπα γονίδια πραγματοποιήθηκαν από άλλα εργαστηρικά μέλη για τον Paracentrotus lividus ή υπάρχουν στην βιβλιογραφία για τον αχινό Strongylocentrotus purpuratus, αλλά συμπεριλαμβάνονται στο σχήμα για την απόκτηση μιας πιο ολοκληρωμένης εικόνας. Συγκεκριμένα, μέχρι στιγμής η επίδραση του PlCOUP-TF πάνω στο PlSix3, PlFoxQ2, PlNk2.1, PlFez, PlMox, PlsFRP1/5, PlEts4 έχει ελεγχεί, μετά από ενέσεις με ΜΑSO, με χρωμογόνο in situ υβριδοποίηση μόνο και όχι και με QPCR, οπότε τα αποτελέσματα αυτά δεν είναι επιβεβαιωμένα. Συγκεκριμένα, φαίνεται το z81 να δέχεται ενεργοποιητικά μηνύματα στην περιοχή του πρώιμου ζωικού πόλου (early APD) 27 ώρες μετά την γονιμοποίηση (στάδιο μεσεγχυματικού βλαστιδίου για τα controι έμβρυα) από το Six3 (Wei et. al.,

Λαμπρινή Καλαμπόκη Α.Μ. 302


Διαβάστε περισσότερα

Τίτλος Διπλωματικής Εργασίας Ο μεταγραφικός παράγοντας Coup-TF και η διαφοροποίηση του νευρικού συστήματος στο έμβρυο του αχινού

Τίτλος Διπλωματικής Εργασίας Ο μεταγραφικός παράγοντας Coup-TF και η διαφοροποίηση του νευρικού συστήματος στο έμβρυο του αχινού Τίτλος Διπλωματικής Εργασίας Ο μεταγραφικός παράγοντας Coup-TF και η διαφοροποίηση του νευρικού συστήματος στο έμβρυο του αχινού Μεταπτυχιακή Φοιτήτρια: Μπάρου Βασιλική Α.Μ: 523 Υπεύθυνος καθηγητής: Φλυτζάνης

Διαβάστε περισσότερα



Διαβάστε περισσότερα

Έναρξη της μεταγραφής = μείωση του ρυθμού διαίρεσης

Έναρξη της μεταγραφής = μείωση του ρυθμού διαίρεσης Αυλάκωση vs Γαστριδίωση Αυλάκωση: απανωτές μιτωτικές διαιρέσεις που οδηγούν σε λογαριθμική αύξηση του αριθμού των κυττάρων αλλά χωρίς αύξηση του συνολικού όγκου του αναπτυσσόμενου εμβρύου Έναρξη της μεταγραφής

Διαβάστε περισσότερα


ΕΡΩΤΗΣΕΙΣ ΚΑΤΑΝΟΗΣΗΣ ΕΡΩΤΗΣΕΙΣ ΚΑΤΑΝΟΗΣΗΣ ΚΕΦΑΛΑΙΟ 2 ο 1. Με ποιο μηχανισμό αντιγράφεται το DNA σύμφωνα με τους Watson και Crick; 2. Ένα κύτταρο που περιέχει ένα μόνο χρωμόσωμα τοποθετείται σε θρεπτικό υλικό που περιέχει ραδιενεργό

Διαβάστε περισσότερα

Κ Ε Φ Α Λ Α Ι Ο 22 : Η ενεργοποίηση της µεταγραφής

Κ Ε Φ Α Λ Α Ι Ο 22 : Η ενεργοποίηση της µεταγραφής Κ Ε Φ Α Λ Α Ι Ο 22 : Η ενεργοποίηση της µεταγραφής Εικόνα 22.1 Η γονιδιακή έκφραση ελέγχεται κυρίως κατά την έναρξη της µεταγραφής και σπάνια στα επόµενα στάδια της γονιδιακής έκφρασης, παρόλο που ο έλεγχος

Διαβάστε περισσότερα

Η ΑΝΑΠΑΡΑΓΩΓΗ ΚΑΙ Η ΑΝΑΠΤΥΞΗ ΤΩΝ ΖΩΩΝ. Αρχιτομία. Αγενής αναπαραγωγή. Παρατομία. Εκβλάστηση. Εγγενής αναπαραγωγή Διπλοφασικός κύκλος.

Η ΑΝΑΠΑΡΑΓΩΓΗ ΚΑΙ Η ΑΝΑΠΤΥΞΗ ΤΩΝ ΖΩΩΝ. Αρχιτομία. Αγενής αναπαραγωγή. Παρατομία. Εκβλάστηση. Εγγενής αναπαραγωγή Διπλοφασικός κύκλος. Η ΑΝΑΠΑΡΑΓΩΓΗ ΚΑΙ Η ΑΝΑΠΤΥΞΗ ΤΩΝ ΖΩΩΝ Αρχιτομία Αγενής αναπαραγωγή Παρατομία Εκβλάστηση Εγγενής αναπαραγωγή Απλοφασικός κύκλος Διπλοφασικός κύκλος Ισογαμία Ανισογαμία Ωογαμία Η ΑΝΑΠΑΡΑΓΩΓΗ ΚΑΙ Η ΑΝΑΠΤΥΞΗ

Διαβάστε περισσότερα

Β. ΚΑΜΙΝΕΛΛΗΣ ΒΙΟΛΟΓΙΑ. Είναι η επιστήμη που μελετά τους ζωντανούς οργανισμούς. (Αποτελούνται από ένα ή περισσότερα κύτταρα).

Β. ΚΑΜΙΝΕΛΛΗΣ ΒΙΟΛΟΓΙΑ. Είναι η επιστήμη που μελετά τους ζωντανούς οργανισμούς. (Αποτελούνται από ένα ή περισσότερα κύτταρα). ΒΙΟΛΟΓΙΑ Είναι η επιστήμη που μελετά τους ζωντανούς οργανισμούς. (Αποτελούνται από ένα ή περισσότερα κύτταρα). Είδη οργανισμών Υπάρχουν δύο είδη οργανισμών: 1. Οι μονοκύτταροι, που ονομάζονται μικροοργανισμοί

Διαβάστε περισσότερα

ΑΠΑΝΤΗΣΕΙΣ. ΘΕΜΑ Α Α1. β Α2. γ Α3. δ Α4. γ Α5. β


Διαβάστε περισσότερα


BIO 101 ΕΙΣΑΓΩΓΗ ΣΤΗ ΖΩΟΛΟΓΙΑ BIO 101 ΕΙΣΑΓΩΓΗ ΣΤΗ ΖΩΟΛΟΓΙΑ ΙΑΛΕΞΗ 2. ΓΟΝΙΜΟΠΟΙΗΣΗ - ΑΥΛΑΚΩΣΗ Ι ΑΣΚΩΝ Μιχάλης Παυλίδης (pavlidis@biology.uoc.gr) Hράκλειο, Νοέμβριος 2012 1 ΓΟΝΙΜΟΠΟΙΗΣΗ* 1. 2. 3. 4. Επαφή, αναγνώριση & πρόσδεση σπερματοζωαρίου

Διαβάστε περισσότερα

ΓΟΝΙΜΟΠΟΙΗΣΗ* BIO 101 ΕΙΣΑΓΩΓΗ ΣΤΗ ΖΩΟΛΟΓΙΑ. Επαφή, Αναγνώριση & Πρόσδεσητου σπερματοζωαρίου στο ωάριο ΓΟΝΙΜΟΠΟΙΗΣΗ ΑΥΛΑΚΩΣΗ

ΓΟΝΙΜΟΠΟΙΗΣΗ* BIO 101 ΕΙΣΑΓΩΓΗ ΣΤΗ ΖΩΟΛΟΓΙΑ. Επαφή, Αναγνώριση & Πρόσδεσητου σπερματοζωαρίου στο ωάριο ΓΟΝΙΜΟΠΟΙΗΣΗ ΑΥΛΑΚΩΣΗ ΔΙΑΛΕΞΗ 2. BIO 101 ΕΙΣΑΓΩΓΗ ΣΤΗ ΖΩΟΛΟΓΙΑ ΓΟΝΙΜΟΠΟΙΗΣΗ ΑΥΛΑΚΩΣΗ ΔΙΔΑΣΚΩΝ Μιχάλης Παυλίδης (pavlidis@biology.uoc.gr) Hράκλειο, Νοέμβριος 2013 ΓΟΝΙΜΟΠΟΙΗΣΗ* 1. Επαφή, αναγνώριση & πρόσδεση σπερματοζωαρίου

Διαβάστε περισσότερα

ΓΕΝΕΤΙΚΗ ΜΗΧΑΝΙΚΗ. Η τεχνολογία του ανασυνδυασμένου DNA και οι εφαρμογές της...

ΓΕΝΕΤΙΚΗ ΜΗΧΑΝΙΚΗ. Η τεχνολογία του ανασυνδυασμένου DNA και οι εφαρμογές της... ΓΕΝΕΤΙΚΗ ΜΗΧΑΝΙΚΗ Η τεχνολογία του ανασυνδυασμένου DNA και οι εφαρμογές της... Γενετική Μηχανική o Περιλαμβάνει όλες τις τεχνικές με τις οποίες μπορούμε να επεμβαίνουμε στο γενετικό υλικό των οργανισμών.

Διαβάστε περισσότερα

Ζωολογία Ι. Εργαστηριακή Άσκηση : ΑΝΑΠΑΡΑΓΩΓΗ. Ενότητα 4η: Η Διαδικασία της Αναπαραγωγής

Ζωολογία Ι. Εργαστηριακή Άσκηση : ΑΝΑΠΑΡΑΓΩΓΗ. Ενότητα 4η: Η Διαδικασία της Αναπαραγωγής Ζωολογία Ι Εργαστηριακή Άσκηση : ΑΝΑΠΑΡΑΓΩΓΗ Ενότητα 4η: Η Διαδικασία της Αναπαραγωγής Συγγραφείς: Α. Νικολαίδου, Μ. Βεινή Χαρίτου Διδάσκων: Σκ. Ντέντος Τμήμα ΒΙΟΛΟΓΙΑΣ, Τομέας Ζωολογίας Θαλάσσιας Βιολογίας

Διαβάστε περισσότερα

ΤΑΞΙΝΟΜΗΣΗ ΖΩΙΚΩΝ ΟΡΓΑΝΙΣΜΩΝ. Το πρώτο σύστημα κατάταξης των ζώων κατά τον Αριστοτέλη

ΤΑΞΙΝΟΜΗΣΗ ΖΩΙΚΩΝ ΟΡΓΑΝΙΣΜΩΝ. Το πρώτο σύστημα κατάταξης των ζώων κατά τον Αριστοτέλη ΤΑΞΙΝΟΜΗΣΗ ΖΩΙΚΩΝ ΟΡΓΑΝΙΣΜΩΝ Το πρώτο σύστημα κατάταξης των ζώων κατά τον Αριστοτέλη Επόμενα συστήματα κατάταξης John Ray (1627-1705): Νέο σύστημα κατάταξης και εισαγωγή έννοιας του είδους Charles Linnaeus

Διαβάστε περισσότερα

Εισαγωγή στη Γενετική και στη Γονιδιωματική Τι είναι η κληρονομικότητα, και πώς μεταβιβάζεται η πληροφορία από γενιά σε γενιά;

Εισαγωγή στη Γενετική και στη Γονιδιωματική Τι είναι η κληρονομικότητα, και πώς μεταβιβάζεται η πληροφορία από γενιά σε γενιά; ΒΙΟΛΟΓΙΚΗ ΑΝΘΡΩΠΟΛΟΓΙΑ 12 26/10/2016 Κεφάλαιο 3 Α μέρος Εισαγωγή στη Γενετική και στη Γονιδιωματική Τι είναι η κληρονομικότητα, και πώς μεταβιβάζεται η πληροφορία από γενιά σε γενιά; Ποια είναι η δομή

Διαβάστε περισσότερα


ΒΙΟΛΟΓΙΑ ΠΡΟΣΑΝΑΤΟΛΙΣΜΟΥ ΕΝΔΕΙΚΤΙΚΕΣ ΑΠΑΝΤΗΣΕΙΣ ΠΑΝΕΛΛΗΝΙΩΝ 2017 ΘΕΜΑ Α Α1. δ Α2. δ Α3. β Α4. γ Α5. α ΘΕΜΑ Β Β1. Ι Α, ΙΙ Ε, ΙΙΙ ΣΤ, ΙV Β, V Ζ, VII Γ, VII Δ Β2. Η εικόνα 1 αντιστοιχεί σε προκαρυωτικό κύτταρο. Στους προκαρυωτικούς

Διαβάστε περισσότερα



Διαβάστε περισσότερα


ΑΠΑΝΤΗΣΕΙΣ ΣΤΟ 1 ο ΔΙΑΓΩΝΙΣΜΑ ΒΙΟΛΟΓΙΑΣ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ ΑΠΑΝΤΗΣΕΙΣ ΣΤΟ 1 ο ΔΙΑΓΩΝΙΣΜΑ ΒΙΟΛΟΓΙΑΣ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ ΘΕΜΑ 1 ο Α. Ερωτήσεις πολλαπλής επιλογής 1. δ 2. β 3. γ 4. γ 5. β Β. Ερωτήσεις σωστού λάθους 1. Λάθος 2. Σωστό 3. Λάθος 4. Λάθος 5. Σωστό ΘΕΜΑ

Διαβάστε περισσότερα

Εργαστηριακή άσκηση 11: Γαμετογένεση και γονιμοποίηση στον αχινό

Εργαστηριακή άσκηση 11: Γαμετογένεση και γονιμοποίηση στον αχινό Εργαστηριακή άσκηση 11: Γαμετογένεση και γονιμοποίηση στον αχινό Σύνοψη Με την εργαστηριακή άσκηση, οι φοιτητές και οι φοιτήτριες θα είναι σε θέση να διακρίνουν τα μορφολογικά χαρακτηριστικά των αχινών

Διαβάστε περισσότερα


ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ ΘΕΜΑ 1ο Να γράψετε στο τετράδιό σας τον αριθμό καθεμιάς από τις παρακάτω ημιτελείς προτάσεις 1 έως 5 και δίπλα το γράμμα που αντιστοιχεί στη λέξη ή τη φράση, η οποία

Διαβάστε περισσότερα

Γονιμοποίηση αναγνώριση και συνένωση ωαρίου-σπερματοζωαρίου φραγμός στην πολυσπερμία μετα μετ βολική ενεργο ενεργο ο π ίηση

Γονιμοποίηση αναγνώριση και συνένωση ωαρίου-σπερματοζωαρίου φραγμός στην πολυσπερμία μετα μετ βολική ενεργο ενεργο ο π ίηση Γονιμοποίηση αναγνώριση και συνένωση ωαρίου-σπερματοζωαρίου φραγμός στην πολυσπερμία μεταβολική ενεργοποίηση του αυγού ανακατατάξεις στα συστατικά του αυγού σχηματισμός του διπλοειδή πυρήνα του ζυγωτού

Διαβάστε περισσότερα

ΑΠΑΝΤΗΣΕΙΣ. ΘΕΜΑ Α A1. β Α2. γ Α3. γ Α4. α Α5. δ


Διαβάστε περισσότερα


BIOΛ 102 ΕΙΣΑΓΩΓΗ ΣΤΗ ΖΩΟΛΟΓΙΑ BIOΛ 102 ΕΙΣΑΓΩΓΗ ΣΤΗ ΖΩΟΛΟΓΙΑ Γονιμοποίηση Αυλάκωση Γαστριδίωση Νευριδίωση Οργανογένεση ΕΜΒΡΥΟΛΟΓΙΑ Δ. Δοκιανάκη & Μ. Παυλίδης Ηράκλειο, Νοέμβριος 2015 1 ΓΟΝΙΜΟΠΟΙΗΣΗ* 1. Επαφή, αναγνώριση & πρόσδεση

Διαβάστε περισσότερα



Διαβάστε περισσότερα

Βιολογία προσανατολισμού

Βιολογία προσανατολισμού Βιολογία προσανατολισμού Α. 1. β. 2. γ. 3. γ. 4. α. 5. δ. ΘΕΜΑ Α ΘΕΜΑ Β Β1. Σχολικό βιβλίο σελ. 131 «Το βακτήριο... στο σώμα των φυτών.» Β2.1 Ε, 2 Δ, 3 Α, 4 Β Β3. Σχολικό βιβλίο σελ. 108 «Η θερμοκρασία..

Διαβάστε περισσότερα

Κύτταρα πολυκύτταρων οργανισμών

Κύτταρα πολυκύτταρων οργανισμών Μίτωση - Μείωση Τα ευκαρυωτικά κύτταρα διαιρούνται με δύο τρόπους: τη μίτωση και τη μείωση. Η Μίτωση είναι ο τύπος της κυτταρικής διαίρεσης που από ένα πατρικό κύτταρο καταλήγει σε δύο γενετικά πανομοιότυπα

Διαβάστε περισσότερα

γ ρ α π τ ή ε ξ έ τ α σ η σ τ ο μ ά θ η μ α ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ

γ ρ α π τ ή ε ξ έ τ α σ η σ τ ο μ ά θ η μ α ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ γ ρ α π τ ή ε ξ έ τ α σ η σ τ ο μ ά θ η μ α ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ Γ ' ΛΥΚΕΙΟΥ Τάξη: Γ Λυκείου Τμήμα: Βαθμός: Ονοματεπώνυμο: Καθηγητές: Θ Ε Μ Α A 1. Να επιλέξετε τη σωστή απάντηση: Α1. Το γονίδιο

Διαβάστε περισσότερα

ΘΕΜΑ Α Α1. γ Α2. γ Α3. α Α4. β Α5. β ΘΕΜΑ B B1. B2.

ΘΕΜΑ Α Α1. γ Α2. γ Α3. α Α4. β Α5. β ΘΕΜΑ B B1. B2. ΘΕΜΑ Α Α1. γ (το πριμόσωμα) Α2. γ (οι υποκινητές και οι μεταγραφικοί παράγοντες κάθε γονιδίου) Α3. α (μεταφέρει ένα συγκεκριμένο αμινοξύ στο ριβόσωμα) Α4. β (αποδιάταξη των δύο συμπληρωματικών αλυσίδων)

Διαβάστε περισσότερα

Ενότητα 10: Κυτταρική Διαίρεση

Ενότητα 10: Κυτταρική Διαίρεση Ενότητα 10: Κυτταρική Διαίρεση Κυτταρική διαίρεση: παραγωγή γενετικά πανομοιότυπων θυγατρικών κυττάρων Κυτταρική διαίρεση Μονοκύτταροι οργανισμοί: η διαίρεση του κυττάρου συνεπάγεται αναπαραγωγή ολόκληρου

Διαβάστε περισσότερα


ΕΞΕΤΑΖΟΜΕΝΟ ΜΑΘΗΜΑ ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ ΕΞΕΤΑΖΟΜΕΝΟ ΜΑΘΗΜΑ ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ ΘΕΜΑ Α Να γράψετε στο τετράδιό σας τον αριθμό καθεμιάς από τις παρακάτω ημιτελείς προτάσεις Α1 έως Α5 και δίπλα το γράμμα που αντιστοιχεί στη λέξη

Διαβάστε περισσότερα


ΒΙΟΛΟΓΙΑ Γ ΛΥΚΕΙΟΥ, ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ EIKONA 2.1 Ημισυντηρητικός μηχανισμός αντιγραφής του DNA 1. Να γράψετε τα ένζυμα που (α) προκαλούν ξετύλιγμα των αλυσίδων του αρχικού (μητρικού μορίου) DNA και (β) συνθέτουν τις νέες αλυσίδες του DNA.

Διαβάστε περισσότερα


ΕΠΑΝΑΛΗΠΤΙΚΑ ΘΕΜΑΤΑ 2015 Β ΦΑΣΗ ΑΠΑΝΤΗΣΕΙΣ ÏÅÖÅ ΤΑΞΗ: ΜΑΘΗΜΑ: 3 η ΤΑΞΗ ΕΠΑ.Λ. (Β ΟΜΑ Α) ΒΙΟΛΟΓΙΑ ΙΙ Ηµεροµηνία: Παρασκευή 19 Απριλίου 2015 ιάρκεια Εξέτασης: 3 ώρες ΘΕΜΑ Α Α1-β, Α2-γ, Α3-γ, Α4-α, Α5-α ΑΠΑΝΤΗΣΕΙΣ ΘΕΜΑ Β Β1. α. Με τη µέθοδο της επιλογής

Διαβάστε περισσότερα

ΘΕΜΑ Α ΘΕΜΑ Β ΑΠΑΝΤΗΣΕΙΣ. Α1. β. Α2. γ. Α3. δ. Α4. γ. Α5. β Β1. 5, 4, 2, 1, 3. Β2. Τα δομικά μέρη του οπερονίου της λακτόζης είναι κατά σειρά τα εξής:


Διαβάστε περισσότερα


ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ 11 Ιουνίου 2015 ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ Απαντήσεις Θεμάτων Επαναληπτικών Πανελληνίων Εξετάσεων Ημερησίων & Εσπερινών Γενικών Λυκείων ΘΕΜΑ Α Α1. β Α2. γ Α3. α Α4. γ Α5. δ ΘΕΜΑ B Β1. 1. Β 2. Γ 3. Α

Διαβάστε περισσότερα

Η µελέτη της ρύθµισης της πρωτεινοσύνθεσης στο επίπεδο του Ριβοσώµατος εντοπίζεται σε τρία επίπεδα

Η µελέτη της ρύθµισης της πρωτεινοσύνθεσης στο επίπεδο του Ριβοσώµατος εντοπίζεται σε τρία επίπεδα Η µελέτη της ρύθµισης της πρωτεινοσύνθεσης στο επίπεδο του Ριβοσώµατος εντοπίζεται σε τρία επίπεδα ΣτονΣτον ρόλο των διαφόρων οµάδων των ριβοσωµικών πρωτεινών. Κατά πόσο δηλαδή υπάρχει ετερογένεια στις

Διαβάστε περισσότερα

Η ζητούμενη σειρά έχει ως εξής: αδενίνη < νουκλεοτίδιο < νουκλεόσωμα < γονίδιο < χρωματίδα < χρωμόσωμα < γονιδίωμα.

Η ζητούμενη σειρά έχει ως εξής: αδενίνη < νουκλεοτίδιο < νουκλεόσωμα < γονίδιο < χρωματίδα < χρωμόσωμα < γονιδίωμα. ΚΕΦ. 1 ο ΕΡΩΤΗΣΕΙΣ ΚΡΙΣΕΩΣ 1. Να κατατάξετε σε σειρά αυξανόμενου μεγέθους τις παρακάτω έννοιες που σχετίζονται με το γενετικό υλικό των οργανισμών: νουκλεόσωμα, χρωμόσωμα, αδενίνη, νουκλεοτίδιο, γονίδιο

Διαβάστε περισσότερα



Διαβάστε περισσότερα



Διαβάστε περισσότερα

Κεφάλαιο 10 ΤΟ ΟΠΕΡΟΝΙΟ (σελ )

Κεφάλαιο 10 ΤΟ ΟΠΕΡΟΝΙΟ (σελ ) Κεφάλαιο 10 ΤΟ ΟΠΕΡΟΝΙΟ (σελ. 387-417) Ένα ρυθμιστικό γονίδιο κωδικοποιεί μια πρωτεΐνη που δρα σε μια θέση-στόχο πάνω στο DNA και ρυθμίζει την έκφραση ενός άλλου γονιδίου. Στον αρνητικό έλεγχο, μία trans-δραστική

Διαβάστε περισσότερα


ΒΙΟΛΟΓΙΑ ΟΜΑΔΑΣ ΠΡΟΣΑΝΑΤΟΛΙΣΜΟΥ ΘΕΤΙΚΩΝ ΣΠΟΥΔΩΝ 27 Μαΐου 2016 ΒΙΟΛΟΓΙΑ ΟΜΑΔΑΣ ΠΡΟΣΑΝΑΤΟΛΙΣΜΟΥ ΘΕΤΙΚΩΝ ΣΠΟΥΔΩΝ Απαντήσεις Θεμάτων Πανελλαδικών Εξετάσεων Ημερησίων Γενικών Λυκείων (Νέο & Παλιό Σύστημα) ΘΕΜΑ Γ Γ.1 Ο χαρακτήρας της ομάδας αίματος στον άνθρωπο

Διαβάστε περισσότερα


ΒΙΟΛΟΓΙΑ Γ ΛΥΚΕΙΟΥ, ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ ΕΙΚΟΝΑ 2.4 ΣΤΑΔΙΑ ΜΕΤΑΦΡΑΣΗΣ σ ε λ ί δ α 1 ΕΙΚΟΝΑ 4.2β ΕΡΩΤΗΣΕΙΣ 1. Να συμπληρώσετε τα κενά πλαίσια της εικόνας με την κατάλληλη λέξη ή φράση 2. Να γράψετε τον προσανατολισμό της μετακίνησης του ριβοσώματος

Διαβάστε περισσότερα

Φάσμα& Group προπαρασκευή για Α.Ε.Ι. & Τ.Ε.Ι.

Φάσμα& Group προπαρασκευή για Α.Ε.Ι. & Τ.Ε.Ι. σύγχρονο Φάσμα& Group προπαρασκευή για Α.Ε.Ι. & Τ.Ε.Ι. μαθητικό φροντιστήριο 1. 25ης Μαρτίου 111 ΠΕΤΡΟΥΠΟΛΗ 50.27.990 50.20.990 2. 25ης Μαρτίου 74 Π. ΠΕΤΡΟΥΠΟΛΗΣ 50.50.658 50.60.845 3. Γραβιάς 85 ΚΗΠΟΥΠΟΛΗ

Διαβάστε περισσότερα


Γ' ΛΥΚΕΙΟΥ ΘΕΤΙΚΗ ΚΑΤΕΥΘΥΝΣΗ ΒΙΟΛΟΓΙΑ ΑΠΑΝΤΗΣΕΙΣ ÏÅÖÅ 1 Γ' ΛΥΚΕΙΟΥ ΘΕΤΙΚΗ ΚΑΤΕΥΘΥΝΣΗ ΒΙΟΛΟΓΙΑ ΘΕΜΑ 1 ο Α. 1 - Γ 2 - Β 3-4 - Γ 5 - Β. 1 - Σ 2 - Λ 3 - Λ 4 - Λ 5 - Σ ΘΕΜΑ 2 ο ΑΠΑΝΤΗΣΕΙΣ 1. Κάθε είδος αντισώµατος που αναγνωρίζει έναν αντιγονικό καθοριστή παράγεται

Διαβάστε περισσότερα


Τρίτη, 27 Μαΐου 2008 Γ ΛΥΚΕΙΟΥ ΚΑΤΕΥΘΥΝΣΗΣ ΒΙΟΛΟΓΙΑ Τρίτη, 27 Μαΐου 2008 Γ ΛΥΚΕΙΟΥ ΚΑΤΕΥΘΥΝΣΗΣ ΒΙΟΛΟΓΙΑ ΘΕΜΑ 1o Να γράψετε στο τετράδιο σας τον αριθµό καθεµιάς από τις παρακάτω ηµιτελείς προτάσεις 1 έως 5 και δίπλα το γράµµα που αντιστοιχεί στη λέξη ή τη

Διαβάστε περισσότερα


ΛΥΣΗ ΤΗΣ ΑΣΚΗΣΗΣ ΕΠΑΝΑΛΗΨΗΣ ΛΥΣΗ ΤΗΣ ΑΣΚΗΣΗΣ ΕΠΑΝΑΛΗΨΗΣ 1. Ο γενετικός κώδικας είναι ένας κώδικας αντιστοίχισης των κωδικονίων του mrna με αμινοξέα στην πολυπεπτιδική αλυσίδα. Σύμφωνα με αυτόν η 3 μετάφραση όλων των mrna αρχίζει

Διαβάστε περισσότερα

Παραγωγή, απομόνωση και καθαρισμός της φαρμακευτικής πρωτεΐνης.

Παραγωγή, απομόνωση και καθαρισμός της φαρμακευτικής πρωτεΐνης. ΑΠΟΛΥΤΗΡΙΕΣ ΕΞΕΤΑΣΕΙΣ Γ ΤΑΞΗΣ ΗΜΕΡΗΣΙΟΥ ΕΝΙΑΙΟΥ ΛΥΚΕΙΟΥ ΤΡΙΤΗ 1 ΙΟΥΝΙΟΥ 2004 ΕΞΕΤΑΖΟΜΕΝΟ ΜΑΘΗΜΑ: ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ 1 ΑΠΑΝΤΗΣΕΙΣ ΘΕΜΑ 1o 1. δ 2. β 3. β 4. γ 5. δ ΘΕΜΑ 2o 1. Σχολικό βιβλίο, σελ.

Διαβάστε περισσότερα


ΒΑΣΙΚΕΣ ΔΟΜΕΣ - ΤΟ ΚΥΤΤΑΡΟ ΤΕΙ ΠΑΤΡΑΣ ΤΜΗΜΑ ΝΟΣΗΛΕΥΤΙΚΗΣ ΑΝΑΤΟΜΙΑ I ΥΠΕΥΘΥΝΟΣ ΚΑΘΗΓΗΤΗΣ : Γεράσιμος Π. Βανδώρος ΒΑΣΙΚΕΣ ΔΟΜΕΣ - ΤΟ ΚΥΤΤΑΡΟ Οι βασικές δομές που εξετάζουμε στην ανατομία μπορούν ιεραρχικά να ταξινομηθούν ως εξής:

Διαβάστε περισσότερα

Να απαντήσετε σε καθεμιά από τις παρακάτω ερωτήσεις με μια πρόταση.

Να απαντήσετε σε καθεμιά από τις παρακάτω ερωτήσεις με μια πρόταση. Κεφάλαιο 4: Γενετική Α. Αντιγραφή - Μεταγραφή - Μετάφραση του DNA Να απαντήσετε σε καθεμιά από τις παρακάτω ερωτήσεις με μια πρόταση. 1. Τι είναι κωδικόνιο; 2. Που γίνεται η σύνθεση πρωτεϊνών στο κύτταρο;

Διαβάστε περισσότερα



Διαβάστε περισσότερα

Πανελλαδικές εξετάσεις Γ Τάξης Ημερήσιου Γενικού Λυκείου Βιολογία Θετικής Κατεύθυνσης Τετάρτη 4 Ιουνίου 2014

Πανελλαδικές εξετάσεις Γ Τάξης Ημερήσιου Γενικού Λυκείου Βιολογία Θετικής Κατεύθυνσης Τετάρτη 4 Ιουνίου 2014 Πανελλαδικές εξετάσεις Γ Τάξης Ημερήσιου Γενικού Λυκείου Βιολογία Θετικής Κατεύθυνσης Τετάρτη 4 Ιουνίου 2014 ΘΕΜΑ Α Α1.δ Α2.γ Α3.β Α4.γ Α5.β ΘΕΜΑ Β Β1. 4,2,1,6,3,5 Β2. α. DNA πολυμεράση β. πριμόσωμα γ.

Διαβάστε περισσότερα



Διαβάστε περισσότερα


ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ ΓΕΝΙΚΟΥ ΛΥΚΕΙΟΥ ΚΑΙ ΕΠΑΛ (ΟΜΑ Α Β ) 2011 ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ ΓΕΝΙΚΟΥ ΛΥΚΕΙΟΥ ΚΑΙ ΕΠΑΛ (ΟΜΑ Α Β ) 2011 ΘΕΜΑ Α Να γράψετε στο τετράδιό σας τον αριθμό καθεμιάς από τις παρακάτω ημιτελείς προτάσεις Α1 έως Α5 και δίπλα το γράμμα που αντιστοιχεί

Διαβάστε περισσότερα


ΔΙΑΓΩΝΙΣΜΑ ΒΙΟΛΟΓΙΑΣ ΠΡΟΣΑΝΑΤΟΛΙΣΜΟΥ ΚΕΦΑΛΑΙΑ 1 ΚΑΙ 2 ΔΙΑΓΩΝΙΣΜΑ ΒΙΟΛΟΓΙΑΣ ΠΡΟΣΑΝΑΤΟΛΙΣΜΟΥ ΚΕΦΑΛΑΙΑ 1 ΚΑΙ 2 ΘΕΜΑ 1 ο Α. Στις ερωτήσεις 1-5 να γράψετε στο τετράδιό σας τον αριθμό της ερώτησης και δίπλα του το γράμμα που αντιστοιχεί στη σωστή απάντηση. 1. Το

Διαβάστε περισσότερα

1 ο #Κεφάλαιο# 1)#Πειράματα: α)$να#περιγράψεις#το#πείραμα#των#hershey#και#chase.# Υπόδειξη:#σελ#14#σχολ.

1 ο #Κεφάλαιο# 1)#Πειράματα: α)$να#περιγράψεις#το#πείραμα#των#hershey#και#chase.# Υπόδειξη:#σελ#14#σχολ. 1 ο #Κεφάλαιο# ΤΟ ΓΕΝΕΤΙΚΟ ΥΛΙΚΟ 1)#Πειράματα: α)$να#περιγράψεις#το#πείραμα#των#hershey#και#chase.# Υπόδειξη:#σελ#14#σχολ. Παραλλαγή:#δίνονται##τα#παρακάτω#διαγράμματα#που#απεικονίζουν# τη#ραδιενέργεια#στο#εσωτερικό#των#βακτηρίων,#μετά#τη#μόλυνση#με#

Διαβάστε περισσότερα

Ποιες είναι οι ομοιότητες και οι διαφορές μεταξύ της αντιγραφής και της

Ποιες είναι οι ομοιότητες και οι διαφορές μεταξύ της αντιγραφής και της ΚΕΦ. 2 ο ΕΡΩΤΗΣΕΙΣ ΚΡΙΣΕΩΣ Ποιες είναι οι ομοιότητες και οι διαφορές μεταξύ της αντιγραφής και της μεταγραφής; Διαφορές Αντιγραφή Μεταγραφή 1. Διατηρείται και μεταβιβάζεται η 1. Μεταβιβάζεται η γενετική

Διαβάστε περισσότερα

Γονιδιωματική. G. Patrinos

Γονιδιωματική. G. Patrinos Γονιδιωματική Η μεταγονιδιωματική εποχή... Σημαντικότερα επιτεύγματα POST GENOME ERA Ολοκλήρωση της αποκρυπτογράφησης της αλληλουχίας των γονιδιωμάτων πολλών οργανισμών. Προτύπωση μεθοδολογιών για προσδιορισμό

Διαβάστε περισσότερα



Διαβάστε περισσότερα


Αθήνα, 16/06/2017 ΠΑΝΕΛΛΗΝΙΑ ΕΝΩΣΗ ΒΙΟΕΠΙΣΤΗΜΟΝΩΝ Αθήνα, 16/06/2017 ΠΑΝΕΛΛΗΝΙΑ ΕΝΩΣΗ ΒΙΟΕΠΙΣΤΗΜΟΝΩΝ Σας αποστέλλουμε τις προτεινόμενες απαντήσεις και το Δελτίο Τύπου που αφορούν τα θέματα της Βιολογίας Προσανατολισμού των Ημερησίων Γενικών Λυκείων. Η

Διαβάστε περισσότερα

ΒΙΟΛΟΓΙΑ ΠΡΟΣΑΝΑΤΟΛΙΣΜΟΥ Γ ΛΥΚΕΙΟΥ ΘΕΜΑ Α. Α1. δ. Α2. δ. Α3. β. Α4. γ. Α5. α ΘΕΜΑ Β. Β1. I A. φωσφορική ομάδα. Ε. υδροξύλιο. ΣΤ. αμινομάδα. Β.

ΒΙΟΛΟΓΙΑ ΠΡΟΣΑΝΑΤΟΛΙΣΜΟΥ Γ ΛΥΚΕΙΟΥ ΘΕΜΑ Α. Α1. δ. Α2. δ. Α3. β. Α4. γ. Α5. α ΘΕΜΑ Β. Β1. I A. φωσφορική ομάδα. Ε. υδροξύλιο. ΣΤ. αμινομάδα. Β. ΜΑΘΗΜΑ: ΒΙΟΛΟΓΙΑ ΠΡΟΣΑΝΑΤΟΛΙΣΜΟΥ Γ ΛΥΚΕΙΟΥ ΘΕΜΑ Α Α1. δ Α2. δ Α3. β Α4. γ Α5. α ΘΕΜΑ Β Β1. I A. φωσφορική ομάδα II III IV V VI VII Ε. υδροξύλιο ΣΤ. αμινομάδα Β. mrna Ζ. RNA πολυμεράση Γ. μεταγραφόμενη

Διαβάστε περισσότερα


ΒΙΟΛΟΓΙΑ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ ΒΙΟΛΟΓΙΑ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ ΙΑΓΩΝΙΣΜΑ Θέµα 1 ο 1. Τα άτοµα που είναι ετερόζυγα για τη β-θαλασσαιµία: α. Εµφανίζουν ήπια αναιµία β. Έχουν ευαισθησία στην ελονοσία γ. Συνθέτουν µεγάλη ποσότητα HbF δ.

Διαβάστε περισσότερα

Βιολογία Γ Γενικού Λυκείου Θετικής κατεύθυνσης. Κεφάλαιο 1α Το Γενετικό Υλικό

Βιολογία Γ Γενικού Λυκείου Θετικής κατεύθυνσης. Κεφάλαιο 1α Το Γενετικό Υλικό Βιολογία Γ Γενικού Λυκείου Θετικής κατεύθυνσης Κεφάλαιο 1α Το Γενετικό Υλικό Το DNA είναι το γενετικό υλικό Αρχικά οι επιστήμονες θεωρούσαν ότι οι πρωτεΐνες αποτελούσαν το γενετικό υλικό των οργανισμών.

Διαβάστε περισσότερα



Διαβάστε περισσότερα

ΑΠΑΝΤΗΣΕΙΣ. ΘΕΜΑ Α A1. β Α2. γ Α3. γ Α4. α Α5. δ


Διαβάστε περισσότερα


ΕΠΑΝΑΛΗΠΤΙΚΑ ΘΕΜΑΤΑ Ο.Ε.Φ.Ε. 2004 ΘΕΜΑΤΑ ΒΙΟΛΟΓΙΑΣ Γ ΛΥΚΕΙΟΥ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ ΕΠΑΝΑΛΗΠΤΙΚΑ ΘΕΜΑΤΑ Ο.Ε.Φ.Ε. 2004 ΘΕΜΑ 1 Ο Α. Να επιλέξετε την ορθή πρόταση: ΘΕΜΑΤΑ ΒΙΟΛΟΓΙΑΣ Γ ΛΥΚΕΙΟΥ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ 1. Το κωδικόνιο του mrna που κωδικοποιεί το αµινοξύ µεθειονίνη είναι α. 5 GUA

Διαβάστε περισσότερα


ΒΙΟΛΟΓΙΑ ΠΡΟΣΑΝΑΤΟΛΙΣΜΟΥ ΟΜΑΔΑΣ ΥΓΕΙΑΣ & ΖΩΗΣ ΒΙΟΛΟΓΙΑ ΠΡΟΣΑΝΑΤΟΛΙΣΜΟΥ ΟΜΑΔΑΣ ΥΓΕΙΑΣ & ΖΩΗΣ ΘΕΜΑ Α Α1. δ Α2. δ Α3. β Α4. γ Α5. α ΘΕΜΑ Β Β1. Α. I, Β. IV, Γ. VI, Δ. VII, Ε. ΙΙ, ΣΤ. III, Ζ. V Β2. Αντιστοιχεί σε προκαρυωτικό οργανισμό. Στους προκαρυωτικούς

Διαβάστε περισσότερα

Πανελλήνιες Εξετάσεις Ημερήσιων Γενικών Λυκείων. Εξεταζόμενο Μάθημα: Βιολογία Θετικής Προσανατολισμού Θετικών Σπουδών, Ημ/νία: 16 Ιουνίου 2017

Πανελλήνιες Εξετάσεις Ημερήσιων Γενικών Λυκείων. Εξεταζόμενο Μάθημα: Βιολογία Θετικής Προσανατολισμού Θετικών Σπουδών, Ημ/νία: 16 Ιουνίου 2017 Πανελλήνιες Εξετάσεις Ημερήσιων Γενικών Λυκείων Εξεταζόμενο Μάθημα: Βιολογία Θετικής Προσανατολισμού Θετικών Σπουδών, Ημ/νία: 16 Ιουνίου 2017 Απαντήσεις Θεμάτων ΘΕΜΑ Α Α1. δ Α2. δ Α3. β Α4. γ Α5. α ΘΕΜΑ

Διαβάστε περισσότερα

Εργαλεία Μοριακής Γενετικής

Εργαλεία Μοριακής Γενετικής Εργαλεία Μοριακής Γενετικής Αρχές Μοριακής κλωνοποίησης Τα περιοριστικά ένζυμα: αναγνωρίζουν αλληλουχίες (θέσεις περιορισμού). 2 τύποι ενζύμων: -Τύπος I = Κόβουν κοντά στη θέση περιορισμού -σπάνια χρησιμοποιούνται.

Διαβάστε περισσότερα


Αθήνα, 18/5/2011 ΠΑΝΕΛΛΗΝΙΑ ΕΝΩΣΗ ΒΙΟΕΠΙΣΤΗΜΟΝΩΝ Αθήνα, 18/5/2011 ΠΑΝΕΛΛΗΝΙΑ ΕΝΩΣΗ ΒΙΟΕΠΙΣΤΗΜΟΝΩΝ Σας αποστέλλουμε τις προτεινόμενες απαντήσεις που αφορούν τα θέματα της Βιολογίας Θετικής Κατεύθυνσης των Ημερησίων Γενικών Λυκείων. Η Επιτροπή Παιδείας

Διαβάστε περισσότερα

ΑΠΑΝΤΗΣΕΙΣ. ΘΕΜΑ Α Α1. δ Α2. α Α3. α Α4. γ Α5. β. ΘΕΜΑ Β Β1. Στήλη Ι Στήλη ΙΙ 1. Γ 2. Β 3. Ε 4. Α 5. Δ


Διαβάστε περισσότερα



Διαβάστε περισσότερα

Κυτταρική Διαίρεση (Μίτωση και Μείωση) Μέρος Α Μοριακή Βιολογία και Γενετική BIOL 123 Άνοιξη 2015 Δρ. Χαρίτα Χρίστου

Κυτταρική Διαίρεση (Μίτωση και Μείωση) Μέρος Α Μοριακή Βιολογία και Γενετική BIOL 123 Άνοιξη 2015 Δρ. Χαρίτα Χρίστου Κυτταρική Διαίρεση (Μίτωση και Μείωση) Μέρος Α Μοριακή Βιολογία και Γενετική BIOL 123 Άνοιξη 2015 Δρ. Χαρίτα Χρίστου Παρουσιάσεις Power Point με υλικό από: Campbell και Reece (2010) ΒΙΟΛΟΓΙΑ τόμος Ι, 1

Διαβάστε περισσότερα

ΒΙΟΛΟΓΙΑ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ 16-2-2014 ΘΕΜΑ 1 ο Α. Να βάλετε σε κύκλο το γράμμα που αντιστοιχεί στη σωστή απάντηση. (Μονάδες 25)

ΒΙΟΛΟΓΙΑ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ 16-2-2014 ΘΕΜΑ 1 ο Α. Να βάλετε σε κύκλο το γράμμα που αντιστοιχεί στη σωστή απάντηση. (Μονάδες 25) ΤΣΙΜΙΣΚΗ &ΚΑΡΟΛΟΥ ΝΤΗΛ ΓΩΝΙΑ THΛ: 270727 222594 ΑΡΤΑΚΗΣ 12 - Κ. ΤΟΥΜΠΑ THΛ: 919113 949422 ΕΠΩΝΥΜΟ:... ΟΝΟΜΑ:... ΤΜΗΜΑ:... ΗΜΕΡΟΜΗΝΙΑ:... ΒΙΟΛΟΓΙΑ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ 16-2-2014 ΘΕΜΑ 1 ο Α. Να βάλετε σε

Διαβάστε περισσότερα

Κεφάλαιο 20 Η ρύθμιση της γονιδιακής έκφρασης στους ευκαρυωτικούς οργανισμούς

Κεφάλαιο 20 Η ρύθμιση της γονιδιακής έκφρασης στους ευκαρυωτικούς οργανισμούς Κεφάλαιο 20 Η ρύθμιση της γονιδιακής έκφρασης στους ευκαρυωτικούς οργανισμούς Πυρίνας ανθρώπινου μεσοφασικού κυττάρου στον οποίο παρατηρούμε, με ανοσοφθορισμό, τη διάστικτη κατανομή της απακετυλάσης των

Διαβάστε περισσότερα

EΠΑΝΑΛΗΠΤΙΚΟ ΔΙΑΓΩΝΙΣΜΑ ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ 1,2,4,9 ΚΕΦΑΛΑΙΑ. Εξεταζόμενο μάθημα. Συκούδη Κωνσταντίνα. Διδάσκων/επιβλέπων καθηγήτρια

EΠΑΝΑΛΗΠΤΙΚΟ ΔΙΑΓΩΝΙΣΜΑ ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ 1,2,4,9 ΚΕΦΑΛΑΙΑ. Εξεταζόμενο μάθημα. Συκούδη Κωνσταντίνα. Διδάσκων/επιβλέπων καθηγήτρια EΠΑΝΑΛΗΠΤΙΚΟ ΔΙΑΓΩΝΙΣΜΑ ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ 1,2,4,9 ΚΕΦΑΛΑΙΑ Εξεταζόμενο μάθημα Συκούδη Κωνσταντίνα Διδάσκων/επιβλέπων καθηγήτρια 3:00 ώρες Διάρκεια εξέτασης Ονοματεπώνυμο εξεταζόμενου Όνομα:

Διαβάστε περισσότερα

Τηλ: Ανδρέου Δημητρίου 81 & Ακριτών 26 -ΚΑΛΟΓΡΕΖΑ

Τηλ: Ανδρέου Δημητρίου 81 & Ακριτών 26 -ΚΑΛΟΓΡΕΖΑ ΔΙΑΓΩΝΙΣΜΑ ΒΙΟΛΟΓΙΑΣ Γ ΛΥΚΕΙΟΥ- ΘΕΤΙΚΗ ΚΑΤΕΥΘΥΝΣΗ (Ιανουάριος 2014) 1 ο ΘΕΜΑ Απαντήστε στις παρακάτω ερωτήσεις πολλαπλής επιλογής. Μία απάντηση είναι η σωστή. 1. Υβριδοποίηση: Α. Είναι ιδιότητα του DNA

Διαβάστε περισσότερα

ΤΟ ΓΕΝΕΤΙΚΟ ΥΛΙΚΟ. Με αναφορά τόσο στους προκαρυωτικούς όσο και στους ευκαρυωτικούς οργανισμούς

ΤΟ ΓΕΝΕΤΙΚΟ ΥΛΙΚΟ. Με αναφορά τόσο στους προκαρυωτικούς όσο και στους ευκαρυωτικούς οργανισμούς ΤΟ ΓΕΝΕΤΙΚΟ ΥΛΙΚΟ Με αναφορά τόσο στους προκαρυωτικούς όσο και στους ευκαρυωτικούς οργανισμούς Λειτουργίες Γενετικού Υλικού o Αποθήκευση της γενετικής πληροφορίας. Η οργάνωση της γενετικής πληροφορίας

Διαβάστε περισσότερα

σύγχρονο προπαρασκευή για Α.Ε.Ι. & Τ.Ε.Ι. & Group µαθητικό φροντιστήριο Γραβιάς 85 ΚΗΠΟΥΠΟΛΗ

σύγχρονο προπαρασκευή για Α.Ε.Ι. & Τ.Ε.Ι. & Group µαθητικό φροντιστήριο Γραβιάς 85 ΚΗΠΟΥΠΟΛΗ σύγχρονο Φάσµα & Group προπαρασκευή για Α.Ε.Ι. & Τ.Ε.Ι. µαθητικό φροντιστήριο Γραβιάς 85 ΚΗΠΟΥΠΟΛΗ 210 50 51 557 210 50 56 296 25ης Μαρτίου 111 ΠΕΤΡΟΥΠΟΛΗ 210 50 20 990 210 50 27 990 25ης Μαρτίου 74 ΠΕΤΡΟΥΠΟΛΗ

Διαβάστε περισσότερα

Δοµή και ιδιότητες του DNA σε επίπεδο χρωµατίνηςνουκλεοσώµατος. 09/04/ Μοριακή Βιολογία Κεφ. 1 Καθηγητής Δρ. Κ. Ε. Βοργιάς

Δοµή και ιδιότητες του DNA σε επίπεδο χρωµατίνηςνουκλεοσώµατος. 09/04/ Μοριακή Βιολογία Κεφ. 1 Καθηγητής Δρ. Κ. Ε. Βοργιάς Δοµή και ιδιότητες του DNA σε επίπεδο χρωµατίνηςνουκλεοσώµατος 09/04/2014 1 09/04/2014 2 Η καθαρά δοµική εικόνα της χρωµατίνης µας παρέχει µόνο µια στατική περιγραφή της. Δυναµική εικόνα της χρωµατίνης

Διαβάστε περισσότερα

8. Σε στέλεχος του βακτηρίου E.coli δε λειτουργεί το γονίδιο που παράγει τον καταστολέα του οπερόνιου της λακτόζης. Ποιο είναι το αποτέλεσμα σε σχέση

8. Σε στέλεχος του βακτηρίου E.coli δε λειτουργεί το γονίδιο που παράγει τον καταστολέα του οπερόνιου της λακτόζης. Ποιο είναι το αποτέλεσμα σε σχέση Γονιδιακή ρύθμιοη 1. Εντοπίστε δύο διαφορές στον έλεγχο της γονιδιακής έκφρασης ανάμεσα στους προκαρυωτικούς και στους ευκαρυωτικούς οργανισμούς. Α. Η ρύθμιση της γσνιδιακής έκφρασης στους προκαρυωτικούς

Διαβάστε περισσότερα

ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ ΟΝΟΜΑΤΕΠΩΝΥΜΟ: ΤΜΗΜΑ: ΘΕΜΑ 1 Ο. 3. Το DNA των μιτοχονδρίων έχει μεγαλύτερο μήκος από αυτό των χλωροπλαστών.

ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ ΟΝΟΜΑΤΕΠΩΝΥΜΟ: ΤΜΗΜΑ: ΘΕΜΑ 1 Ο. 3. Το DNA των μιτοχονδρίων έχει μεγαλύτερο μήκος από αυτό των χλωροπλαστών. ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ ΟΝΟΜΑΤΕΠΩΝΥΜΟ: ΤΜΗΜΑ: ΘΕΜΑ 1 Ο Α. Να γράψετε τον αριθμό της καθεμιάς από τις παρακάτω προτάσεις 1-5 και δίπλα του τη λέξη Σωστό, αν η πρόταση είναι σωστή, ή Λάθος, αν η πρόταση

Διαβάστε περισσότερα



Διαβάστε περισσότερα



Διαβάστε περισσότερα

Γαμετογένεση. Καθορισμός φύλου (όρχεις ς ή ωοθήκες) Πρόφαση Ι μείωσης Γαμετικά κύτταρα Γονάδα (μιτώσεις) έσμευση Έμβρυο. Θηλαστικά, Αμφίβια, ιχθύες

Γαμετογένεση. Καθορισμός φύλου (όρχεις ς ή ωοθήκες) Πρόφαση Ι μείωσης Γαμετικά κύτταρα Γονάδα (μιτώσεις) έσμευση Έμβρυο. Θηλαστικά, Αμφίβια, ιχθύες Γαμετογένεση Γαμετογένεση Καθορισμός φύλου (όρχεις ς ή ωοθήκες) G1 Σπερματογένεση Πρόφαση Ι μείωσης Γαμετικά κύτταρα Γονάδα (μιτώσεις) έσμευση Έμβρυο Ολοκλήρωση μείωσης Ι Γονιμοποίηση-ολοκλήρωση η η μείωσης

Διαβάστε περισσότερα



Διαβάστε περισσότερα


ΠΑΝΕΛΛΑΔΙΚΕΣ ΕΞΕΤΑΣΕΙΣ ΒΙΟΛΟΓΙΑ ΘΕΜΑ Α Θετικής κατεύθυνσης Α1. δ Α2. γ Α3. β Α4. γ Α5. β ΘΕΜΑ Β Β1. Η σωστή σειρά είναι: 4 2 1 6 3 5 Β2. α. DNA πολυμεράση β. πριμόσωμα γ. DNA δεσμάση δ. DNA ελικάσες ε. RNA πολυμεράση Β3. Σχολικό

Διαβάστε περισσότερα

ΑΠΑΝΤΗΣΕΙΣ. ΘΕΜΑ Α Α1. β Α2. β Α3. δ Α4. γ Α5. γ. ΘΕΜΑ Β Β1. Στήλη Ι Στήλη ΙΙ 1 Α 2 Γ 3 Α 4 Β 5 Α 6 Α 7 Γ


Διαβάστε περισσότερα



Διαβάστε περισσότερα

Ηλίας Ηλιόπουλος Εργαστήριο Γενετικής, Τµήµα Γεωπονικής Βιοτεχνολογίας, Γεωπονικό Πανεπιστήµιο Αθηνών

Ηλίας Ηλιόπουλος Εργαστήριο Γενετικής, Τµήµα Γεωπονικής Βιοτεχνολογίας, Γεωπονικό Πανεπιστήµιο Αθηνών Χηµική Μεταβίβαση Σήµατος Ηλίας Ηλιόπουλος Εργαστήριο Γενετικής, Τµήµα Γεωπονικής Βιοτεχνολογίας, Γεωπονικό Πανεπιστήµιο Αθηνών 1 Η Επικοινωνία στα Ζωϊκά Κύτταρα 1. Δίκτυα εξωκυτταρικών και ενδοκυτταρικών

Διαβάστε περισσότερα

ΜΕΤΑΓΡΑΦΗ ΤΟΥ DNA Περετσή Χριστίνα Πιτσικάλη Παναγιώτα

ΜΕΤΑΓΡΑΦΗ ΤΟΥ DNA Περετσή Χριστίνα Πιτσικάλη Παναγιώτα Εργασία στη Βιολογία ΜΕΤΑΓΡΑΦΗ ΤΟΥ DNA Περετσή Χριστίνα Πιτσικάλη Παναγιώτα ΜΕΤΑΓΡΑΦΗ ΤΟΥ DNA Η ροή της πληροφορίας για το σχηματισμό των πρωτεϊνών, προϋποθέτει τη μεταφορά της από το DNA στο RNA (ΜΕΤΑΓΡΑΦΗ).

Διαβάστε περισσότερα

Θετικών Σπουδών. Ενδεικτικές απαντήσεις θεμάτων

Θετικών Σπουδών. Ενδεικτικές απαντήσεις θεμάτων Πανελλαδικές Εξετάσεις Ημερήσιων Γενικών Λυκείων Εξεταζόμενο μάθημα: Βιολογία Προσανατολισμού Θετικών Σπουδών Παρασκευή, 16 Ιουνίου 2017 Ενδεικτικές απαντήσεις θεμάτων Θέμα Α Α1. α) 3 CAT 5 β) 3 TAC 5

Διαβάστε περισσότερα



Διαβάστε περισσότερα

Τα ορμονικά μόρια και η διαχείριση τους μέσα στο φυτό

Τα ορμονικά μόρια και η διαχείριση τους μέσα στο φυτό Φυσιολογία Φυτών Διαχείριση ορμονικών μορίων Τα ορμονικά μόρια και η διαχείριση τους μέσα στο φυτό Φυσιολογία Φυτών 3 ου Εξαμήνου Δ. Μπουράνης, Σ. Χωριανοπούλου 1 Φυσιολογία Φυτών Διαχείριση ορμονικών

Διαβάστε περισσότερα



Διαβάστε περισσότερα


ΒΙΟΛΟΓΙΑ Ο.Π. ΘΕΤΙΚΩΝ ΣΠΟΥΔΩΝ Κανάρη 36, Δάφνη Τηλ. 210 9713934 & 210 9769376 ΔΙΑΓΩΝΙΣΜΑ ΠΡΟΣΟΜΟΙΩΣΗΣ ΒΙΟΛΟΓΙΑ Ο.Π. ΘΕΤΙΚΩΝ ΣΠΟΥΔΩΝ ΘΕΜΑ Α Α1.Γ. Α2.Γ. Α3.Β. Α4.Β. Α5.Β. ΘΕΜΑ Β 1. Οι σωστές απαντήσεις είναι: A. Μεγαλύτερη συμβολή γενετικού

Διαβάστε περισσότερα


ΒΙΟΛΟΓΙΑ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ 02/12/2012 ΑΠΑΝΤΗΣΕΙΣ ΤΣΙΜΙΣΚΗ &ΚΑΡΟΛΟΥ ΝΤΗΛ ΓΩΝΙΑ THΛ: 270727 222594 ΑΡΤΑΚΗΣ 12 - Κ. ΤΟΥΜΠΑ THΛ: 919113 949422 ΒΙΟΛΟΓΙΑ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ 02/12/2012 ΑΠΑΝΤΗΣΕΙΣ ΘΕΜΑ 1 ο Α. Να βάλετε σε κύκλο το γράμμα που αντιστοιχεί στη

Διαβάστε περισσότερα


ΠΡΟΣΟΜΟΙΩΤΙΚΟ ΔΙΑΓΩΝΙΣΜΑ ΒΙΟΛΟΓΙΑΣ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ Κεφάλαια: 1 o 2 o ΑΠΑΝΤΗΣΕΙΣ ΠΡΟΣΟΜΟΙΩΤΙΚΟ ΔΙΑΓΩΝΙΣΜΑ ΒΙΟΛΟΓΙΑΣ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ Κεφάλαια: 1 o 2 o ΑΠΑΝΤΗΣΕΙΣ ΖΗΤΗΜΑ 1 ο Να επιλέξτε το γράμμα που αντιστοιχεί στη σωστή απάντηση ή στη φράση που συμπληρώνει σωστά την πρόταση. 1.

Διαβάστε περισσότερα


ΑΠΑΝΤΗΣΕΙΣ ΣΤΗ ΒΙΟΛΟΓΙΑ ΚΑΤΕΥΘΥΝΣΗΣ 24 ΜΑΪΟΥ 2013 ΑΠΑΝΤΗΣΕΙΣ ΣΤΗ ΒΙΟΛΟΓΙΑ ΚΑΤΕΥΘΥΝΣΗΣ 24 ΜΑΪΟΥ 2013 ΘΕΜΑ Α Α1. γ Α2. β Α3. α Α4. δ Α5. α ΘΕΜΑ Β Β1. Σελ. 123 124 σχολ. βιβλίου: «Η διαδικασία που ακολουθείται παράγουν το ένζυμο ADA». Β2. Σελ. 133 σχολ.

Διαβάστε περισσότερα


ΒΙΟΛΟΓΙΑ. 1 ο ΔΙΑΓΩΝΙΣΜΑ ΑΠΑΝΤΗΣΕΙΣ. ΘΕΜΑ 1 o ΘΕΜΑ 1 o Γ ΛΥΚΕΙΟΥ-ΘΕΤΙΚΗ ΚΑΤΕΥΘΥΝΣΗ 1 ο ΔΙΑΓΩΝΙΣΜΑ Α. Γιατί τα βακτήρια μπορούν να χρησιμοποιηθούν σαν «εργοστάσια παραγωγής ανθρώπινων πρωτεϊνών»; Β. Σε ένα βακτήριο εισάγεται με τη μέθοδο του ανασυνδυασμένου

Διαβάστε περισσότερα

Τ 28 G 22 C 22 2 η καλλιέργεια βακτηρίων Λόγω συμπληρωματικότητας βάσεων (Μοντέλο διπλής έλικας) και ότι A+T+G+C= 100 Έχω G = C = 28

Τ 28 G 22 C 22 2 η καλλιέργεια βακτηρίων Λόγω συμπληρωματικότητας βάσεων (Μοντέλο διπλής έλικας) και ότι A+T+G+C= 100 Έχω G = C = 28 ΠΑΝΕΛΛΗΝΙΕΣ ΕΞΕΤΑΣΕΙΣ Γ ΤΑΞΗΣ ΗΜΕΡΗΣΙΟΥ ΓΕΝΙΚΟΥ ΛΥΚΕΙΟΥ ΚΑΙ ΕΠΑΛ (ΟΜΑΔΑ Β ) ΤΕΤΑΡΤΗ 8 ΜΑΪΟΥ 2 ΕΞΕΤΑΖΟΜΕΝΟ ΜΑΘΗΜΑ: ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ ΑΠΑΝΤΗΣΕΙΣ ΘΕΜΑΤΩΝ ΘΕΜΑ Α Α. α Α2. δ Α3 γ Α4 β Α5. β ΘΕΜΑ

Διαβάστε περισσότερα

ΠΑΝΕΛΛΗΝΙΕΣ Απαντήσεις Βιολογίας κατεύθυνσης (ΕΠΑΝΑΛΛΗΠΤΙΚΕΣ ΗΜΕΡΗΣΙΟ)

ΠΑΝΕΛΛΗΝΙΕΣ Απαντήσεις Βιολογίας κατεύθυνσης (ΕΠΑΝΑΛΛΗΠΤΙΚΕΣ ΗΜΕΡΗΣΙΟ) ΠΑΝΕΛΛΗΝΙΕΣ 2016 Απαντήσεις Βιολογίας κατεύθυνσης (ΕΠΑΝΑΛΛΗΠΤΙΚΕΣ ΗΜΕΡΗΣΙΟ) Μιχάλης Χαλικιόπουλος ΘΕΜΑ Α Α1 β Α2 γ Α3 γ Α4 α Α5 δ ΘΕΜΑ Β Β1. Το βακτήριο Agrobacterium tumefaciens, το οποίο ζει στο έδαφος,

Διαβάστε περισσότερα