Κύτταρο, η Θεµελιώδης Μονάδα της Ζωής

Save this PDF as:
 WORD  PNG  TXT  JPG

Μέγεθος: px
Εμφάνιση ξεκινά από τη σελίδα:

Download "Κύτταρο, η Θεµελιώδης Μονάδα της Ζωής"

Transcript

1 ΚΕΦΑΛΑΙΟ 2 Κύτταρο, η Θεµελιώδης Μονάδα της Ζωής Α. ΕΡΩΤΗΣΕΙΣ ΚΛΕΙΣΤΟΥ ΤΥΠΟΥ Να βάλετε σε κύκλο το γράµµα που αντιστοιχεί στη σωστή απάντηση ή στη φράση που συµπληρώνει σωστά την πρόταση: 1. Οι µικρότερες λειτουργικές µονάδες στους πολυκύτταρους οργανισµούς είναι α. οι πυρήνες β. τα κύτταρα γ. τα κυτταρικά οργανίδια δ. τα άτοµα. 2. Ποιο από τα παρακάτω δε βρίσκεται στον πυρήνα; α. Τα ριβοσώµατα. β. Οι πυρηνίσκοι. γ. Τα χρωµοσώµατα. δ. Το πυρηνόπλασµα. 3. Το νερό διαχέεται διαµέσου της κυτταρικής µεµβράνης α. από τις περιοχές µε µεγαλύτερη συγκέντρωση προς τις περιοχές µε µικρότερη β. προς το εσωτερικό του κυττάρου, όταν το περιβάλλον είναι υποτονικό γ. όπως το οξυγόνο και το διοξείδιο του άνθρακα δ. από τις περιοχές µε µικρότερη συγκέντρωση προς τις περιοχές µε µεγαλύτερη. 25

2 4. Οι λειτουργίες που πραγµατοποιούνται στους πυρηνίσκους είναι α. η πρωτεϊνοσύνθεση β. η αντιγραφή και η µεταγραφή του DNA γ. η σύνθεση r-rna και η αντιγραφή δ. η σύνθεση ριβοσωµάτων. 5. Σε ποια από τις παρακάτω σειρές οργανιδίων το πρώτο οργανίδιο συνθέτει πρωτεΐνες, ενώ το δεύτερο διασπά τις πρωτεΐνες; α. Πυρήνας-ριβοσώµατα. β. Ριβοσώµατα-λυσοσώµατα. γ. Χλωροπλάστες-όργανο Γκόλτζι (Golgi). δ. Κυτταρική µεµβράνη-πυρήνας. 6. Κριτήριο για το χαρακτηρισµό ενός κυττάρου ως φυτικού είναι η ύπαρξη α. κυτταρικού τοιχώµατος β. χυµοτοπίου και η απουσία κεντροσωµατίου γ. πλαστιδίων δ. άµυλου και γλυκογόνου. 7. ιαµερισµατοποίηση συµβαίνει α. στα µιτοχόνδρια, όπου για παράδειγµα η διάσπαση των υδατανθράκων γίνεται στο στρώµα και η παραγωγή ΑΤΡ στα ελάσµατα του µιτοχονδρίου β. στο φυτικό κύτταρο, όπου για παράδειγµα οι χλωροπλάστες φτιάχνουν υδατάνθρακες και τα µιτοχόνδρια τους διασπούν γ. στους οργανισµούς, όπου για παράδειγµα τα διάφορα οργανικά συστήµατα εκτελούν ιδιαίτερες λειτουργίες δ. σε όλες τις παραπάνω περιπτώσεις. 8. Η πλασµατική µεµβράνη αποτελείται κυρίως από α. διπλοστιβάδα υδατανθράκων και πρωτεϊνών β. διπλοστιβάδα λιπιδίων στην οποία παρεµβάλλονται πρωτεϊνες γ. στιβάδα υδατανθράκων και λιπιδίων δ. διπλοστιβάδα πρωτεϊνών και λιπιδίων. 26

3 9. Οι κύριες λειτουργίες των µεµβρανών βασίζονται στην παρουσία α. των πρωτεϊνών β. των φωσφολιπιδίων γ. των νουκλεϊκών οξέων δ. των ορµονών. 10. Όλες οι µεµβράνες των πολυκύτταρων οργανισµών περιέχουν πρωτεΐνες α. µόνο για τη µεταφορά ουσιών β. µόνο για την υποδοχή ερεθισµάτων γ. µόνο για την αναγνώριση γειτονικών κυττάρων δ. µεταφοράς υποδοχής και αναγνώρισης. 11. Εάν ένα κύτταρο βρεθεί σε υποτονικό διάλυµα, τα µόρια του νερού α. θα κινηθούν προς τον ενδοκυτταρικό χώρο β. θα κινηθούν προς τον εξωκυτταρικό χώρο γ. δε θα µετακινηθούν δ. θα µετακινηθούν µε ενεργητική διαδικασία µεταφοράς. 12. Με τη διάχυση µετακινούνται δια µέσου της λιπιδικής µεµβράνης α. µόνο µόρια γλυκόζης β. µόνο µόρια οξυγόνου γ. µόνο µόρια διοξείδιου του άνθρακα δ. όλα τα µόρια που περιέχονται στα α, β και γ. 13. Ο µηχανισµός µεταφοράς ιόντων Να + διαµέσου της πλασµατικής µεµβράνης, από περιοχές χαµηλής συγκέντρωσης σε περιοχές υψηλής συγκέντρωσης, είναι ένα παράδειγµα α. παθητικής µεταφοράς β. διάχυσης γ. ενεργητικής µεταφοράς δ. ώσµωσης. 27

4 Να συµπληρώσετε µε τους κατάλληλους όρους τα κενά στις παρακάτω προτάσεις: 1. Όσο µεγαλύτερη είναι.. του κυττάρου τόσο ευκολότερα γίνεται η ανταλλαγή ουσιών µε το περιβάλλον. 2. Το κύτταρο πρέπει να έχει.... για εύκολη ανταλλαγή ουσιών και υποδοχή µηνυµάτων,.... για έγκαιρη µεταβίβαση των µηνυµάτων στο εσωτερικό του. 3. Το µοντέλο, που έχει προταθεί για την κυτταρική µεµβράνη, ονοµάζεται Οι µεµβράνες αποτελούνται από στοιβάδες Οι πρωτεΐνες παρεµβάλλονται στη.. των φωσφολιπιδίων. 6. Τα υδρόφιλα τµήµατα των λιπιδίων της πλασµατικής µεµβράνης στρέφονται.... και.... κυτταρικό περιβάλλον. 7. Η µεµβράνη αποκτά σταθερότητα λόγω της έλξης που αναπτύσσεται µεταξύ των.... και των.. τµηµάτων των λιπιδίων. 8. Η χοληστερόλη παίζει σηµαντικό ρόλο για.... των µεµβρανών. 9. Όταν τα µόρια διασπείρονται από τις περιοχές υψηλής συγκέντρωσης προς τις περιοχές χαµηλής συγκέντρωσης αναφερόµαστε στο φαινόµενο της Η ώσµωση είναι µία ειδική περίπτωση.. µορίων µέσω ηµιπερατής µεµβράνης. 11. Ο µηχανισµός µε τον οποίο µετακινούνται τα ιόντα Κ + και Να + χαρακτηρίζεται ως Με την εξωκύττωση.. οι ουσίες που παράγονται στο κύτταρο. 13. Η εισαγωγή ουσιών µεγάλου µοριακού βάρους γίνεται µε τη διαδικασία της... 28

5 14. Οι πρωτεΐνες και τα λιπίδια της µεµβράνης συνδέονται µε υδατάνθρακες και συνθέτουν.. και Οι γλυκοπρωτεΐνες της µεµβράνης παίζουν τον ρόλο του Οι υποδοχείς της πλασµατικής µεµβράνης ανήκουν στην κατηγορία των Οι πυρηνικοί πόροι ελέγχουν την ανταλλαγή των.. µε το κυτταρόπλασµα. 18. Το rrna συντίθεται Ο πυρήνας φυλάσσει Η αντιγραφή του DNA διεξάγεται στον Τα διάφορα RNA συντίθενται Τα ριβοσώµατα εντοπίζονται Η σύνθεση των λιπιδίων γίνεται Η επεξεργασία των πρωτεϊνών γίνεται Τα λυσοσώµατα περιβάλλονται από.... µεµβράνη. 26. Τα υπεροξειδιοσώµατα περιβάλλονται από.... µεµβράνη. 27. Τα χυµοτόπια των φυτικών κυττάρων αποτελούν Οι χλωροπλάστες περιβάλλονται από.... µεµβράνη. 29. Το DNA του χλωροπλάστη εντοπίζεται Τα ώριµα ερυθρά αιµοσφαίρια δεν περιέχουν.. και Τα µιτοχόνδρια περιβάλλονται από.... µεµβράνη. 32. Το DNA και τα ριβοσώµατα των µιτοχονδρίων εντοπίζονται

6 1. Να αντιστοιχίσετε τους όρους που αναγράφονται στη στήλη Ι µε τις έννοιες ή τις φράσεις που αναγράφονται στη στήλη ΙΙ. Για το σκοπό αυτό να γράψετε δίπλα από κάθε γράµµα της στήλης Ι τον αριθµό που ταιριάζει από τη στήλη ΙΙ (π.χ. Α-1) Ι ΙΙ 2. Α.... Ριβόσωµα Β.... Κυτταρικό τοίχωµα Γ.... Κενοτόπιο.... Μιτοχόνδριο Ε.... Πυρήνας ΣΤ.... Αµυλόκκοκος Ζ.... Κυτταρική µεµβράνη H.... Χλωροπλάστης Θ.... Ενδοπλασµατικό δίκτυο Ι.... Λυσόσωµα Κ.... Γλυκογόνο Ι 1. περιέχει γενετικό υλικό 2. χώρος παραγωγής χηµικής ενέργειας 3. αποταµιευτικό υλικό ζώων 4. χώρος φωτοσύνθεσης 5. χώρος πρωτεϊνικής σύνθεσης 6. αποτελείται από κυτταρίνη 7. αποταµιευτικό υλικό φυτών 8. ελέγχει την είσοδο και την έξοδο των συστατικών 9. δίκτυο σωλήνων του κυτταροπλάσµατος 10. αποθήκες άχρηστων προϊόντων µεταβολισµού ΙΙ Α.... ιοξείδιο του άνθρακα Β.... Μικροοργανισµοί Γ.... Λιπόφοβες ουσίες.... ιαλυτές ουσίες στο νερό Ε.... Αντλία ιόντων Να + ΣΤ.... Μόρια νερού 1. Ενδοκύττωση 2. ιάχυση 3. Ώσµωση 4. Ενεργητική µεταφορά 30

7 3. Ι ΙΙ Α.... Αντλία Κ +, Να + Β.... ιάχυση Γ.... Ψευδοπόδια.... Χρωµατίνη Ε.... Θυλακοειδή 1. Ενεργητική µεταφορά 2. Παθητική µεταφορά 3. Λευκά αιµοσφαίρια 4. Πυρήνας 5. Χλωροπλάστες 6. Μυοσίνη Β. ΕΡΩΤΗΣΕΙΣ ΑΝΟΙΚΤΟΥ ΤΥΠΟΥ Να χρησιµοποιήσετε σωστά τους παρακάτω όρους και να διατυπώσετε από µια πρόταση, που να εκφράζει την έννοια του όρου: ευκαρυωτικό κύτταρο διαµερισµατοποίηση χρωµατίνη παθητική µεταφορά φαγοκύττωση πυρηνόπλασµα υπεροξειδιοσώµατα κυτταρικός σκελετός αδρό ενδοπλασµατικό δίκτυο Να απαντήσετε σύντοµα σε καθεµία από τις παρακάτω ερωτήσεις (10-20 λέξεις): 1. Πώς σχετίζεται η ώσµωση µε τη διάχυση; 2. Να δώσετε ένα παράδειγµα στο οποίο µεταφέρεται νερό µε το φαινόµενο της ώσµωσης. 3. Ποιος είναι ο ρόλος των µικροϊνιδίων και των µικροσωληνίσκων; 31

8 4. Ποιο οργανίδιο διασπά άχρηστες ή βλαβερές ουσίες στο κύτταρο; 5. Το κύτταρο χρειάζεται διάφορες ουσίες για τις λειτουργίες του. Να εξηγήσετε µε ποιο τρόπο οι ουσίες αυτές επηρεάζουν την κατεύθυνση της διάχυσης. 6. Γιατί το κύτταρο ανταλλάσσει ουσίες µε το περιβάλλον του; 7. Να γράψετε ποιο είναι το οργανίδιο που συµβάλει στην αποτοξίνωση του οργανισµού από το οινόπνευµα. 8. Να εξηγήσετε γιατί τα ώριµα ερυθρά αιµοσφαίρια δεν περιέχουν µιτοχόνδρια. 9. Να αναφέρετε τους κυτταρικούς σχηµατισµούς οι οποίοι υποστηρίζουν µηχανικά τα κύτταρα. 10. Να αναφέρετε τα κυτταρικά οργανίδια στα οποία παράγεται η απαραίτητη για τα κύτταρα ενέργεια. 11. Να γράψετε σύντοµα την κυτταρική θεωρία και να αναφέρετε τα ονόµατα των δύο βιολόγων που τη διατύπωσαν. 12. Να γράψετε τις διαφορές του ευκαρυωτικού από το προκαρυωτικό κύτταρο. 13. Τι αναφέρει το µοντέλο του ρευστού µωσαϊκού και ποιοι το διετύπωσαν; 14. Πού οφείλεται η σταθερότητα της µεµβράνης των κυττάρων; 15. Ποιο ρόλο παίζουν οι έλξεις που αναπτύσσονται αφενός µεταξύ των υδρόφιλων τµηµάτων των λιπιδίων και των µορίων του νερού, αφετέρου µεταξύ των ίδιων των υδρόφοβων τµηµάτων των λιπιδίων για το κύτταρο; 16. Ποια ιδιότητα των συστατικών της πλασµατικής µεµβράνης αποδίδει ο όρος ρευστό µωσαϊκό ; 17. Ποια είναι η σηµασία για το κύτταρο της ρευστότητας της κυτταρικής µεµβράνης; 18. Ποιο στεροειδές, συµβάλει στη ρευστότητα της κυτταρικής µεµβράνης; Να το περιγράψετε σύντοµα. 19. Ποιο µακροµόριο εµποδίζει τη στερεοποίηση της κυτταρικής µεµβράνης; 20. Να γράψετε παραδείγµατα κυττάρων τα οποία δεν περιέχουν µιτοχόνδρια. 21. Να συγκρίνετε ένα µιτοχόνδριο µε ένα χλωροπλάστη και να γράψετε δύο διαφορές και δύο οµοιότητες. 22. Σε ποιο κυτταρικό χώρο γίνεται η σύνθεση των λιπιδίων και η εξουδετέρωση των τοξικών ουσιών; 32

9 Να απαντήσετε στις παρακάτω ερωτήσεις µε µία παράγραφο (20-40 λέξεις): 1. Ένα γυάλινο δοχείο περιέχει δύο διαλύµατα άλατος χωρισµένα µε µια µεµβράνη. Το ύψος της στήλης του διαλύµατος από την αριστερή πλευρά της µεµβράνης είναι µεγαλύτερο από το ύψος στη δεξιά πλευρά. Η µεµβράνη είναι διαπερατή από το νερό, αλλά όχι από το άλας. Σε ποια πλευρά του δοχείου η συγκέντρωση του άλατος ήταν µεγαλύτερη; Να δικαιολογήσετε την απάντησή σας. 2. Τα ερυθρά αιµοσφαίρια του αίµατος, τα οποία δεν έχουν µιτοχόνδρια, µεταφέρουν οξυγόνο σε όλα τα µέρη του σώµατος µε την κυκλοφορία του αίµατος. Με βάση αυτή την πληροφορία γίνεται φανερό ότι το οξυγόνο διαπερνά τη κυτταρική µεµβράνη των ερυθρών αιµοσφαιρίων. Με ποια διαδικασία γίνεται αυτή η µετακίνηση: µε παθητική ή ενεργητική µεταφορά; Να δικαιολογήσετε την απάντησή σας. 3. Εάν χρησιµοποιήσουµε το θαλασσινό νερό για πόσιµο, θα παρατηρήσουµε απώλεια νερού από το σώµα µας. Να εξηγήσετε γιατί συµβαίνει αυτό. 4. Να ονοµάσετε τα οργανίδια (α, β, γ, δ, ε) του κυττάρου, στο διπλανό σχήµα και να γράψετε για το ρόλο τους στη σύνθεση και στη µετατροπή των πρωτεϊνών. Να εξηγήσετε την απάντησή σας. 5. Να γράψετε τα τρία σηµαντικότερα επιχειρήµατα στα οποία βασίζεται η κυτταρική θεωρία. 6. Να περιγράψετε τα κύρια χαρακτηριστικά του µοντέλου του υγρού µωσαϊκού. 7. Να περιγράψετε τη διαδροµή που ακολουθεί µια ουσία που εισέρχεται στο κύτταρο µε ενδοκύττωση. 33

10 8. Η κατανόηση της δοµής του κυττάρου εξαρτάται από την εξέλιξη της τεχνολογίας; Να δικαιολογήσετε την απάντησή σας. 9. Κάποιες από τις πρωτεΐνες των ευκαρυωτικών κυττάρων δρουν πολύ µακριά από τον χώρο παραγωγής τους. Να εξηγήσετε µε ποια διαδικασία πραγµατοποιούν το ταξίδι τους, µέχρι να φτάσουν στην περιοχή που εκδηλώνεται η δράση τους. 10. Η πλασµατική µεµβράνη ρυθµίζει την είσοδο των θρεπτικών συστατικών και των άλλων µορίων που απαιτούνται για τις κυτταρικές διαδικασίες. Τα άχρηστα συστατικά του µεταβολισµού αποβάλλονται από το κύτταρο µέσω της πλασµατικής µεµβράνης. Με ποια διαδικασία πραγµατοποιείται η αποβολή τους; 11. Να αναφέρετε τις κυριότερες αρχές της σύγχρονης κυτταρικής θεωρίας. 12. Να περιγράψετε τις κυριότερες λειτουργίες της κυτταρικής µεµβράνης. 13. Πόσοι τύποι µεταφοράς χαρακτηρίζουν τη διέλευση ουσιών διαµέσου της κυτταρικής µεµβράνης; 14. Να περιγράψετε τα στάδια της ενδοκύττωσης. 15. Πώς εξηγείται το γεγονός ότι οι ορµόνες µπορούν να συνδέονται µόνο µε µια κατηγορία κυττάρων ενός οργανισµού και όχι µε όλα τα κύτταρα; 16. Ποιες πρωτεΐνες ονοµάζονται αντιγόνα ιστοσυµβατότητας; 17. Πώς γίνεται ο διαχωρισµός σε οµάδες αίµατος; 18. Τι γνωρίζετε για τα συγκολητιγόνα και τις συγκολητίνες; 19. Για ποιο λόγο, κύτταρα στα οποία έχει αφαιρεθεί ο πυρήνας, δεν αναπαράγονται; 20. Να εξηγήσετε γιατί τα ώριµα ερυθρά κύτταρα δεν µπορούν να αναπαραχθούν; 21. Με ποια διαδροµή γίνεται η µεταφορά ουσιών από τον πυρήνα προς τον εξωκυτταρικό χώρο; 22. Σε ποια οργανίδια γίνεται η πέψη των µεγαλοµοριακών ουσιών ενδοκυτταρικής και εξωκυτταρικής προέλευσης; Ποια οργανίδια του κυττάρου εξειδικεύονται στο πακετάρισµα ουσιών; Να δώσετε ένα παράδειγµα που να δείχνει τον τρόπο µε τον οποίο και η κυτταρική µεµβράνη δηµιουργεί πακετάρισµα ουσιών. 34

11 Γ. ΠΡΟΒΛΗΜΑΤΑ ΕΡΓΑΣΙΕΣ 1. Να σχεδιάσετε ένα φυτικό κύτταρο και τα κυριότερα οργανίδια που περικλείει. 2. Να σχεδιάσετε ένα ζωϊκό κύτταρο και τα κυριότερα οργανίδια που περικλείει. 3. Να σχεδιάσετε ένα τµήµα της πλασµατικής µεµβράνης σηµειώνοντας µε αριθµούς τα βιολογικά µόρια που συµµετέχουν σε αυτή. 4. Ας υποθέσουµε ότι παρατηρείτε στο µικροσκόπιο κύτταρα. Είναι γνωστό ότι τα σύνορα των κυττάρων συχνά δε διακρίνονται στο µικροσκόπιο. Παρ όλα αυτά µπορεί κανείς να µετρήσει τα κύτταρα, χρησιµοποιώντας χρωστικές. α) Να αναφέρετε το οργανίδιο που χρωµατίζεται έντονα και χάρη στο χρωµατισµό του οποίου µπορεί να γίνει η καταµέτρηση των κυττάρων; β) Ποιων οργανιδίων ο χρωµατισµός θα µας βοηθήσει να ξεχωρίσουµε αν τα υπό παρατήρηση κύτταρα είναι φυτικά ή ζωικά; 5. Κατά τη µικροσκοπική εξέταση παρασκευάσµατος φυτικών κυττάρων σε σχολικό εργαστήριο Βιολογίας ένας µαθητής παρατηρεί ότι πολλά από αυτά τα κύτταρα έχουν υποστεί πλασµόλυση. α) Ποια είναι η αιτία για την πλασµόλυση; β) Να σχεδιάσετε ένα κύτταρο το οποίο έχει υποστεί πλασµόλυση. 6. Να περιγράψετε τη δοµή: α) του κυτταρικού τοιχώµατος ενός φυτικού κυττάρου β) της κυτταρικής µεµβράνης ενός φυτικού κυττάρου Στην απάντηση σας να περιλαµβάνεται και η περιγραφή της διάταξης των µορίων των δύο παραπάνω σχηµατισµών και η ερµηνεία, µε ποιο τρόπο η διάταξη αυτή επηρεάζει τις δύο κυτταρικές δοµές. 7. Στο διπλανό σχήµα απεικονίζεται ένα µιτοχόνδριο ηπατικού κυττάρου: α) Να γράψετε τις ονοµασίες των δοµών του µιτοχονδρίου που δείχνουν τα βέλη. β) Να εξηγήσετε το λόγο για τον οποίο τα ηπατικά κύτταρα έχουν πολλά µιτοχόνδρια γ) Τα µιτοχόνδρια περιέχουν δικό τους DNA και ριβοσώµατα. Να εξηγήσετε γιατί συµβαίνει αυτό. 35

12 8. Το διπλανό σχήµα δείχνει τµήµα ενός ζωικού κυττάρου. α) Να γράψετε τις ονοµασίες των δοµών που δείχνουν τα βέλη. β) Να αναφέρετε ποιος είναι ο ρόλος της κάθε δοµής για τη ζωή του κυττάρου. 9. Ο παρακάτω πίνακας αναφέρεται σε τρία κύτταρα, ένα ηπατικό κύτταρο του ανθρώπου, ένα βακτηριακό, ένα φυτικό και στις κυτταρικές δοµές που περιέχουν: Κυτταρική δοµή Βακτηριακό ηπατικό φυτικό κύτταρο Πυρηνική µεµβράνη Κυτταρικό τοίχωµα Κοκκία γλυκογόνου Χλωροπλάστες Κεντρόσωµα Αµυλόκκοκοι Να σηµειώσετε µε Χ την παρουσία της δοµής σε κάθε κύτταρο. 10. Ο καθηγητής στο µάθηµα της Βιολογίας, σας έδειξε µια φωτογραφία ενός κυττάρου από ηλεκτρονικό µικροσκόπιο, στο οποίο διακρίνονται πολλά µιτοχόνδρια, το σύµπλεγµα Golgi και εκτεταµένο ενδοπλασµατικό δίκτυο. Ποια κυτταρική δραστηριότητα θα δικαιολογούσε την ύπαρξη των παραπάνω τριών κυτταρικών δοµών; 11. Στο διπλανό σχήµα απεικονίζεται ένα τµήµα από την κυτταρική µεµβράνη: α) Να ονοµάσετε τα βιολογικά συστατικά που σηµειώνονται µε τα βέλη. β) Να γράψετε ποιος είναι ο ρόλος αυτών των βιολογικών συστατικών. 36

13 12. Ορισµένα βακτήρια ζουν σε θερµοκρασίες που πλησιάζουν τους 100 ο C. (π.χ. τα βακτήρια που ζουν στις πλαγιές των ηφαιστείων και των θερµών θαλάσσιων ρευµάτων.) Γνωρίζουµε ότι οι κυτταρικές µεµβράνες αποτελούνται κυρίως από φωσφολιπίδια. Χρησιµοποιώντας τις γνώσεις σας, από τον τρόπο διάταξης των φωσφολιπιδίων και των ουσιών που παρεµβάλλονται σε αυτά, να ερµηνεύσετε µε ποιο τρόπο στερεοποιούνται οι µεµβράνες των παραπάνω βακτηρίων, ώστε να επιβιώνουν στις ακραίες θερµοκρασίες. 13. Ένα σαλιγκάρι, αν του ρίξουµε αλάτι, πεθαίνει. Ο άνθρωπος, µετά από γεύµα µε αλµυρό φαγητό, έχει έντονο αίσθηµα δίψας. Να ερµηνεύσετε αυτά τα δύο φαινόµενα, χρησιµοποιώντας τις γνώσεις σας σχετικά µε τα φαινόµενα της ώσµωσης και διάχυσης. Να συµπληρώσετε µε τις κατάλληλες έννοιες τα κενά του εννοιολογικού χάρτη που ακολουθεί: Μέσα στο κύτταρο υπάρχουν ; το κυτταρόπλασµα που λειτουργεί ως: που περιέχει: ; ριβοσώµατα που λειτουργούν ως: Ε.., όργανο Golgi που λειτουργεί ως: που λειτουργεί ως: ; ; που λειτουργεί ως: ; ; σκελετός κέντρο παραγωγής ενέργειας 37

14 . ΠΑΡΑ ΕΙΓΜΑΤΑ ΚΡΙΤΗΡΙΩΝ ΑΞΙΟΛΟΓΗΣΗΣ Παράδειγµα κριτηρίου αξιολόγησης σύντοµης διάρκειας Αντικείµενο εξέτασης: Κύτταρο, η θεµελιώδης µονάδα της ζωής Στόχοι που ελέγχονται: Ανάκληση γνώσεων, κατανόηση, κριτική σκέψη ΣΤΟΙΧΕΙΑ ΜΑΘΗΤΗ Επώνυµο:.. Όνοµα:... Τάξη:. Τµήµα: Μάθηµα:.... Ηµεροµηνία:. ΕΡΩΤΗΣΕΙΣ 1. Να γράψετε ένα χαρακτηριστικό, για το οποίο η κυτταρική µεµβράνη είναι διαφορετική από µια πλαστική σακούλα. Μονάδες 2 2. Ποιο είναι το πλεονέκτηµα της διαµερισµατοποίησης του ευκαρυωτικού κυττάρου; Μονάδες 3 3. Να περιγράψετε σύντοµα τις λειτουργίες των παρακάτω κυτταρικών οργανιδίων: πυρήνας, µιτοχόνδριο, χλωροπλάστης, ριβόσωµα, χυµοτόπιο. Μονάδες 5 4. Σε τι διαφέρει η παθητική από την ενεργητική µεταφορά ουσιών διαµέσου της πλασµατικής µεµβράνης; Γιατί είναι σηµαντικοί και οι δύο τύποι µεταφοράς ουσιών για το κύτταρο; Μονάδες 5 5. Να επιλέξετε µια από τις διαφορές µεταξύ προκαρυωτικού και ευκαρυωτικού κυττάρου και να εξηγήσετε πώς αυτή η διαφορά αυξάνει τις δυνατότητες του ευκαρυωτικού κυττάρου. Μονάδες 5 38

15 Παράδειγµα ωριαίου κριτηρίου αξιολόγησης Αντικείµενο εξέτασης: Κύτταρο, Η θεµελιώδης µονάδα της ζωής Στόχοι που ελέγχονται: Ανάκληση γνώσεων, κατανόηση, κριτική σκέψη ΣΤΟΙΧΕΙΑ ΜΑΘΗΤΗ Επώνυµο:.. Όνοµα:... Τάξη:. Τµήµα: Μάθηµα:.... Ηµεροµηνία:. ΕΡΩΤΗΣΕΙΣ 1. Α. Να βάλετε σε κύκλο το γράµµα που αντιστοιχεί στη σωστή απάντηση ή στη φράση που συµπληρώνει σωστά την πρόταση: Εάν ένα κύτταρο βρεθεί σε υποτονικό διάλυµα τα µόρια του νερού α. θα κινηθούν προς το κύτταρο β. θα κινηθούν προς τον εξωκυτταρικό χώρο γ. δε θα µετακινηθούν δ. θα µετακινηθούν µε ενεργητική διαδικασία µεταφοράς. Η πλασµατική µεµβράνη αποτελείται κυρίως από α. διπλοστιβάδα υδατανθράκων και πρωτεϊνών β. διπλοστιβάδα λιπιδίων στα οποία παρεµβάλλονται πρωτεΐνες γ. στιβάδα υδατανθράκων και λιπιδίων δ. διπλοστιβάδα πρωτεϊνών και υδατανθράκων. Μονάδες 2 39

16 1. Β. Να συµπληρώσετε µε τους κατάλληλους όρους τα κενά στις παρακάτω προτάσεις: Ο µηχανισµός µετακίνησης των ιόντων Κ + και Να + χαρακτηρίζεται ως... Για τη διατήρηση της ρευστότητας των µεµβρανών σηµαντικό ρόλο παίζει ένα λιπίδιο που ονοµάζεται... Η σύνθεση των πρωτεϊνών γίνεται σε σχηµατισµούς που ονοµάζονται... Μονάδες 3 2. Να χαρακτηρίσετε µε Σ (σωστό) ή µε Λ (λάθος) τις παρακάτω προτάσεις: Στο εσωτερικό του πυρήνα περιέχεται γενετικό υλικό και ριβοσώµατα. ( ) Στα ριβοσώµατα γίνεται η σύνθεση των πρωτεϊνών. ( ) Τα µιτοχόνδρια είναι τα εργοστάσια παραγωγής ενέργειας του κυττάρου. ( ) Η πλασµατική µεµβράνη ελέγχει το είδος των ουσιών που εισέρχονται - εξέρχονται από τα κύτταρα και συµµετέχει την υποδοχή και ερµηνεία µηνυµάτων από το περιβάλλον. ( ) Τα λυσοσώµατα είναι οργανίδια στα οποία γίνεται σύνθεση υδατανθράκων και πρωτεϊνών ( ) Μονάδες 5 3. Να απαντήσετε σύντοµα σε καθεµία από τις παρακάτω ερωτήσεις: Να περιγράψετε το µοντέλο του ρευστού µωσαϊκού για τη δοµή των µεµβρανών. Ποιος είναι ο ρόλος των πρωτεϊνών της πλασµατικής µεµβράνης; Μονάδες 5 4. Μία από τις θεωρίες που διατύπωσαν οι Βιολόγοι αναφέρει ότι τα µιτοχόνδρια και οι χλωροπλάστες αρχικά ήταν προκαρυωτικοί οργανισµοί, οι οποίοι σε κάποιο στάδιο της εξέλιξης διείσδυσαν στο ευκαρυωτικό κύτταρο και από τότε συµβιώνουν µε αυτό. Να αναφέρετε πού βασίστηκε, κατά την άποψή σας, η θεωρία αυτή. Μονάδες 5 40

17 ΚΕΦΑΛΑΙΟ 3 Μεταβολισµός Α. ΕΡΩΤΗΣΕΙΣ ΚΛΕΙΣΤΟΥ ΤΥΠΟΥ Να βάλετε σε κύκλο το γράµµα που αντιστοιχεί στη σωστή απάντηση ή στη φράση που συµπληρώνει σωστά την πρόταση: 1. Η εµφάνιση καταλυτικών ιδιοτήτων σε ένα πρωτεϊνικό µόριο εξαρτάται πάντα από α. την ύπαρξη ενός µικρού οργανικού µορίου, του συνένζυµου β. την ύπαρξη καταλλήλων συνθηκών θερµοκρασίας και PH γ. την εξειδίκευση της δράσης του δ. την καθορισµένη αλληλουχία των αµινοξέων του. 2. Η δράση ενός ενζύµου πάνω στο υπόστρωµά του έχει ως αποτέλεσµα α. την ισχυροποίηση των δεσµών του υποστρώµατος β. την εξασθένηση των δεσµών του υποστρώµατος γ. την αδρανοποίηση των δεσµών του υποστρώµατος δ. τη χαλάρωση και το σπάσιµο των δεσµών του ενζύµου. 3. Η φωτεινή φάση της φωτοσύνθεσης διεξάγεται α. στα θυλακοειδή β. στο κυτταρόπλασµα γ. στην κυτταρική µεµβράνη δ. στο στρώµα 41

18 4. Η σκοτεινή φάση της φωτοσύνθεσης διεξάγεται α. στα γκράνα (grana) β. στα θυλακοειδή γ. στα µιτοχόνδρια δ. στο στρώµα. 5. Φωτοσύνθεση γίνεται α. στα φυτά, στους µύκητες και στα φύκη β. σε όλους τους αυτότροφους οργανισµούς γ. στα φυτά, στα χλωροφύκη και στα κυανοφύκη δ. σε όλα τα αυτότροφα βακτήρια, στα φύκη και στα φυτά. 6. Ποια από τα παρακάτω συστατικά απαιτούνται ταυτόχρονα, για την πραγµατοποίηση της γλυκόλυσης σε ένα ζωντανό κύτταρο; α. Γλυκόζη και οξυγόνο. β. ΑΤΡ και γλυκόζη. γ. Οξυγόνο και ΑΤΡ. δ. Πυροσταφυλικό οξύ και οξυγόνο. 7. Σε µικροοργανισµούς, που έχουν τη δυνατότητα να µεταβολίζουν τη γλυκόζη τόσο αερόβια όσο και αναερόβια, επιλέγεται η αερόβια οδός, όταν οι συνθήκες το επιτρέπουν, γιατί α. τα προϊόντα της ζύµωσης ελαττώνουν τη µεταβολική δραστηριότητα του κυττάρου λόγω µεταβολής του pη β. παράγεται περισσότερη ενέργεια ανά µόριο γλυκόζης, λόγω του γεγονότος ότι όλα τα άτοµα C οξειδώνονται στο µέγιστο βαθµό γ. τα προϊόντα της ζύµωσης είναι τοξικά για το κύτταρο και το περιβάλλον του δ. έχουµε µεγαλύτερη ενεργειακή απόδοση, επειδή η ενέργεια που απελευθερώνεται από τα σάκχαρα αθροίζεται και µε την ενέργεια που απελευθερώνεται από το Ο 2. 42

19 8. Το τελευταίο βήµα της κυτταρικής αναπνοής είναι α. η παραγωγή υδρογόνου β. ο σχηµατισµός 36 µορίων ΑΤΡ γ. η αναγωγή του οξυγόνου σε νερό δ. η µεταφορά ηλεκτρονίων µέσω της αναπνευστικής αλυσίδας. 9. Τα ένζυµα έχουν α. ένα ενεργό κέντρο β. περισσότερα από δύο πολυπεπτίδια γ. ένα ή περισσότερα ενεργά κέντρα δ. συµπληρωµατικές αζωτούχες βάσεις. Να συµπληρώσετε µε τους κατάλληλους όρους τα κενά στις παρακάτω προτάσεις: 1. Ο καταβολισµός περιλαµβάνει τις αντιδράσεις.. οργανικών ενώσεων σε.. µε παράλληλη.. ενεργείας. 2. Ο αναβολισµός περιλαµβάνει τις αντιδράσεις.. ουσιών µε παράλληλη.. ενέργειας. 3. Οι καταβολικές αντιδράσεις, είναι αντιδράσεις.., ενώ οι αναβολικές, είναι αντιδράσεις Η τριφωσφορική αδενοσίνη περιέχει δεσµούς Η καταλυτική δράση των ενζύµων, καθορίζεται από.. δοµή του πρωτεϊνικού µορίου. 6. Οι αναστολείς των ενζύµων διακρίνονται σε.. και Πολλά συνένζυµα είναι Με τη βοήθεια.. και των άλλων φυτοσυνθετικών χρωστικών τα φυτά συνθέτουν σάκχαρα από απλές ανόργανες ενώσεις 43

20 9. Τα θυλακοειδή περιέχουν τις φωτοσυνθετικές χρωστικές οργανωµένες σε Κάθε φωτοσύστηµα περιλαµβάνει χλωροφύλλες.., οι οποίες διεγείρονται και ένα µόριο.. το οποίο ιονίζεται. 11. Στην κυκλική φωσφορυλίωση τα ηλεκτρόνια ξεκινούν από το µόριο.. και επιστρέφουν στο.., αποδίδοντας ενέργεια για τη σύνθεση ΑΤΡ. Β. ΕΡΩΤΗΣΕΙΣ ΑΝΟΙΚΤΟΥ ΤΥΠΟΥ Να χρησιµοποιήσετε σωστά τους παρακάτω όρους και να διατυπώσετε από µια πρόταση, που να εκφράζει την έννοια του όρου: µεταβολισµός συγκέντρωση θυλακοειδή υποστρώµατος ακετυλο-συνένζυµο Α φωτεινή ενέργεια χλωροφύλλες ολοένζυµο φωτοσύστηµα ΙΙ αναερόβια αναπνοή συνένζυµο κυκλική φωτοφωσφορυλίωση οξειδωτική φωσφορυλίωση Να απαντήσετε σύντοµα σε καθεµία από τις παρακάτω ερωτήσεις (10-20 λέξεις): 1. Γιατί το ΑΤΡ θεωρείται ως το ενεργειακό «νόµισµα» του κυττάρου; 2. Γιατί οι καταβολικές αντιδράσεις θεωρούνται εξώθερµες; 3. Γιατί οι αναβολικές αντιδράσεις θεωρούνται ενδόθερµες; 4. Ποια διαδικασία εξυπηρετεί η σύζευξη των εξώθερµων και ενδόθερµων αντιδράσεων; 5. Σε τι εξυπηρετεί το κύτταρο το γεγονός ότι οι δεσµοί υψηλής ενέργειας του ΑΤΡ, είναι ασταθείς; 44

21 6. Πώς καθορίζεται η καταλυτική δράση των ενζύµων; 7. Γιατί τα ένζυµα παραµένουν αναλλοίωτα στο τέλος µιας αντίδρασης; 8. Πώς επηρεάζει την ενζυµική ταχύτητα η αύξηση του υποστρώµατος; 9. Πώς δρούν οι αντιστρεπτοί αναστολείς των ενζύµων; 10. Τι σηµαίνει όρος «αναδραστική αναστολή ενός ενζύµου»; 11. Τι είναι ενέργεια ενεργοποίησης; 12. Τι είναι ενεργό κέντρο ενζύµου; 13. Ποιες ουσίες ονοµάζουµε αναστολείς; 14. Ποιοι είναι οι παράγοντες που επηρεάζουν τη δράση των ενζύµων; 15. Ποιοι είναι οι συµπαράγοντες των ενζύµων; 16. Με ποιο τρόπο τα φυτά προσλαµβάνουν διοξείδιο του άνθρακα; 17. Πώς χρησιµοποιούν τα φυτά τις ουσίες που προσλαµβάνουν από το έδαφος; 18. Πώς τρέφεται το φυτό; 19. Πώς χρησιµοποιείται το οξυγόνο που παράγεται κατά τη φωτοσύνθεση; 20. Σε τι εξυπηρετεί η διαδικασία της διαπνοής; 21. Ποια ακτινοβολία του ορατού φωτός απορροφάται από τις χλωροφύλλες και ποια από τα καροτινοειδή; 22. Με ποιο τρόπο µπορούµε να υπολογίσουµε την ταχύτητα της φωτοσύνθεσης; 23. Να αναφερθούν ονοµαστικά οι παράγοντες που επηρεάζουν τη φωτοσύνθεση. 24. Ποιοι παράγοντες επηρεάζουν τη φωτοσύνθεση; Πώς το νερό επηρεάζει τη φωτοσυνθετική δραστηριότητα; 25. Ποιο µήκος κύµατος του ορατού φωτός, είναι το καταλληλότερο για τη πραγµατοποίηση της φωτοσύνθεσης; Να απαντήσετε στις παρακάτω ερωτήσεις µε µία παράγραφο (20-40 λέξεις): 1. Να εξηγήσετε γιατί η ενέργεια είναι σηµαντική για τους οργανισµούς. 2. Τι συµβαίνει στους χλωροπλάστες µετά τη δέσµευση της ενέργειας; 3. Να περιγράψετε συνοπτικά πώς η ενέργεια αποθηκεύεται στο µόριο του ΑΤΡ και πώς απελευθερώνεται. 4. Με ποιο τρόπο η ενέργεια ενεργοποίησης «προετοιµάζει» τα διάφορα µόρια για να αντιδράσουν µεταξύ τους; 45

22 5. Να περιγράψετε τη δράση των ενζύµων. 6. Όταν διασπάται το ΑΤΡ παράγεται ΑDP. Περιέχει ενέργεια το ΑDP; Να εξηγήσετε την απάντησή σας. 7. Γιατί ένα ένζυµο δεν µπορεί να συµµετέχει σε διαφορετικές χηµικές αντιδράσεις; 8. Γιατί απαιτείται µικρότερη ενέργεια για τη διεξαγωγή µιας χηµικής αντίδρασης, όταν συµµετέχει ένα ένζυµο; 9. Γιατί οι φωτοσυνθετικοί οργανισµοί, σε ένα οικοσύστηµα, ονοµάζονται παραγωγοί; 10. Πώς χρησιµοποιείται το φως κατά τη φωτοσύνθεση; 11. Τι είναι φωτοσύστηµα; Να περιγράψετε το ρόλο του φωτοσυστήµατος Ι. 12. Ποια είναι τα προϊόντα της φωτεινής φάσης της φωτοσύνθεσης; 13. Με ποιο τρόπο δεσµεύεται η ηλιακή ενέργεια κατά τη διάρκεια της φωτοσύνθεσης, και πώς αποθηκεύεται µε τη µορφή µορίων ΑΤΡ και NADPH; Πώς χρησιµοποιείται το ΑΤΡ και NADPH για τη µετατροπή του διοξειδίου του άνθρακα σε σάκχαρα; Πού χρησιµεύουν τα σάκχαρα τα οποία συντίθενται κατά τη διάρκεια της φωτοσύνθεσης; 14. Σε τι εξυπηρετούν τους οργανισµούς οι παρακάτω διαδικασίες; α. Αναπνοή. β. Γλυκόλυση. γ. Κύκλος του Κρεµπς (Κrebs). δ. Οξειδωτική φωσφορυλίωση. 15. Η ταχύτητα της φωτοσύνθεσης σε ένα φυτό επηρεάζει την ανάπτυξη του; Να εξηγήσετε την απάντησή σας. 16. Γιατί η θερµοκρασία επηρεάζει την ταχύτητα της φωτοσύνθεσης; 17. Ποιους οργανισµούς χαρακτηρίζουµε ως ετερότροφους; 18. Ποια είναι η «τύχη» του οξυγόνου που παράγεται κατά τη φωτοσύνθεση; 19. Πώς σχετίζονται ο αναβολισµός και ο καταβολισµός; Σε ποια βασικά σηµεία µοιάζουν και σε ποια διαφέρουν; 20. Οι οργανισµοί αποβάλλουν ενέργεια στο περιβάλλον, κατά τη διάρκεια του µεταβολισµού τους. Εάν δεν υπήρχε αυτή η απώλεια ενέργειας, θα είχαν 46

23 πάλι οι οργανισµοί την ανάγκη να προµηθευτούν ενέργεια για να επιζήσουν; Να εξηγήσετε την απάντησή σας. 21. Να συγκρίνετε τα ένζυµα µε τους ανόργανους καταλύτες και να γράψετε µια οµοιότητα και µια διαφορά. 22. Να αναφέρετε περιληπτικά όλες τις ιδιότητες των ενζύµων. 23. Να αναφέρετε περιληπτικά µε ποιο τρόπο δρουν οι αναστολείς των ενζύµων. 24. Να εξηγήσετε µε ποιο τρόπο επηρεάζεται η ενζυµική δραστηριότητα: α) από τη θερµοκρασία β) από τη συγκέντρωση του ενζύµου γ) από τη συγκέντρωση του υποστρώµατος. 25. Γιατί τα φυτά δε φωτοσυνθέτουν όταν αυξηθεί η θερµοκρασία; 26. Υπάρχουν οργανισµοί που φωτοσυνθέτουν σε υψηλές θερµοκρασίες; 27. Ποιος είναι ο ρόλος των φωτοσυστηµάτων στη διαδικασία της φωτοσύνθεσης; 28. Ποια σχέση υπάρχει µεταξύ αναπνοής και φωτοσύνθεσης στα φυτά; Τι επίδραση έχει αυτή η σχέση στα ζώα; 29. Να συγκρίνετε: α) τη γλυκόλυση µε τον κύκλο του Κρεµπς (Κrebs) β) τον κύκλο του Κρεµπς (Κrebs) µε την οξειδωτική φωσφορυλίωση. 30. Να περιγράψετε τη σχέση µεταξύ της λειτουργίας της αναπνοής (πρόσληψη οξυγόνου-αποβολή διοξειδίου του άνθρακα από τον οργανισµό) και της κυτταρικής αναπνοής. 31. Το φθινόπωρο τα φυτά µε πράσινα φύλλα σταµατούν να παράγουν χλωροφύλλη. Πώς σχετίζεται το γεγονός αυτό µε την αλλαγή του χρώµατος των φύλλων αυτή την εποχή; 32. Να περιγράψετε το ρόλο των µεµβρανών στην κυτταρική αναπνοή. 33. Να περιγράψετε µε ποιο τρόπο τα φυτά δεσµεύουν την ηλιακή ενέργεια και την αποθηκεύουν κατά τη φωτεινή φάση της φωτοσύνθεσης. 34. Να εξηγήσετε µε ποιο τρόπο τα προϊόντα της φωτεινής φάσης της φωτοσύνθεσης επηρεάζουν έµµεσα ή άµεσα τη ζωή των ζώων. 47

24 Γ. ΠΡΟΒΛΗΜΑΤΑ ΕΡΓΑΣΙΕΣ 1. Στον κήπο σας έχετε κόκκινες, µπλε και άσπρες πετούνιες. Αξιοποιώντας τις γνώσεις σας σχετικά µε τη φωτοσύνθεση, να εξηγήσετε ποια ακτινοβολία του ορατού φωτός απορροφούν αυτά τα λουλούδια. 2. Ένα µόριο γλυκόζης εγκλείει περίπου 686 kcal. Ένα µόριο γλυκόζης παράγει 36 µόρια ΑΤΡ στα ευκαρυωτικά κύτταρα. Κάθε µόριο ΑΤΡ περιέχει περίπου 7,3 kcal. α) Να υπολογίσετε την ενέργεια που παράγεται κατά την αερόβια διάσπαση της γλυκόζης και να τη συγκρίνετε µε αυτήν του µορίου της γλυκόζης. β) Να αναφέρετε πώς χρησιµοποιείται η υπόλοιπη ενέργεια. 3. Το δηµοτικό συµβούλιο της Ρώµης ζήτησε από τους κατοίκους της πόλης να φυτέψουν πράσινα φυτά στις ταράτσες και στα µπαλκόνια για τη µείωση της ρύπανσης. Αξιοποιώντας τις γνώσεις σας, σχετικά µε τη φωτοσύνθεση, να προσπαθήσετε να ερµηνεύσετε την πρόταση αυτή. 4. Τα ένζυµα είναι οι οργανικοί καταλύτες και µειώνουν τη ενέργεια ενεργοποίησης των µεταβολικών αντιδράσεων. Συµµετέχουν λειτουργικά σε ενδοκυτταρικό και εξωκυτταρικό επίπεδο. Σε µερικές περιπτώσεις λειτουργούν µόνο µε την παρουσία ουσιών, που ονοµάζονται συνένζυµα. Η δράση τους περιορίζεται σε συγκεκριµένα φυσιολογικά όρια, τα οποία όταν παραβιαστούν µετουσιώνονται. A. Να εξηγήσετε τι σηµαίνει ο καθένας από τους παρακάτω όρους: α) εξειδικευµένοι καταλύτες β) ενέργεια ενεργοποίησης γ) φυσιολογικά όρια δράσης. B. Να περιγράψετε πλήρως τη διαδικασία της µετουσίωσης, εξηγώντας τον λόγο για τον οποίο αυτή επηρεάζει τη δραστικότητα του ενζύµου. Γ. Να εξηγήσετε τι σηµαίνει ο όρος συνένζυµο. ώστε ένα παράδειγµα από τη δράση ενός συνενζύµου.. Να ονοµάσετε δύο ενδοκυτταρικά ένζυµα, αναφέροντας ποιες αντιδράσεις επιτελούν. 48

25 5. α) Τι εννοούµε µε τον όρο ένζυµο; β) Η γραφική παράσταση που ακολουθεί, παρουσιάζει την δράση της συγκέντρωσης του υποστρώµατος στην εξέλιξη µιας ενζυµικής αντίδρασης. Συγκέντρωση του υποστρώµατος Να εξηγήσετε τα τρία µέρη της καµπύλης που δείχνουν τα τόξα. γ) Οι ενζυµικές αντιδράσεις έχουν συχνά ένα συντελεστή θερµοκρασίας, που κυµαίνεται από 0 έως 40 βαθµούς Κελσίου. Τι σηµαίνει ακριβώς αυτό; δ) Σε υψηλότερες θερµοκρασίες τα ένζυµα µετουσιώνονται: i) πώς συµβαίνει αυτό; ii) πώς επηρεάζει την ενζυµική δράση η µετουσίωση; ε) Να ονοµάσετε δύο άλλους παράγοντες, εκτός από τη συγκέντρωση του υποστρώµατος και τη θερµοκρασία, που επηρεάζουν την ενζυµική δραστικότητα. ζ) Να αναφέρετε ένα παράδειγµα ενός ενζύµου, που δρα ενδοκυτταρικά και να περιγράψετε τη λειτουργία του. η) Να αναφέρετε ένα παράδειγµα ενός ενζύµου, το οποίο δρα εξωκυτταρικά και να περιγράψετε τη λειτουργία του. θ) Να ξεχωρίσετε σε τι διαφέρουν οι αναβολικές από τις καταβολικές αντιδράσεις. ι) Να παρουσιάσετε περιληπτικά τον τρόπο µε τον οποίο συνδέονται οι αναβολικές µε τις καταβολικές αντιδράσεις στο κύτταρο. 49

26 Να συµπληρώσετε µε τις κατάλληλες έννοιες τα κενά του εννοιολογικού χάρτη που ακολουθεί: ΕΝΕΡΓΕΙΑ που απελευθερώνεται που δεσµεύεται Γλυκόλυση ; παρουσία Ο 2 ; ; Ζύµωση Στάδιο φωτεινών αντιδράσεων Κύκλος του Krebs ; H 2 O O 2 ATP ; 50

27 . ΠΑΡΑ ΕΙΓΜΑΤΑ ΚΡΙΤΗΡΙΩΝ ΑΞΙΟΛΟΓΗΣΗΣ Παράδειγµα ωριαίου κριτηρίου αξιολόγησης Αντικείµενο εξέτασης: Μεταβολισµός Στόχοι που ελέγχονται: Ανάκληση γνώσεων, κατανόηση, κριτική σκέψη ΣΤΟΙΧΕΙΑ ΜΑΘΗΤΗ Επώνυµο:.. Όνοµα:... Τάξη:. Τµήµα: Μάθηµα:.... Ηµεροµηνία:. ΕΡΩΤΗΣΕΙΣ 1. Α. Να βάλετε σε κύκλο το γράµµα που αντιστοιχεί στη σωστή απάντηση ή στη φράση που συµπληρώνει σωστά την πρόταση: Από τους τρεις φωσφορικούς δεσµούς του ΑΤΡ υψηλού ενεργειακού περιεχοµένου είναι α. και οι τρεις β. µόνο ο τελευταίος γ. µόνο ο δεύτερος και ο τρίτος δ. µόνο ο πρώτος και ο τρίτος. Η σκοτεινή φάση της φωτοσύνθεσης διεξάγεται α. στα ριβοσώµατα β. στα θυλακοειδή γ. στα µιτοχόνδρια δ. στο στρώµα. Η σχάση ενός ενζύµου στο υπόστρωµά του έχει ως αποτέλεσµα α. την ισχυροποίηση των δεσµών του υποστρώµατος β. την εξασθένιση των δεσµών του υποστρώµατος γ. την αδρανοποίηση των δεσµών του υποστρώµατος δ. τη χαλάρωση και το σπάσιµο των δεσµών του ενζύµου. Μονάδες 3 51

28 1. Β. Να χαρακτηρίσετε µε Σ (σωστό) ή µε Λ (λάθος) τις παρακάτω προτάσεις: Η καταλυτική δράση των ενζύµων καθορίζεται από την τριτοταγή δοµή τους. ( ) Με τη διαδικασία της φωτοσύνθεσης παράγεται διοξείδιο του άνθρακα στα φυτικά κύτταρα και πρωτεΐνες στα ζωικά. ( ) Μονάδες 2 2. Να συµπληρώσετε µε τους κατάλληλους όρους τα κενά στις παρακάτω προτάσεις: Ως ενεργειακό νόµισµα στο κύτταρο χαρακτηρίζεται το µόριο.... Η διαδικασία σύνθεσης πολύπλοκων χηµικών ουσιών από απλούστερες ονοµάζεται.... Οι αναστολείς της δράσης των ενζύµων διακρίνονται σε... και.... Οι αντιδράσεις της οξειδωτικής φωσφορολίωσης γίνονται στις µεµβράνες των.... Κατά την γλυκόλυση ένα µόριο γλυκόζης διασπάται σε δύο µόρια Μονάδες 5 3. Να απαντήσετε σύντοµα στις παρακάτω ερωτήσεις: Ποιοι παράγοντες επηρεάζουν τη δράση των ενζύµων; Ποιος είναι ο ρόλος των συνενζύµων; Μονάδες 5 4. Να απαντήσετε στις παρακάτω ερωτήσεις µε µια παράγραφο: Ένα ένζυµο δρα σε θερµοκρασίες γύρω στους 36 C. Γιατί η δράση του ενζύµου σταµατάει όταν η θερµοκρασία αυξηθεί υπερβολικά; Όταν η θερµοκρασία επανέλθει στους 36 C επανέρχεται και η δραστικότητα του ενζύµου ή όχι και γιατί; Μονάδες 5 52

29 ΚΕΦΑΛΑΙΟ 4 Γενετική Α. ΕΡΩΤΗΣΕΙΣ ΚΛΕΙΣΤΟΥ ΤΥΠΟΥ Να βάλετε σε κύκλο το γράµµα που αντιστοιχεί στη σωστή απάντηση ή στη φράση που συµπληρώνει σωστά την πρόταση: 1. Κατά τη διαδικασία που ονοµάζεται µεταγραφή παράγεται α. µία πολυπεπτιδική αλυσίδα β. ένα µεταφορικό RNA γ. ένα αγγελιοφόρο RNA δ. ένα ριβοσωµικό RNA. 2. Η διαδικασία της µετάφρασης διεξάγεται α. στον πυρήνα β. στο σύµπλεγµα Golgi γ. στα ριβοσώµατα δ. στα µιτοχόνδρια. 3. Το RNA αποτελεί το γενετικό υλικό για α. την Αµοιβάδα β. τα Βακτήρια γ. τους Μύκητες δ. τους Ρετροϊούς. 53

30 4. Η γενετική πληροφορία είναι αποθηκευµένη α. στον πυρήνα β. στο κυτταρόπλασµα γ. στα ριβοσώµατα δ. στο αδρό ενδοπλασµατικό δίκτυο. 5. Το αντικωδικόνιο αποτελεί τµήµα α. της πολυπεπτιδικής αλυσίδας β. του DNA γ. του αγγελιοφόρου RNA δ. του µεταφορικού RNA. 6. Οι γενετικές πληροφορίες είναι αποθηκευµένες α. στο µόριο του DNA β. στο µόριο του trna γ. στο µόριο του mrna δ. στις πολυπεπτιδικές αλυσίδες. 7. Η χρωµατίνη ενός ευκαρυωτικού κυττάρου αποτελείται από α. DNA, υδατάνθρακες και RNA β. RNA, λιπίδια και πρωτεΐνες γ. DNA και πρωτεΐνες δ. DNA, πρωτεΐνες και µικρή ποσότητα RNA. 8. Το συνολικό µήκος του DNA, που περιέχεται στο ευκαρυωτικό κύτταρο, είναι εξαιρετικά µεγάλο σε σχέση µε τις διαστάσεις του. Η ολοκλήρωση της αντιγραφής του, σε σχετικά σύντοµο χρονικό διάστηµα, οφείλεται στο γεγονός ότι α. η διπλή έλικα του DNA «ανοίγει» ταυτόχρονα σε πολλά σηµεία β. η αντιγραφή πραγµατοποιείται ταυτόχρονα και προς τις δύο κατευθύνσεις γ. όλες οι αντιδράσεις πραγµατοποιούνται µε τη βοήθεια ενζύµων δ. ισχύουν όλα τα παραπάνω. 54

31 9. Η σύνθεση του RNA γίνεται πάνω σε «καλούπι» DNA και περιλαµβάνει α. µεταγραφή και των δύο αλυσίδων του DNA β. µεταγραφή µόνο της µιας ή της άλλης αλυσίδας της διπλής έλικας γ. µεταγραφή τυχαίων τµηµάτων της µιας και της άλλης αλυσίδας δ. µεταγραφή µόνο συγκεκριµένων τµηµάτων της µιας αλυσίδας. 10. Ο γενετικός κώδικας είναι συνεχής. Αυτό σηµαίνει ότι α. ο κώδικας χρησιµοποιείται από τους οργανισµούς κατά τη διάρκεια της εξέλιξης συνεχώς β. κατά την ανάγνωση των τριπλετών των βάσεων του DNA ενός γονιδίου καµιά βάση δεν παραλείπεται γ. η µετάφραση του κωδικοποιηµένου µηνύµατος γίνεται αδιάκοπα σε όλη τη διάρκεια του κύκλου ζωής του κυττάρου δ. µεταξύ του τέλους ενός γονιδίου και της αρχής του επόµενου δε µεσολαβεί καµία περιοχή που να µη µεταγράφεται. 11. Ποια είναι τα ζεύγη των συµπληρωµατικών βάσεων του DNA; α. A-G.. T-G β. A-C.. T-G γ. A-U.. C-G δ. A-T.. G-C. 12. Το DNA ενός είδους διαφέρει από αυτό των άλλων ειδών α. στα σάκχαρα β. στις φωσφορικές οµάδες γ. στην αλληλουχία των αζωτούχων οργανικών βάσεων δ. σε όλα τα παραπάνω. 13. Ένα αγγελιοφόρο RNA παράγεται α. κατά τη διαδικασία της αντιγραφής β. µε τον αυτοδιπλασιασµό του DNA γ. κατά τη διαδικασία της µεταγραφής δ. κατά τη διαδικασία της µετάφρασης. 55

32 14. Τα αντικωδικόνια συνδέονται α. µε τα κωδικόνια του αγγελιοφόρου RNA β. µε τα αντικωδικόνια του DNA γ. µε τα αντικωδικόνια των ριβοσωµάτων δ. µε τα αµινοξέα. 15. Η γενετική πληροφορία, που βρίσκεται κωδικοποιηµένη σε δύο οµόλογα χρωµοσώµατα, α. είναι εντελώς πανοµοιότυπη, αφού αυτά προέρχονται από το διπλασιασµό του DNA β. είναι εντελώς διαφορετική, αφού το ένα έχει µητρική και το άλλο πατρική προέλευση γ. αν και ελέγχει τις ίδιες ιδιότητες, δεν τις ελέγχει αναγκαστικά µε τρόπο πανοµοιότυπο δ. δεν ελέγχει αναγκαστικά τις ίδιες ιδιότητες, αφού αυτό δε θα πρόσφερε κανένα πλεονέκτηµα. 16. Ποιο από τα παρακάτω δεν αποτελεί τµήµα ενός χρωµοσώµατος κατά την πρόφαση; α. Το κεντροµερίδιο. β. Το κεντροσωµάτιο. γ. Η χρωµατίδα. δ. Το DNA. 17. Τα σωµατικά κύτταρα του ανθρώπου έχουν 46 χρωµοσώµατα. Κατά το στάδιο της ανάφασης στη µίτωση, ένα κύτταρο θα έχει α. 92 χρωµοσώµατα β. 46 χρωµοσώµατα γ. 23 χρωµοσώµατα δ. 44 χρωµοσώµατα. 56

33 18. Τα άωρα γεννητικά κύτταρα παράγονται µε α. χιασµατυπία β. µίτωση γ. µείωση δ. γονιµοποίηση. 19. Στα κύτταρα, που προκύπτουν από τη µείωση Ι, α. όλα τα χρωµοσώµατα αντιπροσωπεύονται δύο φορές και αποτελούνται από δύο αδελφές χρωµατίδες β. τα µισά µόνο χρωµοσώµατα αντιπροσωπεύονται δύο φορές και αποτελούνται από δύο αδελφές χρωµατίδες γ. όλα τα χρωµοσώµατα αντιπροσωπεύονται µία φορά και αποτελούνται από δύο αδελφές χρωµατίδες δ. όλα τα χρωµοσώµατα αντιπροσωπεύονται µία φορά και αποτελούνται από ένα νήµα χρωµατίνης. Να συµπληρώσετε µε τους κατάλληλους όρους τα κενά στις παρακάτω προτάσεις: 1. Ο κυτταρικός κύκλος χωρίζεται σε δύο φάσεις.. και Οι ιοί διαθέτουν ως γενετικό υλικό.. ή Για το διπλασιασµό του DNA απαιτείται σπάσιµο των δεσµών.. µεταξύ των συµπληρωµατικών βάσεων. 4. Ο αυτοδιπλασιασµός του DNA, χαρακτηρίζεται ως Οι πρωτεΐνες συντίθενται στα.., που εντοπίζονται στο Η διαδικασία µε την οποία παράγεται το mrna ονοµάζεται Το κωδικόνιο αποτελείται από

34 8. Τα µονοµερή, που χρησιµοποιούνται για τη σύνθεση της πρωτεΐνης, ονοµάζονται Για τη σύνθεση της πρωτεΐνης χρησιµοποιείται ως εκµαγείο το µόριο Ένα µόριο.. συνοδεύει το κάθε αµινοξύ κατά τη σύνθεση µιας πρωτεΐνης. 11. Η χρωµατίνη είναι µια.., που αποτελείται από DNA, RNA και από πρωτεϊνες. 12. Τα κύτταρα, που έχουν τα χρωµοσώµατά τους σε ζευγάρια, χαρακτηρίζονται ως Κατά τη διάρκεια της.... το κυτταρόπλασµα του µητρικού κυττάρου διαιρείται εµφανίζονται κατά τη διάρκεια της πρόφασης του ζωικού κυττάρου και καταλαµβάνουν τους δύο πόλους του. 15. Η ανταλλαγή τµηµάτων µεταξύ µη αδελφών χρωµατίδων οµολόγων χρωµοσωµάτων, που συµβαίνει κατά τη διάρκεια της µείωσης, λέγεται Η µείωση γίνεται σε µια ειδική κατηγορία διπλοειδών κυττάρων, που χαρακτηρίζονται ως.... κύτταρα. 17. Το φαινόµενο της σύναψης πραγµατοποιείται κατά.. της 1ης µειωτικής διαίρεσης. 18. Στους περισσότερους ευκαρυωτικούς οργανισµούς τα χρωµοσώµατα είναι ένας συνδυασµός από 60%.. και 40%.. περίπου. Το γενετικό υλικό των βακτηρίων είναι 100%... 58

35 Β. ΕΡΩΤΗΣΕΙΣ ΑΝΟΙΚΤΟΥ ΤΥΠΟΥ Να απαντήσετε σύντοµα σε καθεµία από τις παρακάτω ερωτήσεις (10-20 λέξεις): 1. Τι είναι ο κύκλος ζωής του κυττάρου; 2. Τι είναι η µεσόφαση; 3. Τι είναι οι αδελφές χρωµατίδες; 4. Ποιος είναι ο ρόλος του κεντροσωµατίου κατά τη διαίρεση των ζωϊκών κυττάρων; 5. Τι είναι η κυτοκίνηση; 6. Τι εξασφαλίζεται µε τη µίτωση; 7. Τι είναι ο φραγµοπλάστης; 8. Τι είναι το κωδικόνιο; 9. Τι είναι το αντικωδικόνιο; 10. Τι σηµαίνει ο όρος δίχτυ χρωµατίνης; 11. Πού είναι καταγραµµένες οι γενετικές πληροφορίες; 12. Με ποιο τρόπο συνθέτουν το DNA οι ιοί που περιέχουν RNA; 13. Τι σηµαίνει ακριβώς ο όρος αντιγραφή του DNA; 14. Ποιο είναι το πρώτο διαδικαστικό βήµα για την αντιγραφή του DNA; 15. Με ποιο ένζυµο γίνεται η αντιγραφή του DNA; 16. Πώς εξασφαλίζεται η πιστότητα της αντιγραφής του DNA; 17. Ποιο βιολογικό µόριο µεταφέρει τη γενετική πληροφορία στο κυτταρόπλασµα; 18. Ποια είναι τα στάδια της µετάφρασης; 19. Τι σηµαίνει ο όρος κωδικόνιο έναρξης; 20. Με ποιο µηχανισµό σταµατά η σύνθεση µιας πρωτεΐνης; 21. Με ποιο µηχανισµό το κύτταρο παράγει πολλά αντίγραφα του ίδιου πρωτεϊνικού µορίου σε µικρό χρονικό διάστηµα; 22. Σε ποια οργανίδια του κυττάρου γίνεται η σύνθεση πρωτεϊνών; 23. Ποιο είναι το κεντρικό δόγµα της Βιολογίας; 24. Γιατί ο αυτοδιπλασιασµός του DNA χαρακτηρίζεται ως ηµισυντηρητικός; 25. Τι είναι γενετικός κώδικας; 59

36 26. Τι σηµαίνει ο όρος εκφυλισµένος γενετικός κώδικας; 27. Ισχύει ο ισχυρισµός ότι ο γενετικός κώδικας είναι παγκόσµιος; 28. Τι είναι µεταγραφή του DNA; 29. Με πόσες µορφές παρουσιάζεται το DNA στους διάφορους οργανισµούς; 30. Ποιο βιολογικό µόριο κατευθύνει τη σύνδεση ενός αµινοξέος µε ένα άλλο αµινοξύ; 31. Να αναφέρετε πόσα στάδια υπάρχουν στη διαδροµή της γενετικής πληροφορίας, από το DNA µέχρι τις πρωτεϊνες. 32. Ένα κοµµάτι DNA περιέχει 4 ζεύγη βάσεων. Πόσες αλληλουχίες αµινοξέων µπορεί να κωδικοποιεί αυτό το τµήµα; 33. Να γράψετε τρεις διαφορές µεταξύ DNA και RNA. 34. Με ποιο µηχανισµό, διορθώνονται τα λάθη που συµβαίνουν κατά την αντιγραφή του DNA; 35. Ποια κύτταρα του ανθρώπινου οργανισµού είναι διπλοειδή; Ποια είναι απλοειδή; 36. Στο παρακάτω σχεδιαγράµµα να συµπληρώσετε τις ονοµασίες των βιολογικών µηχανισµών, που δείχνουν τα κάθετα βέλη: DNA RNA Πρωτεΐνη 60

37 Να απαντήσετε στις παρακάτω ερωτήσεις µε µια παράγραφο (20-40 λέξεις): 1. Ποιος είναι ο ρόλος της DNA-πολυµεράσης III στην αντιγραφή του DNA; 2. Ποιο χαρακτηριστικό στη δοµή του DNA αποτελεί τον παράγοντα-κλειδί για την ικανότητα του να αντιγράφεται; 3. Γιατί είναι απαραίτητο ένα µόριο-µήνυµα, όπως είναι το m-rna, για τη σύνθεση των πρωτεϊνών; 4. Ποιες δραστηριότητες παρατηρούνται κατά τη διάρκεια της µεταγραφής του m-rna; 5. Ποιος είναι ο ρόλος του κωδικονίου και του αντικωδικονίου κατά τη µετάφραση; 6. Ποιος είναι ο ρόλος του t-rna; 7. Η µεταγραφή και η µετάφραση των προκαρυωτικών κυττάρων διεξάγονται στο κυτταρόπλασµα. Να αναφέρετε πού διεξάγονται αυτές οι δύο διαδικασίες στο ευκαρυωτικό κύτταρο. 8. Να αναφέρετε τα στάδια της µετάφρασης. 9. Να συγκρίνετε και να γράψετε τις διαφορετικές λειτουργίες του m-rna, του t-rna και του r-rna. 10. Να συγκρίνετε τις διαδικασίες της µεταγραφής και της µετάφρασης της γενετικής πληροφορίας. 11. Να περιγράψτε τα βασικά βήµατα της πρωτεϊνοσύνθεσης στο ριβόσωµα. 12. Να αναφέρετε σε ποια συµπεράσµατα κατέληξαν οι δύο ερευνητές Γουάτσον και Κρίκ, οι οποίοι διερευνούσαν τη δοµή του γενετικού υλικού. 13. Να εξηγήσετε µε ποιο τρόπο το µόριο του DNA προσφέρει σταθερότητα και ταυτόχρονα ποικιλοµορφία σε ένα οργανισµό. 14. Να δώσετε τον ορισµό της µετάλλαξης. Οι µεταλλάξεις είναι όλες αυθόρ- µητες; Να εξηγήσετε την απάντησή σας. 15. Να γράψετε τρεις σκοπούς που εξυπηρετεί η διαδικασία της µίτωσης. 16. Να περιγράψετε την οργάνωση των χρωµοσωµάτων κατά τη διάρκεια της µίτωσης. 17. Να περιγράψετε τρία φαινόµενα, που παρατηρούνται κατά τη διάρκεια της πρόφασης, 61

38 18. Πώς γίνεται η αποµάκρυνση των αδελφών χρωµατίδων από το ισηµερινό επίπεδο του κυττάρου; 19. Να εξηγήσετε τα φαινόµενα της σύναψης και της χιασµατυπίας. 20. Σε τι διαφέρει η κυτταροπλασµατική διαίρεση στα ζώα από τα φυτά; 21. Πώς διαιρούνται τα κύτταρα των βακτηρίων; 22. Να συκρίνετε την πρόφαση της µίτωσης και την πρόφαση Ι της 1ης µειωτικής διαίρεσης και να γράψετε τις βασικές διαφορές τους. 23. Να εξηγήσετε γιατί χρειάζονται δύο διαιρέσεις, προκειµένου να ολοκληρωθεί η µείωση. 24. Να συγκρίνετε την πρόφαση µε την τελόφαση. 25. Να συγκρίνετε το σχηµατισµό γαµετών στα ζώα και στα φυτά. 26. Ποια είναι η καλύτερη φάση για να παρατηρήσουµε τα χρωµοσώµατα ενός συγκεκριµένου οργανισµού; Να εξηγήσετε την απάντησή σας. 27. Εάν ένα σωµατικό κύτταρο έχει 23 ζευγάρια χρωµοσωµάτων, πόσα χρωµοσώµατα θα παρατηρήσετε κατά τη διάρκεια της φάσης G 2 ; Πόσες χρωµατίδες; Να εξηγήσετε την απάντησή σας. 28. Να γράψετε και να σχολιάσετε τις βασικές διαφορές µεταξύ χρωµατίνης, χρωµατίδων και χρωµοσωµάτων. 29. Ποια είναι η σηµασία του φαινοµένου της σύναψης για τη χιασµατυπία; 30. Να συγκρίνετε τη διαδικασία της µίτωσης και της µείωσης Ι. 62

39 Γ. ΠΡΟΒΛΗΜΑΤΑ ΕΡΓΑΣΙΕΣ 1. Να γράψετε ένα µόριο m-rna, το οποίο να είναι συµπληρωµατικό για την παρακάτω σειρά νουκλεοτιδίων του DNA: ATT, ACG, CGG, TCA, GTA. 2. Ένα τµήµα ενός κλώνου του DNA περιέχει την εξής αλληλουχία βάσεων: AACCGAT. Να γράψετε τη δίκλωνη µορφή του µορίου. 3. Η ινσουλίνη είναι µια ορµόνη πρωτεϊνικής φύσης, που εκκρίνεται από τα κύτταρα του παγκρέατος και συµµετέχει στη ρύθµιση του σακχάρου του αίµατος. Το µόριο της ινσουλίνης αποτελείται από δύο πολυπεπτιδικές αλυσίδες την Α και τη Β. Η Α περιέχει 21 αµινοξέα και η Β 30. Οι δύο αλυσίδες συνδέονται µε δισουλφιδικούς δεσµούς. Το παρακάτω σχήµα παρουσιάζει µια αλληλουχία νουκλεοτιδίων του αγγελιοφόρου RNA, το οποίο συµµετέχει στη σύνδεση των τελευταίων 8 αµινοξέων της Β αλυσίδας. GUGGAGAGCGUGGCUUCUACACUCCUAAGACU mrna α) Χρησιµοποιώντας τον πίνακα του γενετικού κώδικα να γράψετε την αλληλουχία των αµινοξέων της Β αλυσίδας. β) Να γράψετε την αλληλουχία των νουκλεοτιδίων του αντίστοιχου γονιδίου και να αιτιολογήσετε την απάντησή σας. 4. Η καζεϊνη, είναι µία πρωτεϊνη του γάλακτος. Όπως όλες οι πρωτεϊνες, αποτελείται από µία ειδική αλληλουχία αµινοξέων, που κωδικοποιούνται από ένα γονίδιο. Οι επιστήµονες κατάφεραν, σε ορισµένα θηλαστικά, να αποµονώσουν το υπεύθυνο γονίδιο και να αποκρυπτογραφήσουν την αλληλουχία του. Ο παρακάτω πίνακας παρουσιάζει ένα µέρος από την αλληλουχία των βάσεων του ενός κλώνου του DNA, που κωδικοποιεί αυτή την πρωτεϊνη του προβάτου και της αγελάδας: Πρόβατο GCC CTT GTT CTT CTC AAC TTA CAA αγελάδα TCC CTC AAT CTT CTT AAT TTG GGA α) Ποια θα είναι η αλληλουχία του άλλου κλώνου, των δύο οργανισµών; β) Ποια είναι η αλληλουχία του αγγελιοφόρου mrna των δύο οργανισµών; 63

40 5. ίνονται οι αλληλουχίες από τα τµήµατα ενός µορίου του DNA και ενός µορίου RNA: DNA TATGTTGG ATACTACC RNA UAUGAUGG Να παρατηρήσετε προσεχτικά τα δύο µόρια και να εξηγήσετε εάν υπάρχει κάποια σχέση µεταξύ τους. 6. Η κολχικίνη είναι µια χηµική ουσία, η οποία όταν επιδράσει στο κύτταρο, καταστρέφει την κυτταρική άτρακτο. Εάν σε µια καλλιέργεια κυττάρων επιδράσει η κολχικίνη: α) Σε ποια φάση του κυτταρικού κύκλου θα βρεθούν τα κύτταρα µετά από ένα αρκετό χρονικό διάστηµα; Να εξηγήσετε την απάντησή σας. β) Η παραπάνω διαδικασία σε τι µας εξυπηρετεί (βοηθά) κατά τη µελέτη του γενετικού υλικoύ του κυττάρου; Να συµπληρώσετε τα κενά του εννοιολογικού χάρτη που ακολουθεί µε τους παρακάτω όρους: RNA, αµινοξέα, DNA, αντικωδικώνια. µεταγράφεται ; ; περιέχει το Γενετικό Κώδικα r-rna κωδικοποιείται σε m-rna µπορεί να σχηµατίζει πρωτεΐνες που αποτελούνται t-rna µεταφέρει ; ; 64

41 . ΠΑΡΑ ΕΙΓΜΑΤΑ ΚΡΙΤΗΡΙΩΝ ΑΞΙΟΛΟΓΗΣΗΣ Παράδειγµα ωριαίου κριτηρίου αξιολόγησης Αντικείµενο εξέτασης: Γενετική Στόχοι που ελέγχονται: Ανάκληση γνώσεων, κατανόηση, κριτική σκέψη ΣΤΟΙΧΕΙΑ ΜΑΘΗΤΗ Επώνυµο:.. Όνοµα:... Τάξη:. Τµήµα: Μάθηµα:.... Ηµεροµηνία:. ΕΡΩΤΗΣΕΙΣ 1. Α. Να βάλετε σε κύκλο το γράµµα που αντιστοιχεί στη σωστή απάντηση ή στη φράση που συµπληρώνει σωστά την πρόταση: Οι γαµέτες περιέχουν ένα χρωµόσωµα από κάθε ζευγάρι οµολόγων γιατί α. τα οµόλογα ζεύγη διαχωρίζονται κατά τη διάρκεια της µείωσης β. οι αδελφές χρωµατίδες δε διαχωρίζονται κατά τη µείωση γ. διπλασιάζεται δύο φορές το DNA κατά τη µείωση δ. γίνεται επιχιασµός κατά την πρόφαση Ι. Ο επιχιασµός γίνεται κατά τη διάρκεια α. της πρόφασης I β. της µετάφασης Ι γ. της ανάφασης Ι δ. της ανάφασης ΙΙ. Το αντικωδικόνιο είναι τµήµα α. του DNA β. του mrna γ. του t-rna δ. των πρωτεϊνών που παράγονται. Μονάδες 3 65

42 1. Β. Να συµπληρώσετε µε τους κατάλληλους όρους τα κενά στις παρακάτω προτάσεις: Η σύνθεση των πρωτεϊνών γίνεται.... Με τη διαδικασία της µείωσης διαιρούνται διπλοειδή κύτταρα, τα οποία ονοµάζονται.... Μονάδες 2 2. Να χαρακτηρίσετε µε Σ (σωστό) ή µε Λ (λάθος) τις παρακάτω προτάσεις: Η διαδικασία της αντιγραφής αφορά την παραγωγή πολυπεπτιδικών αλυσίδων στα ριβοσώµατα. ( ) Με τη διαδικασία της µεταγραφής παράγεται RNA µε πρότυπο το DNA. ( ) Κάθε τριάδα νουκλεοτιδίων (τριπλέτα) του γενετικού κώδικα αντιστοιχεί σε ένα και µόνο αµινοξύ. ( ) Το αντικωδικόνιο είναι η τριάδα των αζωτούχων βάσεων του t-rna συµπληρωµατική µε κωδικόνιο του mrna. ( ) ιπλοειδή κύτταρα χαρακτηρίζονται τα κύτταρα που έχουν διπλάσιο µέγεθος από τα υπόλοιπα. ( ) Μονάδες 5 3. Να απαντήσετε σύντοµα στις παρακάτω ερωτήσεις: Ποιο είναι το κωδικόνιο έναρξης και σε ποιο αµινοξύ αντιστοιχεί; Ποιο είναι το αντικωδικόνιο, που αντιστοιχεί στην έναρξη της πρωτεϊνοσύνθεσης και σε ποιο µόριο βρίσκεται; Μονάδες 5 4. Να απαντήσετε στις παρακάτω ερωτήσεις µε µια παράγραφο: Μια πρωτεΐνη, που το πρώτο της αµινοξύ είναι η µεθειονίνη, αποτελείται από 20 αµινοξέα. Πόσα νουκλεοτίδια περιέχει το m-rna που κωδικοποιεί την πρωτεΐνη αυτή; Μονάδες 5 66

43 ΜΕΘΟ ΟΛΟΓΙΑ ΗΜΙΟΥΡΓΙΑΣ ΑΣΚΗΣΕΩΝ (ΕΦΑΡΜΟΓΩΝ) Οι ερωτήσεις, που περιλαµβάνονται στους οδηγούς για την αξιολόγηση των µαθητών, έχουν χαρακτήρα ενδεικτικό και συµβουλευτικό. Στόχος τους είναι η διευκόλυνση των εκπαιδευτικών ώστε να τροποποιούν, να απλουστεύουν ή και να διαµορφώνουν τις ερωτήσεις, ανάλογα µε το επίπεδο των µαθητών τους ή τους διδακτικούς στόχους που οι ίδιοι έχουν θέσει. Παρακάτω παραθέτουµε µια µεθοδολογία δηµιουργίας ασκήσεων (εφαρµογών) οι οποίες µπορούν να χρησιµοποιηθούν στα κεφάλαια 1 και 4. Εξετάζοντας ένα µεγάλο µέρος των ασκήσεων (εφαρµογών), διαπιστώνουµε ότι οι παράµετροι που εµπλέκονται σε αυτές είναι: Αριθµός βάσεων DNA ενός ή περισσοτέρων γονιδίων, ποσοστό και αριθµός κάθε βάσης, δεσµοί υδρογόνου, τριπλέτες νουκλεοτιδίων µεταγραφόµενης αλυσίδας, αµινοξέα πολυπεπτιδικής-ών αλυσίδων ή Μ.Β. αυτών. Μπορούµε εποµένως να δηµιουργήσουµε οποιαδήποτε άσκηση συνδυάζοντας αυτές τις παραµέτρους. Παρακάτω σας αναφέρουµε µερικούς τρόπους: 1. Μια σειρά ασκήσεων κατασκευάζεται µε οποιοδήποτε συνδυασµό των στοιχείων του πίνακα 1. ΠΙΝΑΚΑΣ 1 Αρ. βάσεων µε- Τριπλέτες µε- Μ.Β. πολυ- Αρ. βάσεων ταγραφόµενης ταγραφόµενης Αµινοξέα πεπτιδικής γονιδίων αλυσίδας αλυσίδας πρωτεΐνης αλυσίδας Για παράδειγµα: α) ίνεται ο αριθµός των βάσεων ενός τµήµατος µορίου DNA σε ένα προκαρυωτικό οργανισµό και ζητείται το Μ.Β. της πολυπεπτιδικής αλυσίδας που κωδικοποιεί ή το αντίστροφο (δίδεται το Μ.Β. και ζητείται ο αριθµός των βάσεων) ή β) ίνεται ο αριθµός των αµινοξέων µιας πρωτείνης και ζητείται ο αριθµός των βάσεων του γονιδίου που την κωδικοποιεί ή το αντίστροφο κ.λ.π. 67

ΚΑΤΑΣΤΑΤΙΚΟ ΚΕΝΤΡΟΥ ΝΕΟΤΗΤΑΣ. ΙΔΡΥΣΗ Ιδρύεται Κέντρο Νεότητας µε την επωνυµία «Κέντρο Νεότητας... µε έδρα...

ΚΑΤΑΣΤΑΤΙΚΟ ΚΕΝΤΡΟΥ ΝΕΟΤΗΤΑΣ. ΙΔΡΥΣΗ Ιδρύεται Κέντρο Νεότητας µε την επωνυµία «Κέντρο Νεότητας... µε έδρα... ΚΑΤΑΣΤΑΤΙΚΟ ΚΕΝΤΡΟΥ ΝΕΟΤΗΤΑΣ ΑΡΘΡΟ 1 ΙΔΡΥΣΗ Ιδρύεται Κέντρο Νεότητας µε την επωνυµία «Κέντρο Νεότητας... µε έδρα... ΑΡΘΡΟ 2 Στο Καταστατικό αυτό «Κέντρο Νεότητας» σηµαίνει: «εθελοντική-κοινοτική οργάνωση

Διαβάστε περισσότερα

ΠΡΟΤΑΣΗ ΣΥΝΗΓΟΡΟΥ ΤΟΥ ΚΑΤΑΝΑΛΩΤΗ. για την κατάρτιση ΚΩΔΙΚΑ ΚΑΤΑΝΑΛΩΤΙΚΗΣ ΔΕΟΝΤΟΛΟΓΙΑΣ

ΠΡΟΤΑΣΗ ΣΥΝΗΓΟΡΟΥ ΤΟΥ ΚΑΤΑΝΑΛΩΤΗ. για την κατάρτιση ΚΩΔΙΚΑ ΚΑΤΑΝΑΛΩΤΙΚΗΣ ΔΕΟΝΤΟΛΟΓΙΑΣ Ελληνική Δημοκρατία Ευρωπαϊκό ΕΥΡΩΠΑΪΚΟ ΚΕΝΤΡΟ ΚΑΤΑΝΑΛΩΤΗ ΕΛΛΑΔΑΣ Κέντρο Καταναλωτή Ελλάδας ΠΡΟΤΑΣΗ ΣΥΝΗΓΟΡΟΥ ΤΟΥ ΚΑΤΑΝΑΛΩΤΗ για την κατάρτιση ΚΩΔΙΚΑ ΚΑΤΑΝΑΛΩΤΙΚΗΣ ΔΕΟΝΤΟΛΟΓΙΑΣ Δεκέμβριος 2015 ΠΡΟΤΑΣΗ

Διαβάστε περισσότερα

ΠΕΡΙΛΗΨΗ ΚΕΙΜΕΝΟΥ : Θεωρία. Περίληψη γραπτού Λόγου. Τι είναι η περίληψη;

ΠΕΡΙΛΗΨΗ ΚΕΙΜΕΝΟΥ : Θεωρία. Περίληψη γραπτού Λόγου. Τι είναι η περίληψη; ΠΕΡΙΛΗΨΗ ΚΕΙΜΕΝΟΥ : Θεωρία Περίληψη γραπτού Λόγου Τι είναι η περίληψη; Είναι η συνοπτική και περιεκτική απόδοση, σε συνεχή λόγο, ενός κειμένου. Είναι ένα νέο κείμενο, που, χωρίς να προδίδει το αρχικό,

Διαβάστε περισσότερα

ΚΑΤΑΣΤΑΤΙΚΟ ΣΥΛΛΟΓΟΥ ΥΠΟΨΗΦΙΩΝ Ι ΑΚΤΟΡΩΝ ΤΟΥ ΤΜΗΜΑΤΟΣ ΠΛΗΡΟΦΟΡΙΚΗΣ ΤΟΥ ΟΙΚΟΝΟΜΙΚΟΥ ΠΑΝΕΠΙΣΤΗΜΙΟΥ ΑΘΗΝΩΝ

ΚΑΤΑΣΤΑΤΙΚΟ ΣΥΛΛΟΓΟΥ ΥΠΟΨΗΦΙΩΝ Ι ΑΚΤΟΡΩΝ ΤΟΥ ΤΜΗΜΑΤΟΣ ΠΛΗΡΟΦΟΡΙΚΗΣ ΤΟΥ ΟΙΚΟΝΟΜΙΚΟΥ ΠΑΝΕΠΙΣΤΗΜΙΟΥ ΑΘΗΝΩΝ ΚΑΤΑΣΤΑΤΙΚΟ ΣΥΛΛΟΓΟΥ ΥΠΟΨΗΦΙΩΝ Ι ΑΚΤΟΡΩΝ ΤΟΥ ΤΜΗΜΑΤΟΣ ΠΛΗΡΟΦΟΡΙΚΗΣ ΤΟΥ ΟΙΚΟΝΟΜΙΚΟΥ ΠΑΝΕΠΙΣΤΗΜΙΟΥ ΑΘΗΝΩΝ ΚΕΦΑΛΑΙΟ Α Ι ΡΥΣΗ - ΕΠΩΝΥΜΙΑ - Ε ΡΑ Άρθρο 1 α) Ιδρύεται σύλλογος µε την επωνυµία Σύλλογος Υποψηφίων

Διαβάστε περισσότερα

α. Ιδρύεται σύλλογος µε την επωνυµία Ενιαίος Σύλλογος ιδακτικού Προσωπικού

α. Ιδρύεται σύλλογος µε την επωνυµία Ενιαίος Σύλλογος ιδακτικού Προσωπικού ΚΑΤΑΣΤΑΤΙΚΟ ΤΟΥ ΣΥΛΛΟΓΟΥ ΜΕ ΤΗΝ ΕΠΩΝΥΜΙΑ «ΕΝΙΑΙΟΣ ΣΥΛΛΟΓΟΣ Ι ΑΚΤΙΚΟΥ ΠΡΟΣΩΠΙΚΟΥ ΤΟΥ XAΡΟΚΟΠΕΙΟΥ ΠΑΝΕΠΙΣΤΗΜΙΟΥ» ΚΕΦΑΛΑΙΟ Α ΣΥΣΤΑΣΗ ΕΠΩΝΥΜΙΑ ΣΦΡΑΓΙ Α - Ε ΡΑ ΣΚΟΠΟΣ ΜΕΣΑ Άρθρο 1 α. Ιδρύεται σύλλογος µε την

Διαβάστε περισσότερα

Ο ΠΡΟΕ ΡΟΣ ΤΗΣ ΕΛΛΗΝΙΚΗΣ ΗΜΟΚΡΑΤΙΑΣ Εκδίδοµε τον ακόλουθο νόµο που ψήφισε η Βουλή:

Ο ΠΡΟΕ ΡΟΣ ΤΗΣ ΕΛΛΗΝΙΚΗΣ ΗΜΟΚΡΑΤΙΑΣ Εκδίδοµε τον ακόλουθο νόµο που ψήφισε η Βουλή: ΝΟΜΟΣ ΥΠ' ΑΡΙΘ.3084 (ΦΕΚ.318/Α /16-12-2002) Κύρωση της Σύµβασης µεταξύ της Ελληνικής ηµοκρατίας και της ηµοκρατίας της Σλοβενίας για την αποφυγή της διπλής φορολογίας αναφορικά µε τους φόρους εισοδήµατος

Διαβάστε περισσότερα

Η ευσέβεια, η αξιοπιστία και η ακεραιότητα του Αγησιλάου (1 διδακτική ώρα)

Η ευσέβεια, η αξιοπιστία και η ακεραιότητα του Αγησιλάου (1 διδακτική ώρα) Κεφάλαιο 3 4 (από µετάφραση) Η ευσέβεια, η αξιοπιστία και η ακεραιότητα του Αγησιλάου (1 διδακτική ώρα) Ενδεικτικοί διδακτικοί στόχοι 1. Να γνωρίσουν το µέγεθος της αξιοπιστίας του Αγησιλάου και να κατανοήσουν

Διαβάστε περισσότερα

ΙΟΙΚΗΣΗ Ε.Ο.Κ. ΑΡΘΡΟ 1

ΙΟΙΚΗΣΗ Ε.Ο.Κ. ΑΡΘΡΟ 1 ΙΟΙΚΗΣΗ Ε.Ο.Κ. ΑΡΘΡΟ 1 ΙΟΙΚΗΣΗ Ε.Ο.Κ. Για την άσκηση της ιοίκησης της Ελληνικής Οµοσπονδίας Καλαθοσφαίρισης, προβλέπεται, από το Καταστατικό της και το Νόµο, η λειτουργία των παρακάτω οργάνων: Α. Από το

Διαβάστε περισσότερα

ΕΝ ΕΙΚΤΙΚΑ ΠΑΡΑ ΕΙΓΜΑΤΑ ΟΛΙΓΟΛΕΠΤΟΥ ΚΑΙ ΩΡΙΑΙΟΥ ΙΑΓΩΝΙΣΜΑΤΟΣ ΜΕ ΕΡΩΤΗΣΕΙΣ ΑΝΟΙΧΤΗΣ ΑΠΑΝΤΗΣΗΣ

ΕΝ ΕΙΚΤΙΚΑ ΠΑΡΑ ΕΙΓΜΑΤΑ ΟΛΙΓΟΛΕΠΤΟΥ ΚΑΙ ΩΡΙΑΙΟΥ ΙΑΓΩΝΙΣΜΑΤΟΣ ΜΕ ΕΡΩΤΗΣΕΙΣ ΑΝΟΙΧΤΗΣ ΑΠΑΝΤΗΣΗΣ ΕΝ ΕΙΚΤΙΚΑ ΠΑΡΑ ΕΙΓΜΑΤΑ ΟΛΙΓΟΛΕΠΤΟΥ ΚΑΙ ΩΡΙΑΙΟΥ ΙΑΓΩΝΙΣΜΑΤΟΣ ΜΕ ΕΡΩΤΗΣΕΙΣ ΑΝΟΙΧΤΗΣ ΑΠΑΝΤΗΣΗΣ Παραδείγµατα ολιγόλεπτου διαγωνίσµατος Το παράδειγµα αυτό αναφέρεται στη διδακτική ενότητα 3. Κύριος στόχος

Διαβάστε περισσότερα

Η ΦΟΡΟΛΟΓΗΣΗ ΤΩΝ ΦΥΣΙΚΩΝ ΠΡΟΣΩΠΩΝ ΣΤΗΝ ΕΥΡΩΠΑΙΚΗ ΕΝΩΣΗ

Η ΦΟΡΟΛΟΓΗΣΗ ΤΩΝ ΦΥΣΙΚΩΝ ΠΡΟΣΩΠΩΝ ΣΤΗΝ ΕΥΡΩΠΑΙΚΗ ΕΝΩΣΗ ΤΕΧΝΟΛΟΓΙΚΟ ΕΚΠΑΙ ΕΥΤΙΚΟ Ι ΡΥΜΑ ΚΡΗΤΗΣ ΣΧΟΛΗ ΙΟΙΚΗΣΕΙΣ ΟΙΚΟΝΟΜΙΑΣ ΤΜΗΜΑ ΛΟΓΙΣΤΙΚΗΣ ΠΤΥΧΙΑΚΗ ΕΡΓΑΣΙΑ Η ΦΟΡΟΛΟΓΗΣΗ ΤΩΝ ΦΥΣΙΚΩΝ ΠΡΟΣΩΠΩΝ ΣΤΗΝ ΕΥΡΩΠΑΙΚΗ ΕΝΩΣΗ ΣΠΟΥ ΑΣΤΕΣ: ΘΕΜΙΣΤΟΚΛΗΣ ΤΡΙΑΝΤΑΦΥΛΛΟΥ ΒΑΣΙΛΕΙΟΣ

Διαβάστε περισσότερα

35η ιδακτική Ενότητα ΕΝΟΧΙΚΕΣ ΣΧΕΣΕΙΣ ( ΕΝΟΧΙΚΟ ΙΚΑΙΟ)

35η ιδακτική Ενότητα ΕΝΟΧΙΚΕΣ ΣΧΕΣΕΙΣ ( ΕΝΟΧΙΚΟ ΙΚΑΙΟ) 35η ιδακτική Ενότητα ΕΝΟΧΙΚΕ ΧΕΕΙ ( ΕΝΟΧΙΚΟ ΙΚΑΙΟ) Εργασία για το σχολείο Ο καθηγητής θα µοιράσει µισθωτήρια κατοικιών στους µαθητές, θα τους χωρίσει ανά θρανίο σε εκµισθωτές και µισθωτές και αφού τους

Διαβάστε περισσότερα

I.Επί της Αρχής του σχεδίου Νόµου: ΙΙ. Επί των άρθρων του σχεδίου Νόµου: ΕΙΣΗΓΗΤΙΚΗ ΕΚΘΕΣΗ

I.Επί της Αρχής του σχεδίου Νόµου: ΙΙ. Επί των άρθρων του σχεδίου Νόµου: ΕΙΣΗΓΗΤΙΚΗ ΕΚΘΕΣΗ ΕΙΣΗΓΗΤΙΚΗ ΕΚΘΕΣΗ στο σχέδιο νόµου «Πρωτοβάθµιο Εθνικό Δίκτυο Υγείας (Π.Ε.Δ.Υ.), αλλαγή σκοπού Ε.Ο.Π.Υ.Υ. και λοιπές διατάξεις» Προς τη Βουλή των Ελλήνων I.Επί της Αρχής του σχεδίου Νόµου: Με τις διατάξεις

Διαβάστε περισσότερα

ΙΙ, 3-4. Α. Ερωτήσεις ανοικτού τύπου ή ελεύθερης ανάπτυξης

ΙΙ, 3-4. Α. Ερωτήσεις ανοικτού τύπου ή ελεύθερης ανάπτυξης ΙΙ, 3-4 1. Παραδείγµατα ερµηνευτικών ερωτήσεων Α. Ερωτήσεις ανοικτού τύπου ή ελεύθερης ανάπτυξης 1. Τι σήµαινε για τους Αθηναίους η αναγγελία της συντριβής της ναυτικής τους δύναµης στους Αιγός Ποταµούς;

Διαβάστε περισσότερα

ΝΟΜΟΣ ΠΟΥ ΠΡΟΒΛΕΠΕΙ ΓΙΑ ΤΗΝ ΚΡΑΤΙΚΗ ΦΟΙΤΗΤΙΚΗ ΜΕΡΙΜΝΑ ΚΑΙ ΓΙΑ ΣΥΝΑΦΗ ΘΕΜΑΤΑ. Η Βουλή των Αντιπροσώπων ψηφίζει ως ακολούθως:

ΝΟΜΟΣ ΠΟΥ ΠΡΟΒΛΕΠΕΙ ΓΙΑ ΤΗΝ ΚΡΑΤΙΚΗ ΦΟΙΤΗΤΙΚΗ ΜΕΡΙΜΝΑ ΚΑΙ ΓΙΑ ΣΥΝΑΦΗ ΘΕΜΑΤΑ. Η Βουλή των Αντιπροσώπων ψηφίζει ως ακολούθως: ΝΟΜΟΣ ΠΟΥ ΠΡΟΒΛΕΠΕΙ ΓΙΑ ΤΗΝ ΚΡΑΤΙΚΗ ΦΟΙΤΗΤΙΚΗ ΜΕΡΙΜΝΑ ΚΑΙ ΓΙΑ ΣΥΝΑΦΗ ΘΕΜΑΤΑ Η Βουλή των Αντιπροσώπων ψηφίζει ως ακολούθως: Συνοπτικός τίτλος. 1. Ο παρών Νόμος θα αναφέρεται ως ο περί Κρατικής Φοιτητικής

Διαβάστε περισσότερα

ΤΑ ΕΠΙΠΕΔΑ ΟΡΓΑΝΩΣΗΣ ΤΩΝ ΠΟΛΥΚΥΤΤΑΡΩΝ ΟΡΓΑΝΣΙΜΩΝ ΟΙ ΖΩΙΚΟΙ ΙΣΤΟΙ 2 ο ΦΥΛΛΟ ΕΡΓΑΣΙΑΣ

ΤΑ ΕΠΙΠΕΔΑ ΟΡΓΑΝΩΣΗΣ ΤΩΝ ΠΟΛΥΚΥΤΤΑΡΩΝ ΟΡΓΑΝΣΙΜΩΝ ΟΙ ΖΩΙΚΟΙ ΙΣΤΟΙ 2 ο ΦΥΛΛΟ ΕΡΓΑΣΙΑΣ ΤΑ ΕΠΙΠΕΔΑ ΟΡΓΑΝΩΣΗΣ ΤΩΝ ΠΟΛΥΚΥΤΤΑΡΩΝ ΟΡΓΑΝΣΙΜΩΝ ΟΙ ΖΩΙΚΟΙ ΙΣΤΟΙ 2 ο ΦΥΛΛΟ ΕΡΓΑΣΙΑΣ ΤΑ ΟΝΟΜΑΤΑ ΤΩΝ ΜΑΘΗΤΩΝ ΤΗΣ ΟΜΑΔΑΣ ΣΑΣ:.. ΔΡΑΣΤΗΡΙΟΤΗΤΑ 1 η Οι ιστοί των οργάνων του πεπτικού συστήματος Α) Ένα σημαντικό

Διαβάστε περισσότερα

Η ΕΛΛΗΝΙΚΗ ΕΠΑΝΑΣΤΑΣΗ

Η ΕΛΛΗΝΙΚΗ ΕΠΑΝΑΣΤΑΣΗ ΚΕΦΑΛΑΙΟ Η ΕΛΛΗΝΙΚΗ ΕΠΑΝΑΣΤΑΣΗ (1821-1829) 150 1. Η έκρηξη και η εδραίωση της Επανάστασης (1821-1823) Ερωτήσεις ανάπτυξης 1. Αφού µελετήσετε το απόσπασµα από την επαναστατική προκήρυξη του Αντώνη Οικονόµου

Διαβάστε περισσότερα

ΕΣΩΤΕΡΙΚΟΙ ΚΑΝΟΝΙΣΜΟΙ ΙΟΙΚΗΤΙΚΗ ΙΑΡΘΡΩΣΗ

ΕΣΩΤΕΡΙΚΟΙ ΚΑΝΟΝΙΣΜΟΙ ΙΟΙΚΗΤΙΚΗ ΙΑΡΘΡΩΣΗ ΕΣΩΤΕΡΙΚΟΙ ΚΑΝΟΝΙΣΜΟΙ ΙΟΙΚΗΤΙΚΗ ΙΑΡΘΡΩΣΗ ΚΕΦ.1 Γενική Εφορεία ΚΕΦ.2 Περιφερειακή Οργάνωση Επαρχιακές Εφορείες Τοπικές Εφορείες Καθήκοντα και υποχρεώσεις Επαρχιακών και Τοπικών Εφόρων ιαδικασία ανάδειξης

Διαβάστε περισσότερα

Επίσηµη Εφηµερίδα της Ευρωπαϊκής Ένωσης

Επίσηµη Εφηµερίδα της Ευρωπαϊκής Ένωσης L 31/18 6.2.2003 Ο ΗΓΙΑ 2003/9/ΕΚ ΤΟΥ ΣΥΜΒΟΥΛΙΟΥ της 27ης Ιανουαρίου 2003 σχετικά µε τις ελάχιστες απαιτήσεις για την υποδοχή των αιτούντων άσυλο στα κράτη µέλη ΤΟ ΣΥΜΒΟΥΛΙΟ ΤΗΣ ΕΥΡΩΠΑΪΚΗΣ ΕΝΩΣΗΣ, Έχοντας

Διαβάστε περισσότερα

ΙΝΣΤΙΤΟΥΤΟ ΠΑΙΔΑΓΩΓΙΚΩΝ ΕΡΕΥΝΩΝ ΜΕΛΕΤΩΝ ΔΙΔΑΣΚΑΛΙΚΗΣ ΟΜΟΣΠΟΝΔΙΑΣ ΕΛΛΑΔΑΣ

ΙΝΣΤΙΤΟΥΤΟ ΠΑΙΔΑΓΩΓΙΚΩΝ ΕΡΕΥΝΩΝ ΜΕΛΕΤΩΝ ΔΙΔΑΣΚΑΛΙΚΗΣ ΟΜΟΣΠΟΝΔΙΑΣ ΕΛΛΑΔΑΣ 2/10 ΙΝΣΤΙΤΟΥΤΟ ΠΑΙΔΑΓΩΓΙΚΩΝ ΕΡΕΥΝΩΝ ΜΕΛΕΤΩΝ ΔΙΔΑΣΚΑΛΙΚΗΣ ΟΜΟΣΠΟΝΔΙΑΣ ΕΛΛΑΔΑΣ ΚEΝΤΡΟ ΜΕΛΕΤΩΝ & ΤΕΚΜΗΡΙΩΣΗΣ ΟΛΜΕ Αγαπητή/αγαπητέ Συνάδελφε, Το ΚΟΙΝΩΝΙΚΟ ΠΟΛΥΚΕΝΤΡΟ, Ινστιτούτο της ΑΔΕΔΥ, με τη συνεργασία

Διαβάστε περισσότερα

ΑΠΟΣΠΑΣΜΑ Από το Πρακτικό 2/2014 της συνεδρίασης της Εκτελεστικής Επιτροπής του Δήμου ΕΜΜΑΝΟΥΗΛ ΠΑΠΠΑ

ΑΠΟΣΠΑΣΜΑ Από το Πρακτικό 2/2014 της συνεδρίασης της Εκτελεστικής Επιτροπής του Δήμου ΕΜΜΑΝΟΥΗΛ ΠΑΠΠΑ ΕΛΛΗΝΙΚΗ ΔΗΜΟΚΡΑΤΙΑ ΝΟΜΟΣ ΣΕΡΡΩΝ ΔΗΜΟΣ ΕΜΜΑΝΟΥΗΛ ΠΑΠΠΑ Αριθ.Αποφ: 2/2014 ΑΠΟΣΠΑΣΜΑ Από το Πρακτικό 2/2014 της συνεδρίασης της Εκτελεστικής Επιτροπής του Δήμου ΕΜΜΑΝΟΥΗΛ ΠΑΠΠΑ ΘΕΜΑ: Εισήγηση της εκτελεστικής

Διαβάστε περισσότερα

ΛΥΚΕΙΟ ΑΓΙΑΣ ΦΥΛΑΞΕΩΣ ΣΧΟΛΙΚΗ ΧΡΟΝΙΑ 2007-2008 ΛΕΜΕΣΟΣ ΓΡΑΠΤΕΣ ΠΡΟΑΓΩΓΙΚΕΣ ΕΞΕΤΑΣΕΙΣ ΙΟΥΝΙΟΥ 2008. Μάθηµα : ΦΥΣΙΟΓΝΩΣΤΙΚΑ Ηµεροµηνία : 04/6/2008

ΛΥΚΕΙΟ ΑΓΙΑΣ ΦΥΛΑΞΕΩΣ ΣΧΟΛΙΚΗ ΧΡΟΝΙΑ 2007-2008 ΛΕΜΕΣΟΣ ΓΡΑΠΤΕΣ ΠΡΟΑΓΩΓΙΚΕΣ ΕΞΕΤΑΣΕΙΣ ΙΟΥΝΙΟΥ 2008. Μάθηµα : ΦΥΣΙΟΓΝΩΣΤΙΚΑ Ηµεροµηνία : 04/6/2008 ΛΥΚΕΙΟ ΑΓΙΑΣ ΦΥΛΑΞΕΩΣ ΣΧΟΛΙΚΗ ΧΡΟΝΙΑ 2007-2008 ΛΕΜΕΣΟΣ ΓΡΑΠΤΕΣ ΠΡΟΑΓΩΓΙΚΕΣ ΕΞΕΤΑΣΕΙΣ ΙΟΥΝΙΟΥ 2008 Μάθηµα : ΦΥΣΙΟΓΝΩΣΤΙΚΑ Ηµεροµηνία : 04/6/2008 Τάξη /Τµήµα : Α Ονοµατεπώνυµο :. Χρόνος : 1 Ώρα ( 60 Λεπτά

Διαβάστε περισσότερα

ΧΕΙΜΕΡΙΝΟΣ ΤΟΥΡΙΣΜΟΣ ΣΤΗΝ ΕΛΛΑ Α

ΧΕΙΜΕΡΙΝΟΣ ΤΟΥΡΙΣΜΟΣ ΣΤΗΝ ΕΛΛΑ Α ΑΝΩΤΑΤΟ ΤΕΧΝΟΛΟΓΙΚΟ Ι ΡΥΜΑ ΚΡΗΤΗΣ ΣΧΟΛΗ ΙΟΙΚΗΣΗΣ ΚΑΙ ΟΙΚΟΝΟΜΙΑΣ ΤΜΗΜΑ ΤΟΥΡΙΣΤΙΚΩΝ ΕΠΙΧΕΙΡΗΣΕΩΝ ΠΤΥΧΙΑΚΗ ΕΡΓΑΣΙΑ ΧΕΙΜΕΡΙΝΟΣ ΤΟΥΡΙΣΜΟΣ ΣΤΗΝ ΕΛΛΑ Α ΥΠΕΥΘΥΝΟΣ ΚΑΘΗΓΗΤΗΣ : ΓΙΑΝΝΟΥΛΙ ΟΥ ΠΑΡΑΣΚΕΥΗ ΣΠΟΥ ΑΣΤΡΙΑ

Διαβάστε περισσότερα

ΠΑΡΑΡΤΗΜΑ IΙΙ. Ανάλυση των γενικών κριτηρίων πιστοποίησης της ποιότητας των προγραμμάτων σπουδών

ΠΑΡΑΡΤΗΜΑ IΙΙ. Ανάλυση των γενικών κριτηρίων πιστοποίησης της ποιότητας των προγραμμάτων σπουδών ΠΑΡΑΡΤΗΜΑ IΙΙ Ανάλυση των γενικών κριτηρίων πιστοποίησης της ποιότητας των προγραμμάτων σπουδών α) Η ακαδημαϊκή φυσιογνωμία και ο προσανατολισμός του προγράμματος σπουδών α.1. α.2. α.3. Ανταπόκριση του

Διαβάστε περισσότερα

(ΦΕΚ Α 19 16.2.2010) Ο ΠΡΟΕΔΡΟΣ ΤΗΣ ΕΛΛΗΝΙΚΗΣ ΔΗΜΟΚΡΑΤΙΑΣ. Εκδίδομε τον ακόλουθο νόμο που ψήφισε η Βουλή: Αρθρο πρώτο

(ΦΕΚ Α 19 16.2.2010) Ο ΠΡΟΕΔΡΟΣ ΤΗΣ ΕΛΛΗΝΙΚΗΣ ΔΗΜΟΚΡΑΤΙΑΣ. Εκδίδομε τον ακόλουθο νόμο που ψήφισε η Βουλή: Αρθρο πρώτο ΝΟΜΟΣ 3820/2010 (Μαρόκο) Κύρωση της Σύμβασης μεταξύ της Ελληνικής Δημοκρατίας και του Βασιλείου του Μαρόκου για την αποφυγή της διπλής φορολογίας και την αποτροπή της φοροδιαφυγής αναφορικά με τους φόρους

Διαβάστε περισσότερα

ΣΧΕΔΙΟ ΝΟΜΟΥ ΔΑΣΙΚΕΣ ΣΥΝΕΤΑΙΡΙΣΤΙΚΕΣ ΟΡΓΑΝΩΣΕΙΣ

ΣΧΕΔΙΟ ΝΟΜΟΥ ΔΑΣΙΚΕΣ ΣΥΝΕΤΑΙΡΙΣΤΙΚΕΣ ΟΡΓΑΝΩΣΕΙΣ ΣΧΕΔΙΟ ΝΟΜΟΥ ΔΑΣΙΚΕΣ ΣΥΝΕΤΑΙΡΙΣΤΙΚΕΣ ΟΡΓΑΝΩΣΕΙΣ ΚΕΦΑΛΑΙΟ Α ΓΕΝΙΚΕΣ ΔΙΑΤΑΞΕΙΣ Άρθρο 1 Ορισμός σκοπός διαβάθμιση δραστηριότητες 1. Η Δασική Συνεταιριστική Οργάνωση (ΔΑ.Σ.Ο.) είναι αυτόνομη ένωση προσώπων,

Διαβάστε περισσότερα

Ο ΠΡΟΕΔΡΟΣ ΤΗΣ ΒΟΥΛΗΣ ΤΩΝ ΕΛΛΗΝΩΝ. Άρθρο πρώτο.

Ο ΠΡΟΕΔΡΟΣ ΤΗΣ ΒΟΥΛΗΣ ΤΩΝ ΕΛΛΗΝΩΝ. Άρθρο πρώτο. ΝΟΜΟΣ: 1634/86 Κύρωση των πρωτοκόλλων 1980 «Για την προστασία της Μεσογείου θαλάσσης από τη ρύπανση από χερσαίες πηγές» και 1982 «περί των ειδικά προστατευομένων περιοχών της Μεσογείου» (ΦΕΚ 104/Α/18-07-86)

Διαβάστε περισσότερα

ΝΟΜΟΣ ΥΠ' ΑΡΙΘ. 4194 Κώδικας Δικηγόρων

ΝΟΜΟΣ ΥΠ' ΑΡΙΘ. 4194 Κώδικας Δικηγόρων ΝΟΜΟΣ ΥΠ' ΑΡΙΘ. 4194 Κώδικας Δικηγόρων ΝΟΜΟΣ ΥΠ' ΑΡΙΘ. 4194 Κώδικας Δικηγόρων. (ΦΕΚ Α' 208/27-09-2013) Ο ΠΡΟΕΔΡΟΣ ΤΗΣ ΕΛΛΗΝΙΚΗΣ ΔΗΜΟΚΡΑΤΙΑΣ Εκδίδομε τον ακόλουθο νόμο που ψήφισε η Βουλή: Αρθρο 1. Η φύση

Διαβάστε περισσότερα

ΣΩΜΑ ΠΡΟΣΚΟΠΩΝ ΚΥΠΡΟΥ. Εσωτερικός Κανονισμός. Προσκοπικού Πρατηρίου

ΣΩΜΑ ΠΡΟΣΚΟΠΩΝ ΚΥΠΡΟΥ. Εσωτερικός Κανονισμός. Προσκοπικού Πρατηρίου ΣΩΜΑ ΠΡΟΣΚΟΠΩΝ ΚΥΠΡΟΥ Εσωτερικός Κανονισμός Προσκοπικού Πρατηρίου Λευκωσία Μάιος 2010 Περιεχόμενα: 1. Υπόσταση.... 2 2. Σκοπός... 2 3. Λειτουργία... 2 4. Διαχειριστική Επιτροπή..... 2 5. Πελάτες.... 4

Διαβάστε περισσότερα

Μαρξ, Κ. (2007). "Κριτική του προγράµµατος της Γκότα", σ. 37.

Μαρξ, Κ. (2007). Κριτική του προγράµµατος της Γκότα, σ. 37. «( ) Ίση λαϊκή εκπαίδευση; Τι να φαντάζονται µ αυτά τα λόγια; Πιστεύουν ότι µπορεί στη σηµερινή κοινωνία (και µονάχα µε δαύτην έχουν να κάνουν) να είναι η εκπαίδευση ίση για όλες τις τάξεις; Ή ζητάνε να

Διαβάστε περισσότερα

ΑΡΙΣΤΟΤΕΛΕΙΟ ΠΑΝΕΠΙΣΤΗΜΙΟ ΘΕΣΣΑΛΟΝΙΚΗΣ ΣΧΟΛΗ Ν.Ο.Π.Ε. ΤΜΗΜΑ ΝΟΜΙΚΗΣ ΠΡΟΓΡΑΜΜΑ ΜΕΤΑΠΤΥΧΙΑΚΩΝ ΣΠΟΥΔΩΝ ΤΟΜΕΑΣ ΕΜΠΟΡΙΚΟΥ ΚΑΙ ΟΙΚΟΝΟΜΙΚΟΥ ΔΙΚΑΙΟΥ

ΑΡΙΣΤΟΤΕΛΕΙΟ ΠΑΝΕΠΙΣΤΗΜΙΟ ΘΕΣΣΑΛΟΝΙΚΗΣ ΣΧΟΛΗ Ν.Ο.Π.Ε. ΤΜΗΜΑ ΝΟΜΙΚΗΣ ΠΡΟΓΡΑΜΜΑ ΜΕΤΑΠΤΥΧΙΑΚΩΝ ΣΠΟΥΔΩΝ ΤΟΜΕΑΣ ΕΜΠΟΡΙΚΟΥ ΚΑΙ ΟΙΚΟΝΟΜΙΚΟΥ ΔΙΚΑΙΟΥ ΑΡΙΣΤΟΤΕΛΕΙΟ ΠΑΝΕΠΙΣΤΗΜΙΟ ΘΕΣΣΑΛΟΝΙΚΗΣ ΣΧΟΛΗ Ν.Ο.Π.Ε. ΤΜΗΜΑ ΝΟΜΙΚΗΣ ΠΡΟΓΡΑΜΜΑ ΜΕΤΑΠΤΥΧΙΑΚΩΝ ΣΠΟΥΔΩΝ ΤΟΜΕΑΣ ΕΜΠΟΡΙΚΟΥ ΚΑΙ ΟΙΚΟΝΟΜΙΚΟΥ ΔΙΚΑΙΟΥ ΚΥΡΙΟ ΜΑΘΗΜΑ: ΕΜΠΟΡΙΚΕΣ ΔΙΚΑΙΟΠΡΑΞΙΕΣ ΔΙΠΛΩΜΑΤΙΚΗ ΕΡΓΑΣΙΑ ΜΕ

Διαβάστε περισσότερα

Αθλητικός χώρος σηµαίνει γήπεδο, στάδιο ή χώρος προπονήσεως.

Αθλητικός χώρος σηµαίνει γήπεδο, στάδιο ή χώρος προπονήσεως. 1 Αθλητικό παράπτωµα Αθλητικός χώρος «Αθλητικό παράπτωµα» σηµαίνει οποιαδήποτε πράξη ή παράλειψη αντικείµενη προς τους εν Κύπρο κρατούντες ή διεθνείς κανόνες ή κανονισµούς ή την διεθνή αθλητική δεοντολογία

Διαβάστε περισσότερα

ΕΛΛΗΝΙΚΗ ΗΜΟΚΡΑΤΙΑ ΝΟΜΟΣ ΠΕΛΛΑΣ ΗΜΟΣ Ε ΕΣΣΑΣ

ΕΛΛΗΝΙΚΗ ΗΜΟΚΡΑΤΙΑ ΝΟΜΟΣ ΠΕΛΛΑΣ ΗΜΟΣ Ε ΕΣΣΑΣ ΕΛΛΗΝΙΚΗ ΗΜΟΚΡΑΤΙΑ ΝΟΜΟΣ ΠΕΛΛΑΣ ΗΜΟΣ Ε ΕΣΣΑΣ ΑΠΟΣΠΑΣΜΑ ΑΠΟ ΤΟ ΠΡΑΚΤΙΚΟ ΤΗΣ 23 ης ΣΥΝΕ ΡΙΑΣΗΣ ΤΟΥ ΗΜΟΤΙΚΟΥ ΣΥΜΒΟΥΛΙΟΥ ΗΜΟΥ Ε ΕΣΣΑΣ ΣΤΙΣ 29 ΟΚΤΩΒΡΙΟΥ 2014 ΑΡΙΘΜΟΣ ΑΠΟΦΑΣΗΣ : 231/2014 ΘΕΜΑ ΗΜΕΡΗΣΙΑΣ ΙΑΤΑΞΗΣ:

Διαβάστε περισσότερα

ΕΤΟΣ 1936. Συνεδρίαση 171/9-2-1936

ΕΤΟΣ 1936. Συνεδρίαση 171/9-2-1936 ΕΤΟΣ 1936 ΝΕΟ ΙΟΙΚΗΤΙΚΟ ΣΥΜΒΟΥΛΙΟ ΠΡΟΕ ΡΟΣ ΑΝΤΙΠΡΟΕ ΡΟΣ ΓΡΑΜΜΑΤΕΑΣ ΤΑΜΙΑΣ ΤΑ ΜΕΛΗ : Κυπριάδης Ανδρέας : Βούλγαρης Κωνσταντίνος : Μανδηλαράς Γεώργιος : Σίµος Γεώργιος : Κουµερτάς Ματθαίος Λεγάκης Μάριος

Διαβάστε περισσότερα

Ε.Ε. Π α ρ.ι(i), Α ρ.3834, 8/4/2004 Ο ΠΕΡΙ ΑΣΤΥΝΟΜΙΑΣ ΝΟΜΟΣ ΤΟΥ 2004 ΚΑΤΑΤΑΞΗ ΑΡΘΡΩΝ ΜΕΡΟΣ Ι - ΕΙΣΑΓΩΓΗ ΜΕΡΟΣ ΙΙ - ΟΡΓΑΝΩΣΗ ΚΑΙ ΔΙΟΙΚΗΣΗ

Ε.Ε. Π α ρ.ι(i), Α ρ.3834, 8/4/2004 Ο ΠΕΡΙ ΑΣΤΥΝΟΜΙΑΣ ΝΟΜΟΣ ΤΟΥ 2004 ΚΑΤΑΤΑΞΗ ΑΡΘΡΩΝ ΜΕΡΟΣ Ι - ΕΙΣΑΓΩΓΗ ΜΕΡΟΣ ΙΙ - ΟΡΓΑΝΩΣΗ ΚΑΙ ΔΙΟΙΚΗΣΗ Ο ΠΕΡΙ ΑΣΤΥΝΟΜΙΑΣ ΝΟΜΟΣ ΤΟΥ 2004 ΚΑΤΑΤΑΞΗ ΑΡΘΡΩΝ ΜΕΡΟΣ Ι - ΕΙΣΑΓΩΓΗ Άρθρο 1. Συνοπτικός τίτλος. 2. Ερμηνεία. 3. Καθίδρυση Αστυνομίας Κύπρου. 4. Εξουσίες Υπουργού. 5. Συγκρότηση Αστυνομίας. 6. Εξουσίες

Διαβάστε περισσότερα

62 η ΣΥΝΟΔΟΣ ΠΡΥΤΑΝΕΩΝ & ΠΡΟΕΔΡΩΝ Δ.Ε. ΤΩΝ ΕΛΛΗΝΙΚΩΝ ΠΑΝΕΠΙΣΤΗΜΙΩΝ

62 η ΣΥΝΟΔΟΣ ΠΡΥΤΑΝΕΩΝ & ΠΡΟΕΔΡΩΝ Δ.Ε. ΤΩΝ ΕΛΛΗΝΙΚΩΝ ΠΑΝΕΠΙΣΤΗΜΙΩΝ 62 η ΣΥΝΟΔΟΣ ΠΡΥΤΑΝΕΩΝ & ΠΡΟΕΔΡΩΝ Δ.Ε. ΤΩΝ ΕΛΛΗΝΙΚΩΝ ΠΑΝΕΠΙΣΤΗΜΙΩΝ Τεχνολογικό Πολιτιστικό Πάρκο Λαυρίου του Ε.Μ.Π. 11 & 12 Δεκεµβρίου 2009, Λαύριο ΕΙΣΗΓΗΣΗ ΓΙΑ ΤΟ ΣΥΣΤΗΜΑ ΠΡΟΣΒΑΣΗΣ ΣΤΗΝ ΤΡΙΤΟΒΑΘΜΙΑ ΕΚΠΑΙΔΕΥΣΗ

Διαβάστε περισσότερα

ΕΝΩΠΙΟΝ ΠΑΝΤΟΣ ΑΡΜΟΔΙΟΥ ΔΙΚΑΣΤΗΡΙΟΥ ΚΑΙ ΠΑΣΗΣ ΔΗΜΟΣΙΑΣ ΑΡΧΗΣ ΕΞΩΔΙΚΗ ΔΙΑΜΑΡΤΥΡΙΑ ΠΡΟΣΚΛΗΣΗ ΔΗΛΩΣΗ

ΕΝΩΠΙΟΝ ΠΑΝΤΟΣ ΑΡΜΟΔΙΟΥ ΔΙΚΑΣΤΗΡΙΟΥ ΚΑΙ ΠΑΣΗΣ ΔΗΜΟΣΙΑΣ ΑΡΧΗΣ ΕΞΩΔΙΚΗ ΔΙΑΜΑΡΤΥΡΙΑ ΠΡΟΣΚΛΗΣΗ ΔΗΛΩΣΗ ΕΝΩΠΙΟΝ ΠΑΝΤΟΣ ΑΡΜΟΔΙΟΥ ΔΙΚΑΣΤΗΡΙΟΥ ΚΑΙ ΠΑΣΗΣ ΔΗΜΟΣΙΑΣ ΑΡΧΗΣ ΕΞΩΔΙΚΗ ΔΙΑΜΑΡΤΥΡΙΑ ΠΡΟΣΚΛΗΣΗ ΔΗΛΩΣΗ 1. ΑΓΟΡΑΝΟΥ Νικολάου, Ιατρού Ε.Σ.Υ., Επιμελητή Α Γενικής Ιατρικής στο Κέντρο Υγείας Ν. Μάκρης, δικαιοδοσίας

Διαβάστε περισσότερα

Ο ΗΓΟΣ ΜΑΘΗΜΑΤΩΝ ΑΚΑ ΗΜΑΪΚΟΥ ΕΤΟΥΣ 2013-2014

Ο ΗΓΟΣ ΜΑΘΗΜΑΤΩΝ ΑΚΑ ΗΜΑΪΚΟΥ ΕΤΟΥΣ 2013-2014 Ο ΗΓΟΣ ΜΑΘΗΜΑΤΩΝ ΑΚΑ ΗΜΑΪΚΟΥ ΕΤΟΥΣ 201-201 1 ΠΡΟΓΡΑΜΜΑ ΣΠΟΥ ΩΝ Φ.Π.Ψ. A. ιάρθρωση Προγράµµατος Μαθµατα Φιλοσοφίας: 7 ( υποχρεωτικά + 2 επιλεγόµενα) Μαθµατα Παιδαγωγικς: 8 ( υποχρεωτικά + επιλεγόµενα) Μαθµατα

Διαβάστε περισσότερα

ΑΙΤΗΣΗ ΓΙΑ ΤΟ ΠΑΚΕΤΟ ΣΤΟΧΕΥΜΕΝΩΝ ΜΕΤΡΩΝ ΚΡΑΤΙΚΗΣ ΦΟΙΤΗΤΙΚΗΣ ΠΡΟΝΟΙΑΣ ΓΙΑ ΤΟ ΑΚΑ ΗΜΑΪΚΟ ΕΤΟΣ 2014/2015

ΑΙΤΗΣΗ ΓΙΑ ΤΟ ΠΑΚΕΤΟ ΣΤΟΧΕΥΜΕΝΩΝ ΜΕΤΡΩΝ ΚΡΑΤΙΚΗΣ ΦΟΙΤΗΤΙΚΗΣ ΠΡΟΝΟΙΑΣ ΓΙΑ ΤΟ ΑΚΑ ΗΜΑΪΚΟ ΕΤΟΣ 2014/2015 ΚΥΠΡΙΑΚΗ ΗΜΟΚΡΑΤΙΑ ΥΠΟΥΡΓΕΙΟ ΠΑΙ ΕΙΑΣ ΚΑΙ ΠΟΛΙΤΙΣΜΟΥ Για Επίσηµη Χρήση Κοινωνικοοικονοµικά µόρια.. Μόρια απόστασης Συνολικά: Για Επίσηµη Χρήση Αρ. Αίτησης:. Όν. Παρ.:. Ηµερ. Παραλαβής: / /2015 ΑΙΤΗΣΗ ΓΙΑ

Διαβάστε περισσότερα

ΟΔΗΓΙΕΣ ΓΙΑ ΤΗΝ ΕΠΙΛΟΓΗ ΔΙΑΧΕΙΡΙΣΗ ΘΕΜΑΤΩΝ ΣΧΕΤΙΚΑ ΜΕ ΤΑ ΝΑΠ ΔΙΑΦΟΡΩΝ ΓΝΩΣΤΙΚΩΝ ΑΝΤΙΚΕΙΜΕΝΩΝ ΣΤΑ ΣΥΜΠΛΕΓΜΑΤΑ ΤΑΞΕΩΝ

ΟΔΗΓΙΕΣ ΓΙΑ ΤΗΝ ΕΠΙΛΟΓΗ ΔΙΑΧΕΙΡΙΣΗ ΘΕΜΑΤΩΝ ΣΧΕΤΙΚΑ ΜΕ ΤΑ ΝΑΠ ΔΙΑΦΟΡΩΝ ΓΝΩΣΤΙΚΩΝ ΑΝΤΙΚΕΙΜΕΝΩΝ ΣΤΑ ΣΥΜΠΛΕΓΜΑΤΑ ΤΑΞΕΩΝ ΟΔΗΓΙΕΣ ΓΙΑ ΤΗΝ ΕΠΙΛΟΓΗ ΔΙΑΧΕΙΡΙΣΗ ΘΕΜΑΤΩΝ ΣΧΕΤΙΚΑ ΜΕ ΤΑ ΝΑΠ ΔΙΑΦΟΡΩΝ ΓΝΩΣΤΙΚΩΝ ΑΝΤΙΚΕΙΜΕΝΩΝ ΣΤΑ ΣΥΜΠΛΕΓΜΑΤΑ ΤΑΞΕΩΝ ΦΥΣΙΚΕΣ ΕΠΙΣΤΗΜΕΣ ΚΑΙ ΤΕΧΝΟΛΟΓΙΑ, ΦΥΣΙΚΕΣ ΕΠΙΣΤΗΜΕΣ Σύμφωνα με τα νέα Ωρολόγια Προγράμματα,

Διαβάστε περισσότερα

ΕΠΙΤΡΟΠΗ ΕΘΝΙΚΗΣ ΑΜΥΝΑΣ ΚΑΙ ΕΞΩΤΕΡΙΚΩΝ ΥΠΟΘΕΣΕΩΝ ΝΟΜΟΣΧΕ ΙΟ. «Στρατολογία των Ελλήνων» Άρθρο 1 Υπόχρεοι σε στράτευση

ΕΠΙΤΡΟΠΗ ΕΘΝΙΚΗΣ ΑΜΥΝΑΣ ΚΑΙ ΕΞΩΤΕΡΙΚΩΝ ΥΠΟΘΕΣΕΩΝ ΝΟΜΟΣΧΕ ΙΟ. «Στρατολογία των Ελλήνων» Άρθρο 1 Υπόχρεοι σε στράτευση ΕΠΙΤΡΟΠΗ ΕΘΝΙΚΗΣ ΑΜΥΝΑΣ ΚΑΙ ΕΞΩΤΕΡΙΚΩΝ ΥΠΟΘΕΣΕΩΝ ΝΟΜΟΣΧΕ ΙΟ «Στρατολογία των Ελλήνων» Άρθρο 1 Υπόχρεοι σε στράτευση 1. Όλοι οι Έλληνες πολίτες, από την 1η Ιανουαρίου του έτους κατά το οποίο διανύουν το

Διαβάστε περισσότερα

ΠΑΝΕΠΙΣΤΗΜΙΟ ΘΕΣΣΑΛΙΑΣ

ΠΑΝΕΠΙΣΤΗΜΙΟ ΘΕΣΣΑΛΙΑΣ ΑΚΑΔΗΜΑΪΚΟ ΕΤΟΣ 2009 2010 ΟΔΗΓΟΣ ΣΠΟΥΔΩΝ ΤΜΗΜΑ ΓΕΩΠΟΝΙΑΣ ΦΥΤΙΚΗΣ ΠΑΡΑΓΩΓΗΣ ΚΑΙ ΑΓΡΟΤΙΚΟΥ ΠΕΡΙΒΑΛΛΟΝΤΟΣ ΠΑΝΕΠΙΣΤΗΜΙΟ ΘΕΣΣΑΛΙΑΣ Ν. Ιωνία, ΒΟΛΟΣ Τη συγκέντρωση της ύλης του και την επιμέλεια της έκδοσης είχε

Διαβάστε περισσότερα

ΜΕΡΟΣ Ι ΤΙΤΛΟΣ Ι. Άρθρο Ι-1. Ίδρυση της Ένωσης. Άρθρο Ι-2. Οι αξίες της Ένωσης

ΜΕΡΟΣ Ι ΤΙΤΛΟΣ Ι. Άρθρο Ι-1. Ίδρυση της Ένωσης. Άρθρο Ι-2. Οι αξίες της Ένωσης 16.12.2004 EL Επίσημη Εφημερίδα της Ευρωπαϊκής Ένωσης C 310/11 ΜΕΡΟΣ Ι ΤΙΤΛΟΣ Ι ΟΡΙΣΜΟΣ ΚΑΙ ΣΤΟΧΟΙ ΤΗΣ ΕΝΩΣΗΣ Άρθρο Ι-1 Ίδρυση της Ένωσης 1. Εκφράζοντας τη βούληση των πολιτών και των κρατών της Ευρώπης

Διαβάστε περισσότερα

ΚΑΤΑΣΤΑΤΙΚΟ Του Συλλόγου με την επωνυμία ΠΑΝΕΛΛΗΝΙΑ ΕΝΩΣΗ ΦΙΛΩΝ ΤΟΙΧΟΣΦΑΙΡΙΣΗΣ

ΚΑΤΑΣΤΑΤΙΚΟ Του Συλλόγου με την επωνυμία ΠΑΝΕΛΛΗΝΙΑ ΕΝΩΣΗ ΦΙΛΩΝ ΤΟΙΧΟΣΦΑΙΡΙΣΗΣ ΚΑΤΑΣΤΑΤΙΚΟ Του Συλλόγου με την επωνυμία ΠΑΝΕΛΛΗΝΙΑ ΕΝΩΣΗ ΦΙΛΩΝ ΤΟΙΧΟΣΦΑΙΡΙΣΗΣ ΚΕΦΑΛΑΙΟ Α Επωνυμία- Έδρα- Σκοπός-Πόροι ΑΡΘΡΟ 1 Ιδρύεται Σωματείο με την επωνυμία «Πανελλήνια Ένωση Φίλων Τοιχοσφαίρισης»

Διαβάστε περισσότερα

Ενότητα 2. Γενικά Οργάνωση Ελέγχου (ΙΙ) Φύλλα Εργασίας Εκθέσεις Ελέγχων

Ενότητα 2. Γενικά Οργάνωση Ελέγχου (ΙΙ) Φύλλα Εργασίας Εκθέσεις Ελέγχων Ενότητα 2 Γενικά Οργάνωση Ελέγχου (ΙΙ) Φύλλα Εργασίας Εκθέσεις Ελέγχων Φύλλα Εργασίας (Γενικά) Με τον όρο "φύλλα εργασίας" εννοούµε, το σύνολο των φύλλων που περιέχουν όλο το αποδεικτικό υλικό, το οποίο

Διαβάστε περισσότερα

Όλα όσα πρέπει να γνωρίζουν οι απόφοιτοι των ΕΠΑΛ για τις πανελλαδικές εξετάσεις

Όλα όσα πρέπει να γνωρίζουν οι απόφοιτοι των ΕΠΑΛ για τις πανελλαδικές εξετάσεις Όλα όσα πρέπει να γνωρίζουν οι απόφοιτοι των ΕΠΑΛ για τις πανελλαδικές εξετάσεις Oι κάτοχοι απολυτηρίου Ημερησίων ΕΠΑ.Λ. (ΟΜΑΔΑ Α ) καθώς και οι μαθητές της τελευταίας τάξης Ημερησίων ΕΠΑ.Λ. (ΟΜΑΔΑ Α )

Διαβάστε περισσότερα

ΓΕΩΡΓΙΟΣ κ ΝΙΚΟΛΑΟΣ ΑΣΚΟΥΝΗΣ Ο.Ε. ΡΗΓΑ ΦΕΡΑΙΟΥ 178-180, ΠΑΤΡΑ, ΤΗΛ. -FAX: 2610 336537, 327220 Αρ. Πρωτ.Askounis:2246.

ΓΕΩΡΓΙΟΣ κ ΝΙΚΟΛΑΟΣ ΑΣΚΟΥΝΗΣ Ο.Ε. ΡΗΓΑ ΦΕΡΑΙΟΥ 178-180, ΠΑΤΡΑ, ΤΗΛ. -FAX: 2610 336537, 327220 Αρ. Πρωτ.Askounis:2246. ΓΕΩΡΓΙΟΣ κ ΝΙΚΟΛΑΟΣ ΑΣΚΟΥΝΗΣ Ο.Ε. ΡΗΓΑ ΦΕΡΑΙΟΥ 178-180, ΠΑΤΡΑ, ΤΗΛ. -FAX: 2610 336537, 327220 Αρ. Πρωτ.Askounis:2246 ΠΑΤΡΑ 22/12/2009 ΠΡΟΣ τον Πανελλήνιο Σύνδεσµο Ανωνύµων Τεχνικών Εταιρειών & Ε.Π.Ε Φειδίου

Διαβάστε περισσότερα

Σέρρες 11.5.2015 Αριθ. Πρωτ.: 1387

Σέρρες 11.5.2015 Αριθ. Πρωτ.: 1387 ΕΛΛΗΝΙΚΗ ΗΜΟΚΡΑΤΙΑ TEΧΝΟΛΟΓΙΚΟ ΕΚΠΑΙ ΕΥΤΙΚΟ Ι ΡΥΜΑ ΚΕΝΤΡΙΚΗΣ ΜΑΚΕ ΟΝΙΑΣ ΤΕΡΜΑ ΜΑΓΝΗΣΙΑΣ - 614 ΣΕΡΡΕΣ ΠΡΟΚΗΡΥΞΗ Σέρρες 11.5.015 Αριθ. Πρωτ.: 1387 ΠΡΟΣΛΗΨΗΣ ΕΠΙΣΤΗΜΟΝΙΚΩΝ ΣΥΝΕΡΓΑΤΩΝ, ΕΡΓΑΣΤΗΡΙΑΚΩΝ ΣΥΝΕΡΓΑΤΩΝ,

Διαβάστε περισσότερα

ΠΡΟΤΥΠΟ ΠΕΙΡΑΜΑΤΙΚΟ ΔΗΜΟΤΙΚΟ ΣΧΟΛΕΙΟ ΦΛΩΡΙΝΑΣ ΠΡΟΓΡΑΜΜΑ ΑΓΩΓΗΣ ΥΓΕΙΑΣ

ΠΡΟΤΥΠΟ ΠΕΙΡΑΜΑΤΙΚΟ ΔΗΜΟΤΙΚΟ ΣΧΟΛΕΙΟ ΦΛΩΡΙΝΑΣ ΠΡΟΓΡΑΜΜΑ ΑΓΩΓΗΣ ΥΓΕΙΑΣ ΠΡΟΤΥΠΟ ΠΕΙΡΑΜΑΤΙΚΟ ΔΗΜΟΤΙΚΟ ΣΧΟΛΕΙΟ ΦΛΩΡΙΝΑΣ ΠΡΟΓΡΑΜΜΑ ΑΓΩΓΗΣ ΥΓΕΙΑΣ Τίτλος προγράμματος: «Ανάπτυξη της αυτοεκτίμησης» Τάξη: Α Εκπαιδευτικός: Βασιλική Αντωνογιάννη Σχολικό έτος: 2013-14 Σύνολο μαθητών

Διαβάστε περισσότερα

ΘΕΜΑ; "Το συν/γιια ως μέσον διεθνούς πληρωμής" ΣΠΟΥΔΑΣΤΡΙΑ: ΚΟΝΣΤΑΝΤΙΝΙΑΟΥ ΑΓΑΠΗ ΕΠΙΒΛΕΠΟΝ ΚΑΘΗΓΗΤΗΣ: ΠΙΠΙΑΙΑΓΚΟΠΟΥΛΟΣ ΜΙΧΑΑΗΣ

ΘΕΜΑ; Το συν/γιια ως μέσον διεθνούς πληρωμής ΣΠΟΥΔΑΣΤΡΙΑ: ΚΟΝΣΤΑΝΤΙΝΙΑΟΥ ΑΓΑΠΗ ΕΠΙΒΛΕΠΟΝ ΚΑΘΗΓΗΤΗΣ: ΠΙΠΙΑΙΑΓΚΟΠΟΥΛΟΣ ΜΙΧΑΑΗΣ T.E.l. ΚΑΒΑΛΑΣ ΣΧΟΛΗ ΛΙΟίΚΗΣΗΣ ΚΑΙ ΟΙΚΟΝΟ ΜΙΑΣ ΤΜΗΜΑ ΛΟΓΙΣΤΙΚΗΣ ΠΤΥΧΙΑΚΗ ΕΡΓΑΣΙΑ ΘΕΜΑ; "Το συν/γιια ως μέσον διεθνούς πληρωμής" ΣΠΟΥΔΑΣΤΡΙΑ: ΚΟΝΣΤΑΝΤΙΝΙΑΟΥ ΑΓΑΠΗ ΕΠΙΒΛΕΠΟΝ ΚΑΘΗΓΗΤΗΣ: ΠΙΠΙΑΙΑΓΚΟΠΟΥΛΟΣ ΜΙΧΑΑΗΣ

Διαβάστε περισσότερα

ΕΛΛΗΝΙΚΗ ΟΜΟΣΠΟΝΔΙΑ ΚΑΡΑΤΕ

ΕΛΛΗΝΙΚΗ ΟΜΟΣΠΟΝΔΙΑ ΚΑΡΑΤΕ ΕΛΛΗΝΙΚΗ ΟΜΟΣΠΟΝΔΙΑ ΚΑΡΑΤΕ ΕΣΩΤΕΡΙΚΟΣ ΚΑΝΟΝΙΣΜΟΣ ΚΕΦΑΛΑΙΟ Α - ΘΕΜΕΛΙΩΔΕΙΣ ΔΙΑΤΑΞΕΙΣ 1. Η σύνταξη του παρόντος κανονισμού βασίζεται στις διατάξεις της ελληνικής νομοθεσίας και ιδίως του Νόμου 2725/1999

Διαβάστε περισσότερα

Καλζσ Πρακτικζσ ςτην Προςχολική Εκπαίδευςη ΙIΙ.A

Καλζσ Πρακτικζσ ςτην Προςχολική Εκπαίδευςη ΙIΙ.A ΤΠΟΤΡΓΕΙΟ ΠΑΙΔΕΙΑ ΘΡΗΚΕΤΜΑΣΩΝ ΠΟΛΙΣΙΜΟΤ ΚΑΙ ΑΘΛΗΣΙΜΟΤ ΙΝΣΙΣΟΤΣΟ ΕΚΠΑΙΔΕΤΣΙΚΗ ΠΟΛΙΣΙΚΗ Αξιολόγηςη του Εκπαιδευτικοφ Ζργου ςτη χολική Μονάδα Διαδικαςία Αυτοαξιολόγηςησ Καλζσ Πρακτικζσ ςτην Προςχολική Εκπαίδευςη

Διαβάστε περισσότερα

YΠΟΥΡΓΕΙΟ ΠΑΙ ΕΙΑΣ ΚΑΙ ΠΟΛΙΤΙΣΜΟΥ ΙΕΥΘΥΝΣΗ ΑΝΩΤΕΡΗΣ ΚΑΙ ΑΝΩΤΑΤΗΣ ΕΚΠΑΙ ΕΥΣΗΣ ΥΠΗΡΕΣΙΑ ΕΞΕΤΑΣΕΩΝ

YΠΟΥΡΓΕΙΟ ΠΑΙ ΕΙΑΣ ΚΑΙ ΠΟΛΙΤΙΣΜΟΥ ΙΕΥΘΥΝΣΗ ΑΝΩΤΕΡΗΣ ΚΑΙ ΑΝΩΤΑΤΗΣ ΕΚΠΑΙ ΕΥΣΗΣ ΥΠΗΡΕΣΙΑ ΕΞΕΤΑΣΕΩΝ YΠΟΥΡΓΕΙΟ ΠΑΙ ΕΙΑΣ ΚΑΙ ΠΟΛΙΤΙΣΜΟΥ ΙΕΥΘΥΝΣΗ ΑΝΩΤΕΡΗΣ ΚΑΙ ΑΝΩΤΑΤΗΣ ΕΚΠΑΙ ΕΥΣΗΣ ΥΠΗΡΕΣΙΑ ΕΞΕΤΑΣΕΩΝ ΕΞΕΤΑΣΕΙΣ ΓΙΑ ΤΑ ΑΝΩΤΕΡΑ ΚΑΙ ΑΝΩΤΑΤΑ ΕΚΠΑΙ ΕΥΤΙΚΑ Ι ΡΥΜΑΤΑ Μάθηµα: ΒΙΟΛΟΓΙΑ - ΠΡΟΤΕΙΝΟΜΕΝΕΣ ΛΥΣΕΙΣ Ηµεροµηνία

Διαβάστε περισσότερα

ΚΕΦΑΛΑΙΟ 9 ΑΞΙΟΛΟΓΗΣΗ ΕΦΑΡΜΟΓΗΣ «ΕΝΑ ΟΝΕΙΡΙΚΟ ΤΑΞΙΔΙ ΣΤΗΝ ΚΝΩΣΟ» - ΠΕΡΙΓΡΑΦΗ ΔΙΑΔΙΚΑΣΙΑΣ ΚΑΙ ΑΝΑΛΥΣΗ ΑΠΟΤΕΛΕΣΜΑΤΩΝ

ΚΕΦΑΛΑΙΟ 9 ΑΞΙΟΛΟΓΗΣΗ ΕΦΑΡΜΟΓΗΣ «ΕΝΑ ΟΝΕΙΡΙΚΟ ΤΑΞΙΔΙ ΣΤΗΝ ΚΝΩΣΟ» - ΠΕΡΙΓΡΑΦΗ ΔΙΑΔΙΚΑΣΙΑΣ ΚΑΙ ΑΝΑΛΥΣΗ ΑΠΟΤΕΛΕΣΜΑΤΩΝ ΚΕΦΑΛΑΙΟ 9 ΑΞΙΟΛΟΓΗΣΗ ΕΦΑΡΜΟΓΗΣ «ΕΝΑ ΟΝΕΙΡΙΚΟ ΤΑΞΙΔΙ ΣΤΗΝ ΚΝΩΣΟ» - ΠΕΡΙΓΡΑΦΗ ΔΙΑΔΙΚΑΣΙΑΣ ΚΑΙ ΑΝΑΛΥΣΗ ΑΠΟΤΕΛΕΣΜΑΤΩΝ 9.1 Επιλογή δείγµατος Το λογισµικό «Ένα ονειρικό ταξίδι στην Κνωσό» δοκιµάστηκε και αξιολογήθηκε

Διαβάστε περισσότερα

ΚΥΠΡΙΑΚΗ ΔΗΜΟΚΡΑΤΙΑ. Αρ.Φακ.: 7.11.15.10 Αρ.Τηλ.: 22809543 Αρ.Φαξ:22800802 e-mail:oloimero@schools.ac.cy. 2 Σεπτεμβρίου 2010

ΚΥΠΡΙΑΚΗ ΔΗΜΟΚΡΑΤΙΑ. Αρ.Φακ.: 7.11.15.10 Αρ.Τηλ.: 22809543 Αρ.Φαξ:22800802 e-mail:oloimero@schools.ac.cy. 2 Σεπτεμβρίου 2010 ΚΥΠΡΙΑΚΗ ΔΗΜΟΚΡΑΤΙΑ ΥΠΟΥΡΓΕΙΟ ΠΑΙΔΕΙΑΣ ΚΑΙ ΠΟΛΙΤΙΣΜΟΥ ΔΙΕΥΘΥΝΣΗ ΔΗΜΟΤΙΚΗΣ ΕΚΠΑΙΔΕΥΣΗΣ Αρ.Φακ.: 7.11.15.10 Αρ.Τηλ.: 22809543 Αρ.Φαξ:22800802 e-mail:oloimero@schools.ac.cy 2 Σεπτεμβρίου 2010 Διευθυντή/ντρια

Διαβάστε περισσότερα

ΕΓΚΥΚΛΙΟΣ ΓΙΑ ΤΗΝ ΕΦΑΡΜΟΓΗ ΤΟΥ Ν. 3481/2006

ΕΓΚΥΚΛΙΟΣ ΓΙΑ ΤΗΝ ΕΦΑΡΜΟΓΗ ΤΟΥ Ν. 3481/2006 ΕΓΚΥΚΛΙΟΣ ΓΙΑ ΤΗΝ ΕΦΑΡΜΟΓΗ ΤΟΥ Ν. 3481/2006 Με τις διατάξεις του άρθρου 2 του ν. 3481/2006 (ΦΕΚ τ. Α 162/2-8-2006) τροποποιήθηκε και συµπληρώθηκε ο νόµος 2664/1998 για το Εθνικό Κτηµατολόγιο, όπως έχει

Διαβάστε περισσότερα

ΠΕΡΙΕΧΟΜΕΝΑ Α. ΕΝΑΡΞΗ ΕΡΓΩΝ

ΠΕΡΙΕΧΟΜΕΝΑ Α. ΕΝΑΡΞΗ ΕΡΓΩΝ ΕΘΝΙΚΟ ΣΤΡΑΤΗΓΙΚΟ ΠΛΑΙΣΙΟ ΑΝΑΦΟΡΑΣ 2007-2013 ΕΠΙΧΕΙΡΗΣΙΑΚΟ ΠΡΟΓΡΑΜΜΑ «ΑΝΤΑΓΩΝΙΣΤΙΚΟΤΗΤΑ ΚΑΙ ΕΠΙΧΕΙΡΗΜΑΤΙΚΟΤΗΤΑ»2007-2013 (ΕΠΑΝ ΙΙ) ΠΡΟΓΡΑΜΜΑ «ΜΕΤΑΠΟΙΗΣΗ ΣΤΙΣ ΝΕΕΣ ΣΥΝΘΗΚΕΣ» ΕΓΧΕΙΡΙΔΙΟ ΥΛΟΠΟΙΗΣΗΣ ΕΠΕΝΔΥΣΗΣ

Διαβάστε περισσότερα

ΟΡΓΑΝΙΣΜΟΣ ΕΛΛΗΝΙΚΩΝ. Αθήνα, 28/11/01 Αριθ. Πρωτ. : 16021 ΑΣΦΑΛΙΣΕΩΝ

ΟΡΓΑΝΙΣΜΟΣ ΕΛΛΗΝΙΚΩΝ. Αθήνα, 28/11/01 Αριθ. Πρωτ. : 16021 ΑΣΦΑΛΙΣΕΩΝ ΟΡΓΑΝΙΣΜΟΣ ΕΛΛΗΝΙΚΩΝ ΓΕΩΡΓΙΚΩΝ ΑΣΦΑΛΙΣΕΩΝ Αθήνα, 28/11/01 Αριθ. Πρωτ. : 16021 ιεύθυνση Εκτιµήσεων & Αποζηµιώσεων Πληροφορίες : Χ. Γάσπαρη Α. Συγγούνας Μεσογείων 45 11510 ΑΘΗΝΑ Τηλ : 010-7490449-441, fax

Διαβάστε περισσότερα

ΠΙΝΑΚΑΣ 3 της ΚΥΑ 69269/5387/1990 (ΦΕΚ 678 Β'/90)

ΠΙΝΑΚΑΣ 3 της ΚΥΑ 69269/5387/1990 (ΦΕΚ 678 Β'/90) ΠΙΝΑΚΑΣ 3 της ΚΥΑ 69269/5387/1990 (ΦΕΚ 678 Β'/90) Ι. - Ονομασία και είδος του έργου ή της δραστηριότητας. Τύπος Υδροληψίας (π.χ.υδρογεώτρηση ή Πηγάδι ή Απόληψη από ποτάμι κτλ).. στην τοποθεσία της Τοπικής

Διαβάστε περισσότερα

Μετάφραση των πρωτότυπων οδηγιών χρήσης. Εγγύηση 2 ετών W 670 GR

Μετάφραση των πρωτότυπων οδηγιών χρήσης. Εγγύηση 2 ετών W 670 GR Μετάφραση των πρωτότυπων οδηγιών χρήσης Εγγύηση 2 ετών 1 9 8 7 6 5 4 3 10 1/2 16 17 11/12 15 13 18 14 2 3 4 α A β B 5 6 7 1 2 8 9 a b 10 11 14 15 16 12 20 13 a 4 3 b 14 5 19 4 3 2 1 8 2 3 4 6 7 C 13 14

Διαβάστε περισσότερα

Α. ΓΕΝΙΚΑ Β. ΣΤΟΧΟΙ ΤΗΣ ΠΟΛΙΤΙΚΗΣ

Α. ΓΕΝΙΚΑ Β. ΣΤΟΧΟΙ ΤΗΣ ΠΟΛΙΤΙΚΗΣ Πολιτική Παροχής Φιλοξενίας σε ξένες αθλητικές ομάδες, ομίλους και συνδέσμους για προπόνηση και προετοιμασία στην Κύπρο στα πλαίσια των κανονισμών της Ευρωπαϊκής Ένωσης για τις ενισχύσεις ήσσονος σημασίας

Διαβάστε περισσότερα

ΑΠΟΦΑΣΗ. Η Εθνική Επιτροπή Τηλεπικοινωνιών και Ταχυδρομείων (ΕΕΤΤ),

ΑΠΟΦΑΣΗ. Η Εθνική Επιτροπή Τηλεπικοινωνιών και Ταχυδρομείων (ΕΕΤΤ), Μαρούσι, 23-6-2009 ΑΡΙΘ. ΑΠ.: 528/075 ΑΠΟΦΑΣΗ Κανονισμός Καθορισμού των Τελών Διέλευσης, των Τελών Χρήσης Δικαιωμάτων Διέλευσης και του Ύψους των Εγγυήσεων Καλής Εκτέλεσης των Εργασιών Διέλευσης για όλη

Διαβάστε περισσότερα

Επίσηµη Εφηµερίδα αριθ. L335 της 19/12/2001 σ. 0015-0020 ΤΟ ΣΥΜΒΟΥΛΙΟ ΤΗΣ ΕΥΡΩΠΑΪΚΗΣ ΕΝΩΣΗΣ,

Επίσηµη Εφηµερίδα αριθ. L335 της 19/12/2001 σ. 0015-0020 ΤΟ ΣΥΜΒΟΥΛΙΟ ΤΗΣ ΕΥΡΩΠΑΪΚΗΣ ΕΝΩΣΗΣ, Επίσηµη Εφηµερίδα αριθ. L335 της 19/12/2001 σ. 0015-0020 Απόφαση του Συµβουλίου της 3ης εκεµβρίου 2001 για το ευρωπαϊκό έτος των ατόµων µε ειδικές ανάγκες 2003 (2001/903/ΕΚ) ΤΟ ΣΥΜΒΟΥΛΙΟ ΤΗΣ ΕΥΡΩΠΑΪΚΗΣ

Διαβάστε περισσότερα

KΕΦΑΛΑΙΟ 105 Ο ΠΕΡΙ ΑΛΛΟ ΑΠΩΝ ΚΑΙ ΜΕΤΑΝΑΣΤΕΥΣΕΩΣ ΝΟΜΟΣ

KΕΦΑΛΑΙΟ 105 Ο ΠΕΡΙ ΑΛΛΟ ΑΠΩΝ ΚΑΙ ΜΕΤΑΝΑΣΤΕΥΣΕΩΣ ΝΟΜΟΣ KΕΦΑΛΑΙΟ 105 Ο ΠΕΡΙ ΑΛΛΟ ΑΠΩΝ ΚΑΙ ΜΕΤΑΝΑΣΤΕΥΣΕΩΣ ΝΟΜΟΣ ΚΑΤΑΤΑΞΗ ΑΡΘΡΩΝ Άρθρα 1. Συνοπτικός τίτλος 2. Ερµηνεία 3. Εγκριµένα λιµάνια 4. ιευθυντής 5. ιευθυντής έχει εξουσίες αστυνοµικού 6. Απαγορευµένοι µετανάστες

Διαβάστε περισσότερα

ΠΕΡΙΕΧΟΜΕΝΑ ΚΕΦΑΛΑΙΟ 7

ΠΕΡΙΕΧΟΜΕΝΑ ΚΕΦΑΛΑΙΟ 7 ΠΕΡΙΕΧΟΜΕΝΑ Αφιέρωση... 7 Εισαγωγή... 8 ΚΕΦΑΛΑΙΟ 1 Τι θα κερδίσετε από αυτό το βιβλίο... 9 ΚΕΦΑΛΑΙΟ 2 Ανάληψη των ευθυνών σας... 13 ΚΕΦΑΛΑΙΟ 3 Όλα ερείπια: το ψάξιμο στα συντρίμμια... 19 ΚΕΦΑΛΑΙΟ 4 Αναγκαστική

Διαβάστε περισσότερα

ΚΥΠΡΙΑΚΗ ΔΗΜΟΚΡΑΤΙΑ ΥΠΟΥΡΓΕΙΟ ΠΑΙΔΕΙΑΣ ΚΑΙ ΠΟΛΙΤΙΣΜΟΥ

ΚΥΠΡΙΑΚΗ ΔΗΜΟΚΡΑΤΙΑ ΥΠΟΥΡΓΕΙΟ ΠΑΙΔΕΙΑΣ ΚΑΙ ΠΟΛΙΤΙΣΜΟΥ ΚΥΠΡΙΑΚΗ ΔΗΜΟΚΡΑΤΙΑ ΥΠΟΥΡΓΕΙΟ ΠΑΙΔΕΙΑΣ ΚΑΙ ΠΟΛΙΤΙΣΜΟΥ Για Επίσημη Χρήση Κοινωνοικονομικά μόρια.. Μόρια απόστασης Συνολικά: Για Επίσημη Χρήση Αρ. Αίτησης:. Όν. Παρ.:. Ημερ. Παραλαβής: / /2011 ΑΙΤΗΣΗ για

Διαβάστε περισσότερα

(ΜΕ ΤΑ ΔΥΟ ΜΕΙΟΝΕΚΤΗΜΑΤΑ)

(ΜΕ ΤΑ ΔΥΟ ΜΕΙΟΝΕΚΤΗΜΑΤΑ) 1 ΤΟ ΒΙΒΛΙΟ ΤΩΝ ΠΟΝΩΝ ΤΟΥ ΣΩΜΑΤΟΣ (ΜΕ ΤΑ ΔΥΟ ΜΕΙΟΝΕΚΤΗΜΑΤΑ) Η πραγματικότητα ξεπερνά και την πιο τολμηρή φαντασία. Επίκτητος Σοφός δεν είναι όποιος ξέρει πολλά, αλλά όποιος ξέρει χρήσιμα. Ηράκλειτος Οι

Διαβάστε περισσότερα

ΕΜΠΕΔΩΣΗ ΒΑΣΙΚΕΣ ΑΡΧΕΣ ΚΑΛΕΣ ΠΡΑΚΤΙΚΕΣ. Δρ Μάριος Στυλιανίδης, ΕΔΕ

ΕΜΠΕΔΩΣΗ ΒΑΣΙΚΕΣ ΑΡΧΕΣ ΚΑΛΕΣ ΠΡΑΚΤΙΚΕΣ. Δρ Μάριος Στυλιανίδης, ΕΔΕ ΕΜΠΕΔΩΣΗ ΒΑΣΙΚΕΣ ΑΡΧΕΣ ΚΑΛΕΣ ΠΡΑΚΤΙΚΕΣ Δρ Μάριος Στυλιανίδης, ΕΔΕ Δομή Συνάντησης 1 Εμπέδωση Βασικές αρχές 2 3 Πλαίσιο οργάνωσης Διαχείρισης τάξης Καλές πρακτικές 4 Εργαστήρια καλών πρακτικών 1. Εμπέδωση

Διαβάστε περισσότερα

ΥΠ.Ε.Π.Θ. / ΠΑΙ ΑΓΩΓΙΚΟ ΙΝΣΤΙΤΟΥΤΟ ΕΠΙΧΕΙΡΗΣΙΑΚΟ ΠΡΟΓΡΑΜΜΑ «ΚΟΙΝΩΝΙΑ ΤΗΣ ΠΛΗΡΟΦΟΡΙΑΣ»

ΥΠ.Ε.Π.Θ. / ΠΑΙ ΑΓΩΓΙΚΟ ΙΝΣΤΙΤΟΥΤΟ ΕΠΙΧΕΙΡΗΣΙΑΚΟ ΠΡΟΓΡΑΜΜΑ «ΚΟΙΝΩΝΙΑ ΤΗΣ ΠΛΗΡΟΦΟΡΙΑΣ» ΥΠ.Ε.Π.Θ. / ΠΑΙ ΑΓΩΓΙΚΟ ΙΝΣΤΙΤΟΥΤΟ ΕΠΙΧΕΙΡΗΣΙΑΚΟ ΠΡΟΓΡΑΜΜΑ «ΚΟΙΝΩΝΙΑ ΤΗΣ ΠΛΗΡΟΦΟΡΙΑΣ» Γ ΚΟΙΝΟΤΙΚΟ ΠΛΑΙΣΙΟ ΣΤΗΡΙΞΗΣ ΕΡΓO ΣΥΓΧΡΗΜΑΤΟ ΟΤΟΥΜΕΝO ΚΑΤΑ 80% ΑΠΟ ΤΟ ΕΚΤ ΚΑΙ ΚΑΤΑ 20% ΑΠΟ ΕΘΝΙΚΟΥΣ ΠΟΡΟΥΣ «Ολοκληρωµένη

Διαβάστε περισσότερα

ΑΔΑ: Β4Λ3ΩΗΑ-5ΕΝ ΑΝΑΡΤΗΤΕΑ ΣΤΟ ΙΑ ΙΚΤΥΟ

ΑΔΑ: Β4Λ3ΩΗΑ-5ΕΝ ΑΝΑΡΤΗΤΕΑ ΣΤΟ ΙΑ ΙΚΤΥΟ ΕΛΛΗΝΙΚΗ ΗΜΟΚΡΑΤΙΑ Χαλκίδα Αριθµ.Πρωτ. :44650 ΗΜΟΣ ΧΑΛΚΙ ΕΩΝ ΟΙΚΟΝΟΜΙΚΗ ΕΠΙΤΡΟΠΗ ΑΠΟΣΠΑΣΜΑ Αριθ.Αποφ. 212/2012 Από το Πρακτικό της 25ης/2012 Συνεδρίασης της Οικονοµικής Επιτροπής του ήµου Χαλκιδέων Στην

Διαβάστε περισσότερα

ΥΠΟΥΡΓΕΙΟ ΠΑΙΔΕΙΑΣ ΚΑΙ ΠΟΛΙΤΙΣΜΟΥ ΔΙΕΥΘΥΝΣΗ ΜΕΣΗΣ ΕΚΠΑΙΔΕΥΣΗΣ ΚΡΑΤΙΚΑ ΙΝΣΤΙΤΟΥΤΑ ΕΠΙΜΟΡΦΩΣΗΣ

ΥΠΟΥΡΓΕΙΟ ΠΑΙΔΕΙΑΣ ΚΑΙ ΠΟΛΙΤΙΣΜΟΥ ΔΙΕΥΘΥΝΣΗ ΜΕΣΗΣ ΕΚΠΑΙΔΕΥΣΗΣ ΚΡΑΤΙΚΑ ΙΝΣΤΙΤΟΥΤΑ ΕΠΙΜΟΡΦΩΣΗΣ ΥΠΟΥΡΓΕΙΟ ΠΑΙΔΕΙΑΣ ΚΑΙ ΠΟΛΙΤΙΣΜΟΥ ΔΙΕΥΘΥΝΣΗ ΜΕΣΗΣ ΕΚΠΑΙΔΕΥΣΗΣ ΚΡΑΤΙΚΑ ΙΝΣΤΙΤΟΥΤΑ ΕΠΙΜΟΡΦΩΣΗΣ ΤΕΛΙΚΕΣ ΕΝΙΑΙΕΣ ΓΡΑΠΤΕΣ ΕΞΕΤΑΣΕΙΣ ΣΧΟΛΙΚΗ ΧΡΟΝΙΑ 2011-2012 Μάθημα: Ελληνικά Επίπεδο: 2 Διάρκεια: 2 ώρες Ημερομηνία:

Διαβάστε περισσότερα

ΕΣΩΤΕΡΙΚΟΙ ΚΑΝΟΝΙΣΜΟΙ ΛΕΙΤΟΥΡΓΙΑΣ ΤΗΣ ΣΧΟΛΗΣ

ΕΣΩΤΕΡΙΚΟΙ ΚΑΝΟΝΙΣΜΟΙ ΛΕΙΤΟΥΡΓΙΑΣ ΤΗΣ ΣΧΟΛΗΣ ΕΣΩΤΕΡΙΚΟΙ ΚΑΝΟΝΙΣΜΟΙ ΛΕΙΤΟΥΡΓΙΑΣ ΤΗΣ ΣΧΟΛΗΣ ΚΑΝΟΝΙΣΜΟΣ Ο κανονισμός 14 των Κανονισμών Λειτουργίας Δημοσίων Σχολείων Μέσης Εκπαίδευσης 311/2005 αναφέρεται επί λέξει: Κάθε σχολική μονάδα διαμορφώνει με

Διαβάστε περισσότερα

ΣΥΛΛΟΓΙΚΗ ΣΥΜΒΑΣΗ ΕΡΓΑΣΙΑΣ. «Για τους όρους αµοιβής και εργασίας των καθηγητών ιδιωτικών τεχνικών και επαγγελµατικών εκπαιδευτηρίων όλης της χώρας»

ΣΥΛΛΟΓΙΚΗ ΣΥΜΒΑΣΗ ΕΡΓΑΣΙΑΣ. «Για τους όρους αµοιβής και εργασίας των καθηγητών ιδιωτικών τεχνικών και επαγγελµατικών εκπαιδευτηρίων όλης της χώρας» ΣΥΛΛΟΓΙΚΗ ΣΥΜΒΑΣΗ ΕΡΓΑΣΙΑΣ «Για τους όρους αµοιβής και εργασίας των καθηγητών ιδιωτικών τεχνικών και επαγγελµατικών εκπαιδευτηρίων όλης της χώρας» Στην Αθήνα σήµερα 20.11.2002, και στα γραφεία του Ο.ΜΕ..,

Διαβάστε περισσότερα

ΤΟ ΣΥΝΤΑΓΜΑ ΤΟΥ 1844. Εξώφυλλο του Συντάγµατος του 1844 (Βιβλιοθήκη Βουλής των

ΤΟ ΣΥΝΤΑΓΜΑ ΤΟΥ 1844. Εξώφυλλο του Συντάγµατος του 1844 (Βιβλιοθήκη Βουλής των ΤΟ ΣΥΝΤΑΓΜΑ ΤΟΥ 1844 Το Σύνταγµα του 1844 αποτελείται από 107 άρθρα, κατανεµηµένα στα εξής δώδεκα µέρη: Περί Θρησκείας, Περί του δηµοσίου δικαίου των Ελλήνων, Περί συντάξεως της πολιτείας, Περί του Βασιλέως,

Διαβάστε περισσότερα

Κώδικας. ιαχείρισης του Συστήµατος. και. Συναλλαγών Ηλεκτρικής. Ενέργειας

Κώδικας. ιαχείρισης του Συστήµατος. και. Συναλλαγών Ηλεκτρικής. Ενέργειας Κώδικας ιαχείρισης του Συστήµατος και Συναλλαγών Ηλεκτρικής Ενέργειας Ανεπίσηµη έκδοση Φεβρουαρίου 2008, βάσει της απόφασης του Υπουργού Ανάπτυξης για την έγκρισή του ( 5-ΗΛ/Β/οικ./8311/09-05-2005 - ΦΕΚ

Διαβάστε περισσότερα

Αφήγηση. Βασικά στοιχεία αφηγηµατικού κειµένου:

Αφήγηση. Βασικά στοιχεία αφηγηµατικού κειµένου: Αφήγηση Αφήγηση µιας ιστορίας έχουµε όταν παρουσιάζουµε γεγονότα µε µια ορισµένη σειρά. Τα γεγονότα µπορεί να είναι πραγµατικά ή φανταστικά. Η αφήγηση µπορεί να είναι προφορική ή γραπτή. Όταν η αφήγηση

Διαβάστε περισσότερα

Ενιαιο Σύστημα Κοινωνικης Ασφαλειας- Εθνικο Σύστημα Κοινωνικης Ασφαλισης ΑΠΟΣΠΑΣΜΑ ΑΠΟ ΤΟ ΠΡΟΣΧΕΔΙΟ ΝΟΜΟΥ ΔΙΑΤΑΞΕΙΣ ΠΟΥ ΜΑΣ ΑΦΟΡΟΥΝ

Ενιαιο Σύστημα Κοινωνικης Ασφαλειας- Εθνικο Σύστημα Κοινωνικης Ασφαλισης ΑΠΟΣΠΑΣΜΑ ΑΠΟ ΤΟ ΠΡΟΣΧΕΔΙΟ ΝΟΜΟΥ ΔΙΑΤΑΞΕΙΣ ΠΟΥ ΜΑΣ ΑΦΟΡΟΥΝ Ενιαιο Σύστημα Κοινωνικης Ασφαλειας- Εθνικο Σύστημα Κοινωνικης Ασφαλισης ΑΠΟΣΠΑΣΜΑ ΑΠΟ ΤΟ ΠΡΟΣΧΕΔΙΟ ΝΟΜΟΥ ΔΙΑΤΑΞΕΙΣ ΠΟΥ ΜΑΣ ΑΦΟΡΟΥΝ 1 Κεφάλαιο Α Αρχές και όργανα του Ενιαίου Συστήματος Κοινωνικής Ασφάλειας

Διαβάστε περισσότερα

1 Επιμέλεια: Κατερίνα Κούρτη, Υιλόλογος

1 Επιμέλεια: Κατερίνα Κούρτη, Υιλόλογος ΞΕΝΟΥΩΝΣΟ ΕΛΛΗΝΙΚΑ ΒΙΒΛΙΟ 2. ΚΕΥΑΛΑΙΟ 1 27-29 Πραγματολογικά σχόλια Κόνων: Αθηναίος στρατηγός που έδρασε στο τέλος του 5ου και τις αρχές του 4ου αι. π.χ. και ο οποίος συνέβαλε με τις ενέργειές του στο

Διαβάστε περισσότερα

ΕΛΛΗΝΙΚΗ ΔΗΜΟΚΡΑΤΙΑ- ΠΕΡΙΦΕΡΕΙΑ ΑΤΤΙΚΗΣ ΑΝΑΠΤΥΞΙΑΚΟΣ ΣΥΝΔΕΣΜΟΣ ΔΥΤΙΚΗΣ ΑΘΗΝΑΣ

ΕΛΛΗΝΙΚΗ ΔΗΜΟΚΡΑΤΙΑ- ΠΕΡΙΦΕΡΕΙΑ ΑΤΤΙΚΗΣ ΑΝΑΠΤΥΞΙΑΚΟΣ ΣΥΝΔΕΣΜΟΣ ΔΥΤΙΚΗΣ ΑΘΗΝΑΣ ΕΛΛΗΝΙΚΗ ΔΗΜΟΚΡΑΤΙΑ- ΠΕΡΙΦΕΡΕΙΑ ΑΤΤΙΚΗΣ ΑΝΑΠΤΥΞΙΑΚΟΣ ΣΥΝΔΕΣΜΟΣ ΔΥΤΙΚΗΣ ΑΘΗΝΑΣ ΕΘΝΙΚΗΣ ΑΝΤΙΣΤΑΣΕΩΣ 65, 121 34 ΠΕΡΙΣΤΕΡΙ ΤΗΛ. 210 5745826, 210 5762434, FAX 210 5759547 http://www.asda.gr Περιστέρι, 4/09/2007

Διαβάστε περισσότερα

Ε.Ε. Π α ρ.ι(i), Α ρ.3646, 25/10/2002. ΤΗΣ ΕΠΙΣΗΜΗΣ ΕΦΗΜΕΡΙΔΑΣ ΤΗΣ ΔΗΜΟΚΡΑΤΙΑΣ Αρ. 3646 της 25ης ΟΚΤΩΒΡΙΟΥ 2002

Ε.Ε. Π α ρ.ι(i), Α ρ.3646, 25/10/2002. ΤΗΣ ΕΠΙΣΗΜΗΣ ΕΦΗΜΕΡΙΔΑΣ ΤΗΣ ΔΗΜΟΚΡΑΤΙΑΣ Αρ. 3646 της 25ης ΟΚΤΩΒΡΙΟΥ 2002 ΠΑΡΑΡΤΗΜΑ ΠΡΩΤΟ ΤΗΣ ΕΠΙΣΗΜΗΣ ΕΦΗΜΕΡΙΔΑΣ ΤΗΣ ΔΗΜΟΚΡΑΤΙΑΣ Αρ. 3646 της 25ης ΟΚΤΩΒΡΙΟΥ 2002 ΝΟΜΟΘΕΣΙΑ ΜΕΡΟΣ I Ο περί Σκύλων Νόμος του 2002, εκδίδεται με δημοσίευση στην Επίσημη Εφημερίδα της Κυπριακής Δημοκρατίας

Διαβάστε περισσότερα

ΕΘΝΙΚΗ ΣΥΝΟΜΟΣΠΟΝΔΙΑ ΕΛΛΗΝΙΚΟΥ ΕΜΠΟΡΙΟΥ ΙΝ.ΕΜ.Υ.

ΕΘΝΙΚΗ ΣΥΝΟΜΟΣΠΟΝΔΙΑ ΕΛΛΗΝΙΚΟΥ ΕΜΠΟΡΙΟΥ ΙΝ.ΕΜ.Υ. ΕΘΝΙΚΗ ΣΥΝΟΜΟΣΠΟΝΔΙΑ ΕΛΛΗΝΙΚΟΥ ΕΜΠΟΡΙΟΥ ΙΝ.ΕΜ.Υ. ΕΡΕΥΝΑ ΜΕ ΘΕΜΑ ΠΛΑΙΣΙΟ ΛΕΙΤΟΥΡΓΙΑΣ ΤΗΣ ΑΓΟΡΑΣ Αθήνα Παρασκευή, 2 Νοεμβρίου 2012 ΑΠΟΤΕΛΕΣΜΑΤΑ ΕΡΕΥΝΑΣ ΓΙΑ ΤΟ ΠΛΑΙΣΙΟ ΛΕΙΤΟΥΡΓΙΑΣ ΤΗΣ ΑΓΟΡΑΣ Το πλαίσιο λειτουργίας

Διαβάστε περισσότερα

στο σχέδιο νόµου «Ρύθµιση συνταξιοδοτικών θεµάτων του Δηµοσίου και άλλες διατάξεις» Επί του άρθρου 1 ΑΙΤΙΟΛΟΓΙΚΗ ΕΚΘΕΣΗ

στο σχέδιο νόµου «Ρύθµιση συνταξιοδοτικών θεµάτων του Δηµοσίου και άλλες διατάξεις» Επί του άρθρου 1 ΑΙΤΙΟΛΟΓΙΚΗ ΕΚΘΕΣΗ ΑΙΤΙΟΛΟΓΙΚΗ ΕΚΘΕΣΗ στο σχέδιο νόµου «Ρύθµιση συνταξιοδοτικών θεµάτων του Δηµοσίου και άλλες διατάξεις» Προς τη Βουλή των Ελλήνων ΜΕΡΟΣ Α ΡΥΘΜΙΣΗ ΣΥΝΤΑΞΙΟΔΟΤΙΚΩΝ ΘΕΜΑΤΩΝ ΔΗΜΟΣΙΟΥ Με τις προτεινόµενες διατάξεις,

Διαβάστε περισσότερα

ΕΓΧΕΙΡΙΔΙΟ ΟΔΗΓΙΩΝ ΓΙΑ ΤΗΝ ΚΩΔΙΚΟΠΟΙΗΣΗ ΤΗΣ ΝΟΜΟΘΕΣΙΑΣ. Α. Αντικείμενο του εγχειριδίου

ΕΓΧΕΙΡΙΔΙΟ ΟΔΗΓΙΩΝ ΓΙΑ ΤΗΝ ΚΩΔΙΚΟΠΟΙΗΣΗ ΤΗΣ ΝΟΜΟΘΕΣΙΑΣ. Α. Αντικείμενο του εγχειριδίου ΓΕΝΙΚΗ ΓΡΑΜΜΑΤΕΙΑ ΤΗΣ ΚΥΒΕΡΝΗΣΗΣ ΚΕΝΤΡΙΚΗ ΕΠΙΤΡΟΠΗ ΚΩΔΙΚΟΠΟΙΗΣΗΣ ΕΓΧΕΙΡΙΔΙΟ ΟΔΗΓΙΩΝ ΓΙΑ ΤΗΝ ΚΩΔΙΚΟΠΟΙΗΣΗ ΤΗΣ ΝΟΜΟΘΕΣΙΑΣ Α. Αντικείμενο του εγχειριδίου Με το ν. 3133/2003 «Κεντρική Επιτροπή Κωδικοποίησης»

Διαβάστε περισσότερα

Κωδ. 001-002: Οι κωδικοί αυτοί συμπληρώνονται από την φορολογική διοίκηση. Κωδ. 003: Γράψτε τη Δ.Ο.Υ. της έδρας ή του κεντρικού της επιχείρησής σας.

Κωδ. 001-002: Οι κωδικοί αυτοί συμπληρώνονται από την φορολογική διοίκηση. Κωδ. 003: Γράψτε τη Δ.Ο.Υ. της έδρας ή του κεντρικού της επιχείρησής σας. Ι. Γενικά Με την ΑΓΓΔΕ ΠΟΛ 1198/2014 όπως τροποποιήθηκε με την ΑΓΓΔΕ ΠΟΛ 1049/2015 ορίστηκε ο τύπος και το περιεχόμενο της δήλωσης Φ.Π.Α. Με την παρούσα παρέχονται διευκρινίσεις για την ορθή συμπλήρωση

Διαβάστε περισσότερα

ΠΡΟΪΟΝΤΩΝ» Ποσοστό στη.. του Μέτρου. Ποσό (σε ΕΥΡΩ)

ΠΡΟΪΟΝΤΩΝ» Ποσοστό στη.. του Μέτρου. Ποσό (σε ΕΥΡΩ) ΤΕΧΝΙΚΟ ΕΛΤΙΟ ΜΕΤΡΟΥ 7.12 : «EΠΕΝ ΥΣΕΙΣ ΓΙΑ ΤΗ ΒΕΛΤΙΩΣΗ ΤΗΣ ΑΝΤΑΓΩΝΙΣΤΙΚΟΤΗΤΑΣ ΤΩΝ ΕΠΙΧΕΙΡΗΣΕΩΝ ΠΡΩΤΗΣ ΜΕΤΑΠΟΙΗΣΗΣ ΚΑΙ ΕΜΠΟΡΙΑΣ ΓΕΩΡΓΙΚΩΝ ΠΡΟΪΟΝΤΩΝ» Α. ΤΑΥΤΟΤΗΤΑ ΜΕΤΡΟΥ Κ.Π.Σ. 2000-2006 ΕΠΙΧΕΙΡΗΣΙΑΚΟ ΠΡΟΓΡΑΜΜΑ

Διαβάστε περισσότερα

Ε.Ε. Παρ. Ι(Ι), Αρ. 4374, 28.12.2012

Ε.Ε. Παρ. Ι(Ι), Αρ. 4374, 28.12.2012 Ε.Ε. Παρ. Ι(Ι), Αρ. 4374, 28.12.2012 215(Ι)/2012 215(Ι)/2012 Ο ΠΕΡΙ ΤΩΝ ΜΕΛΩΝ ΤΟΥ ΣΤΡΑΤΟΥ ΤΗΣ ΔΗΜΟΚΡΑΤΙΑΣ (ΑΦΥΠΗΡΕΤΗΣΗ ΚΑΙ ΣΥΝΑΦΗ ΘΕΜΑΤΑ) (ΔΙΑΤΑΞΕΙΣ ΓΕΝΙΚΗΣ ΕΦΑΡΜΟΓΗΣ) ΝΟΜΟΣ ΤΟΥ 2012 Άρθρο: ΚΑΤΑΤΑΞΗ ΑΡΘΡΩΝ

Διαβάστε περισσότερα

ΤΕΧΝΟΛΟΓΙΚΟ ΕΚΠΑΙΔΕΥΤΙΚΟ ΙΔΡΥΜΑ (ΤΕΙ) ΚΑΛΑΜΑΤΑΣ ΣΧΟΛΗ ΤΕΧΝΟΛΟΓΙΑΣ ΓΕΩΠΟΝΙΑΣ ΤΜΗΜΑ ΦΥΤΙΚΗΣ ΠΑΡΑΓΩΓΗΣ ΠΤΥΧΙΑΚΗ ΕΡΓΑΣΙΑ

ΤΕΧΝΟΛΟΓΙΚΟ ΕΚΠΑΙΔΕΥΤΙΚΟ ΙΔΡΥΜΑ (ΤΕΙ) ΚΑΛΑΜΑΤΑΣ ΣΧΟΛΗ ΤΕΧΝΟΛΟΓΙΑΣ ΓΕΩΠΟΝΙΑΣ ΤΜΗΜΑ ΦΥΤΙΚΗΣ ΠΑΡΑΓΩΓΗΣ ΠΤΥΧΙΑΚΗ ΕΡΓΑΣΙΑ ΤΕΧΝΟΛΟΓΙΚΟ ΕΚΠΑΙΔΕΥΤΙΚΟ ΙΔΡΥΜΑ (ΤΕΙ) ΚΑΛΑΜΑΤΑΣ ΣΧΟΛΗ ΤΕΧΝΟΛΟΓΙΑΣ ΓΕΩΠΟΝΙΑΣ ΤΜΗΜΑ ΦΥΤΙΚΗΣ ΠΑΡΑΓΩΓΗΣ ΠΤΥΧΙΑΚΗ ΕΡΓΑΣΙΑ «ΟΙΝΟΙ Ο.Π.Α.Π. ΚΑΙ ΣΥΝΕΤΑΙΡΙΣΤΙΚΟ ΚΙΝΗΜΑ. Ο ΣΥΝΕΤΑΙΡΙΣΜΟΣ ΡΟΜΠΟΑΑΣ ΚΕΦΑΑΟΝΙΑΣ» ΥΠΕΥΘΥΝΟΣ

Διαβάστε περισσότερα

ΒΙΟΛΟΓΙΑ Γ ΤΑΞΗΣ ΕΝΙΑΙΟΥ ΛΥΚΕΙΟΥ ΓΕΝΙΚΗΣ ΠΑΙ ΕΙΑΣ 2005 ΕΚΦΩΝΗΣΕΙΣ

ΒΙΟΛΟΓΙΑ Γ ΤΑΞΗΣ ΕΝΙΑΙΟΥ ΛΥΚΕΙΟΥ ΓΕΝΙΚΗΣ ΠΑΙ ΕΙΑΣ 2005 ΕΚΦΩΝΗΣΕΙΣ ΘΕΜΑ 1 ΒΙΟΛΟΓΙΑ Γ ΤΑΞΗΣ ΕΝΙΑΙΟΥ ΛΥΚΕΙΟΥ ΓΕΝΙΚΗΣ ΠΑΙ ΕΙΑΣ 2005 ΕΚΦΩΝΗΣΕΙΣ Να γράψετε στο τετράδιό σας τον αριθµό καθεµιάς από τις παρακάτω ηµιτελείς προτάσεις 1 έως 5 και δίπλα το γράµµα που αντιστοιχεί

Διαβάστε περισσότερα

επείγοντος για την κατανοµή των βαρών της υποδοχής και προσωρινής διαµονής των µετακινουµένων ατόµων ( 6 ). Έχοντας υπόψη:

επείγοντος για την κατανοµή των βαρών της υποδοχής και προσωρινής διαµονής των µετακινουµένων ατόµων ( 6 ). Έχοντας υπόψη: L 212/12 EL Επίσηµη Εφηµερίδα των Ευρωπαϊκών Κοινοτήτων 7.8.2001 Ο ΗΓΙΑ 2001/55/ΕΚ ΤΟΥ ΣΥΜΒΟΥΛΙΟΥ της 20ής Ιουλίου 2001 σχετικά µε τις ελάχιστες προδιαγραφές παροχής προσωρινής προστασίας σε περίπτωση

Διαβάστε περισσότερα

«ΑΝΩ ΛΙΟΣΙΑ: ΤΟΠΙΚΗ ΙΣΤΟΡΙΑ, ΠΕΡΙΒΑΛΛΟΝ, ΠΡΟΚΛΗΣΕΙΣ, ΠΡΟΟΠΤΙΚΕΣ»

«ΑΝΩ ΛΙΟΣΙΑ: ΤΟΠΙΚΗ ΙΣΤΟΡΙΑ, ΠΕΡΙΒΑΛΛΟΝ, ΠΡΟΚΛΗΣΕΙΣ, ΠΡΟΟΠΤΙΚΕΣ» 1 ο ΕΠΑ.Λ ΑΝΩ ΛΙΟΣΙΩΝ ΠΑΡΟΥΣΙΑΣΗ ΤΟΥ ΠΡΟΓΡΑΜΜΑΤΟΣ ΠΕΡΙΒΑΛΛΟΝΤΙΚΗΣ ΕΚΠΑΙΔΕΥΣΗΣ: «ΑΝΩ ΛΙΟΣΙΑ: ΤΟΠΙΚΗ ΙΣΤΟΡΙΑ, ΠΕΡΙΒΑΛΛΟΝ, ΠΡΟΚΛΗΣΕΙΣ, ΠΡΟΟΠΤΙΚΕΣ» ΣΧΟΛΙΚΟ ΕΤΟΣ : 2008-2009 ΠΕΡΙΒΑΛΛΟΝΤΙΚΗ ΟΜΑΔΑ: ΔΗΜΟΠΟΥΛΟΣ

Διαβάστε περισσότερα

Ο ΠΡΟΕΔΡΟΣ ΤΗΣ ΕΛΛΗΝΙΚΗΣ ΔΗΜΟΚΡΑΤΙΑΣ. Για την εφαρμογή των διατάξεων του παρόντος νόμου, ισχύουν οι παρακάτω ορισμοί:

Ο ΠΡΟΕΔΡΟΣ ΤΗΣ ΕΛΛΗΝΙΚΗΣ ΔΗΜΟΚΡΑΤΙΑΣ. Για την εφαρμογή των διατάξεων του παρόντος νόμου, ισχύουν οι παρακάτω ορισμοί: ΝΟΜΟΣ ΥΠ' ΑΡΙΘΜ. 4039 (ΦΕΚ Α 15/02/02/2012) Για τα δεσποζόμενα και τα αδέσποτα ζώα συντροφιάς και την προστασία των ζώων από την εκμετάλλευση ή τη χρησιμοποίηση με κερδοσκοπικό σκοπό. Ο ΠΡΟΕΔΡΟΣ ΤΗΣ ΕΛΛΗΝΙΚΗΣ

Διαβάστε περισσότερα

Ι ΑΚΤΙΚΗ ΠΑΡΕΜΒΑΣΗ ΣΤΗΝ ΠΑΡΑΓΩΓΗ ΓΡΑΠΤΟΥ ΛΟΓΟΥ ΣΕ ΤΜΗΜΑ ΕΝΤΑΞΗΣ ΕΥΤΕΡΟΒΑΘΜΙΑΣ ΕΚΠΑΙ ΕΥΣΗΣ

Ι ΑΚΤΙΚΗ ΠΑΡΕΜΒΑΣΗ ΣΤΗΝ ΠΑΡΑΓΩΓΗ ΓΡΑΠΤΟΥ ΛΟΓΟΥ ΣΕ ΤΜΗΜΑ ΕΝΤΑΞΗΣ ΕΥΤΕΡΟΒΑΘΜΙΑΣ ΕΚΠΑΙ ΕΥΣΗΣ ΜΑΡΙΑ ΣΙΟΜΠΟΤΗ-ΣΑΜΣΑΡΗ Φιλόλογος Ι ΑΚΤΙΚΗ ΠΑΡΕΜΒΑΣΗ ΣΤΗΝ ΠΑΡΑΓΩΓΗ ΓΡΑΠΤΟΥ ΛΟΓΟΥ ΣΕ ΤΜΗΜΑ ΕΝΤΑΞΗΣ ΕΥΤΕΡΟΒΑΘΜΙΑΣ ΕΚΠΑΙ ΕΥΣΗΣ Προλεγόμενα Τα Τμήματα Ένταξης, αν και λειτουργούν στην Α/βάθμια Εκπαίδευση από

Διαβάστε περισσότερα

ΚΑΤΑΣΤΑΤΙΚΟ ΤΟΥ ΕΞΩΡΑΪΣΤΙΚΟΥ ΣΥΛΛΟΓΟΥ «Η ΑΝΕΜΟΕΣΣΑ»

ΚΑΤΑΣΤΑΤΙΚΟ ΤΟΥ ΕΞΩΡΑΪΣΤΙΚΟΥ ΣΥΛΛΟΓΟΥ «Η ΑΝΕΜΟΕΣΣΑ» ΚΑΤΑΣΤΑΤΙΚΟ ΤΟΥ ΕΞΩΡΑΪΣΤΙΚΟΥ ΣΥΛΛΟΓΟΥ ΟΙΚΟΠΕ ΟΥΧΩΝ ΚΑΙ ΟΙΚΙΣΤΩΝ ΕΜΠ ΚΑΡΥΣΤΟΥ ΕΥΒΟΙΑΣ «Η ΑΝΕΜΟΕΣΣΑ» ΑΡΘΡΟ 1 0 ΕΠΩΝΥΜΙΑ - Ε ΡΑ Ιδρύεται σωµατείο µε την επωνυµία «ΕΞΩΡΑΙΣΤΙΚΟΣ ΣΥΛΛΟΓΟΣ ΟΙΚΟΠΕ ΟΥΧΩΝ ΚΑΙ ΟΙΚΙΣΤΩΝ

Διαβάστε περισσότερα

ΑΝΑΡΤΗΤΕΑ Αριθμ. Απόφασης 12/2016 ΑΠΟΣΠΑΣΜΑ

ΑΝΑΡΤΗΤΕΑ Αριθμ. Απόφασης 12/2016 ΑΠΟΣΠΑΣΜΑ ΔΗΜΟΣ ΝΕΑΣ ΠΡΟΠΟΝΤΙΔΑΣ ΝΟΜΟΣ ΧΑΛΚΙΔΙΚΗΣ ΕΛΛΗΝΙΚΗ ΔΗΜΟΚΡΑΤΙΑ ΣΧΟΛΙΚΗ ΕΠΙΤΡΟΠΗ Β/ΘΜΙΑΣ ΕΚΠΑΙΔΕΥΣΗΣ ΑΠΟΣΠΑΣΜΑ ΑΝΑΡΤΗΤΕΑ Αριθμ. Απόφασης 12/2016 Από το Πρακτικό 2/2016 της συνεδρίασης της Σχολικής Επιτροπής

Διαβάστε περισσότερα

Η ΦΟΡΟΛΟΓΙΑ ΜΕΤΑΒΙΒΑΣΗΣ ΠΛΟΙΩΝ

Η ΦΟΡΟΛΟΓΙΑ ΜΕΤΑΒΙΒΑΣΗΣ ΠΛΟΙΩΝ Η ΦΟΡΟΛΟΓΙΑ ΜΕΤΑΒΙΒΑΣΗΣ ΠΛΟΙΩΝ ΠΕΡΙΕΧΟΜΕΝΑ Πρόλογος.. 7 ΜΕΡΟΣ ΠΡΩΤΟ ΕΙΣΑΓΩΓΗ. ΓΕΝΙΚΕΣ ΠΑΡΑΤΗΡΗΣΕΙΣ 1. Εισαγωγή.................. 29 2. Δικαιολογητική βάση επιβολής του φόρου μεταβίβασης πλοίων... 30 3.

Διαβάστε περισσότερα

Η Φυσική με Πειράματα

Η Φυσική με Πειράματα Α Γυμνασίου Η Φυσική με Πειράματα Πρόγραμμα Σπουδών Περιγραφή Το μάθημα της Φυσικής, η "Φυσική με Πειράματα", στην πρώτη τάξη του Γυμνασίου προβλέπεται να διδάσκεται μία ώρα την εβδομάδα, στην τάξη ή στο

Διαβάστε περισσότερα

7. ΠΡΟΓΡΑΜΜΑ ΣΠΟΥΔΩΝ ΕΛΛΗΝΙΚΗΣ ΝΟΗΜΑΤΙΚΗΣ ΓΛΩΣΣΑΣ ΤΗΣ ΠΡΩΤΗΣ ΤΑΞΗΣ ΤΟΥ ΔΗΜΟΤΙΚΟΥ ΣΧΟΛΕΙΟΥ

7. ΠΡΟΓΡΑΜΜΑ ΣΠΟΥΔΩΝ ΕΛΛΗΝΙΚΗΣ ΝΟΗΜΑΤΙΚΗΣ ΓΛΩΣΣΑΣ ΤΗΣ ΠΡΩΤΗΣ ΤΑΞΗΣ ΤΟΥ ΔΗΜΟΤΙΚΟΥ ΣΧΟΛΕΙΟΥ 7. ΠΡΟΓΡΑΜΜΑ ΣΠΟΥΔΩΝ ΕΛΛΗΝΙΚΗΣ ΝΟΗΜΑΤΙΚΗΣ ΓΛΩΣΣΑΣ ΤΗΣ ΠΡΩΤΗΣ ΤΑΞΗΣ ΤΟΥ ΔΗΜΟΤΙΚΟΥ ΣΧΟΛΕΙΟΥ 7.1. Περιεχόμενο 1.Κατανόηση Γλώσσας- Ο μαθητής θα κατανοήσει το θέμα που εκφέρεται στην Ελληνική Νοηματική Γλώσσα.

Διαβάστε περισσότερα

Τιμολόγιο Μελέτης. 320.000,00 (με ΦΠΑ) ΠΡΟΓΡΑΜΜΑ ΑΓΡΟΤΙΚΗ ΑΝΑΠΤΥΞΗ ΤΗΣ ΕΛΛΑΔΑΣ 2007-2013(Ε.Γ.Τ.Α.Α.- ΕΘΝΙΚΟΙ ΠΟΡΟΙ) ΥΠΟΕΡΓΟ 1:

Τιμολόγιο Μελέτης. 320.000,00 (με ΦΠΑ) ΠΡΟΓΡΑΜΜΑ ΑΓΡΟΤΙΚΗ ΑΝΑΠΤΥΞΗ ΤΗΣ ΕΛΛΑΔΑΣ 2007-2013(Ε.Γ.Τ.Α.Α.- ΕΘΝΙΚΟΙ ΠΟΡΟΙ) ΥΠΟΕΡΓΟ 1: ΕΛΛΗΝΙΚΗ ΔΗΜΟΚΡΑΤΙΑ ΠΕΡΙΦΕΡΕΙΑ ΑΝΑΤΟΛΙΚΗΣ ΜΑΚΕΔΟΝΙΑΣ & ΘΡΑΚΗΣ Περιφερειακή Ενότητα Δράμας ΟΤΑ : Δήμος Κάτω Νευροκοπίου ΥΠΟΕΡΓΟ 1: ΤΟΥ ΕΡΓΟΥ: ΠΡΟΥΠΟΛΟΓΙΣΜΟΣ: Ανάπλαση οδών-πεζοδρομίων & ηλεκτροφωτισμού

Διαβάστε περισσότερα

Ανδρικές Αμυνες σε Γυναικεία Ζητήματα

Ανδρικές Αμυνες σε Γυναικεία Ζητήματα Ανδρικές Αμυνες Ανδρικές Αμυνες σε Γυναικεία Ζητήματα σε Γυναικεία Ζητήματα Ασκήσεις Ετερότητας: Δοκιμή 1η Θεσσαλονίκη Ιανουάριος 2008 Περιεχόμενα Λίγα εισαγωγικά 4 Α. «Υπάρχει Σεξισμός;» 5 Β. «Η ράτσα

Διαβάστε περισσότερα

ΘΕΜΑΤΟΛΟΓΙΟ ΚΑΙ ΟΔΗΓΙΕΣ ΟΡΓΑΝΩΣΗΣ & ΛΕΙΤΟΥΡΓΙΑΣ ΕΙΔΙΚΩΝ ΕΚΠΑΙΔΕΥΣΕΩΝ ΣΚΑΠΑΝΙΚΗΣ

ΘΕΜΑΤΟΛΟΓΙΟ ΚΑΙ ΟΔΗΓΙΕΣ ΟΡΓΑΝΩΣΗΣ & ΛΕΙΤΟΥΡΓΙΑΣ ΕΙΔΙΚΩΝ ΕΚΠΑΙΔΕΥΣΕΩΝ ΣΚΑΠΑΝΙΚΗΣ ΘΕΜΑΤΟΛΟΓΙΟ ΚΑΙ ΟΔΗΓΙΕΣ ΟΡΓΑΝΩΣΗΣ & ΛΕΙΤΟΥΡΓΙΑΣ ΕΙΔΙΚΩΝ ΕΚΠΑΙΔΕΥΣΕΩΝ ΣΚΑΠΑΝΙΚΗΣ ΕΚΠΑΙΔΕΥΣΗ ΣΚΑΠΑΝΙΚΗΣ Α. ΣΚΟΠΟΣ Η Εκπαίδευση έχει σκοπό την παροχή κατάλληλων και εξειδικευμένων γνώσεων σχετικά με την κατασκευαστική

Διαβάστε περισσότερα

Α. ΠΕΡΙΓΡΑΦΗ ΜΙΚΡΟΣΚΟΠΙΟΥ Ένα απλό σχολικό µικροσκόπιο αποτελείται από τρία βασικά συστήµατα, το οπτικό, το µηχανικό και το φωτιστικό.

Α. ΠΕΡΙΓΡΑΦΗ ΜΙΚΡΟΣΚΟΠΙΟΥ Ένα απλό σχολικό µικροσκόπιο αποτελείται από τρία βασικά συστήµατα, το οπτικό, το µηχανικό και το φωτιστικό. ΓΝΩΡΙΜΙΑ ΜΕ ΤΟ ΜΙΚΡΟΣΚΟΠΙΟ Σκοπός - Να γνωρίσετε την κατασκευή και τη λειτουργία του µικροσκοπίου. - Να εξασκηθείτε στην προετοιµασία παρασκευασµάτων. - Να εξοικειωθείτε στη χρήση του µικροσκοπίου. Α.

Διαβάστε περισσότερα