ΜΕΛΕΤΗ ΤΩΝ ΣΥΝΤΗΡΗΜΕΝΩΝ ΑΛΛΗΛΟΥΧΙΩΝ ΠΟΥ ΔΕΝ ΚΩΔΙΚΟΠΟΙΟΥΝ ΠΡΩΤΕΪΝΕΣ ΣΤΑ ΓΟΝΙΔΙΩΜΑΤΑ ΤΩΝ ΨΑΡΙΩΝ

Μέγεθος: px
Εμφάνιση ξεκινά από τη σελίδα:

Download "ΜΕΛΕΤΗ ΤΩΝ ΣΥΝΤΗΡΗΜΕΝΩΝ ΑΛΛΗΛΟΥΧΙΩΝ ΠΟΥ ΔΕΝ ΚΩΔΙΚΟΠΟΙΟΥΝ ΠΡΩΤΕΪΝΕΣ ΣΤΑ ΓΟΝΙΔΙΩΜΑΤΑ ΤΩΝ ΨΑΡΙΩΝ"

Transcript

1 9 ο Πανελλήνιο Συμπόσιο Ωκεανογραφίας & Αλιείας Πρακτικά, Τόμος ΙΙ ΜΕΛΕΤΗ ΤΩΝ ΣΥΝΤΗΡΗΜΕΝΩΝ ΑΛΛΗΛΟΥΧΙΩΝ ΠΟΥ ΔΕΝ ΚΩΔΙΚΟΠΟΙΟΥΝ ΠΡΩΤΕΪΝΕΣ ΣΤΑ ΓΟΝΙΔΙΩΜΑΤΑ ΤΩΝ ΨΑΡΙΩΝ Μανουσάκη Τ. 1,2, Lagnel J. 1, Λαδουκάκης Μ. 2, Μαγουλάς Α. 1, Κωτούλας Γ. 1, Τσιγγενόπουλος Κ. 1 1 Ινστιτούτο Θαλάσσιας Βιολογίας και Γενετικής, Ελληνικό Κέντρο Θαλάσσιων Ερευνών 2 Τμήμα Βιολογίας, Πανεπιστήμιο Κρήτης Περίληψη Στην εποχή της μετα-γονιδιωματικής, τα συντηρημένα στοιχεία στις περιοχές εκτός γονιδίων έχουν προσελκύσει το ερευνητικό ενδιαφέρον καθώς θεωρούνται σημαντικά στην εξέλιξη της ομάδας των μεταζώων και ιδιαίτερα των σπονδυλωτών. Στην παρούσα εργασία μελετήθηκαν συγκριτικά τα 5 διαθέσιμα γονιδιώματα ψαριών, των Takifugu rubripes, Tetraodon nigroviridis, Danio rerio, Oryzias latipes και Gasterosteous aculeatus. Με χρήση εργαλείων βιοπληροφορικής, απομονώθηκε σε κάθε γονιδίωμα το τμήμα που δεν κωδικοποιεί πρωτεΐνες και βρίσκεται μεταξύ των γονιδίων. Η μελέτη είχε ως αποτέλεσμα την ανίχνευση 103 αλληλουχιών (CNEs) που είχαν τουλάχιστον 100 νουκλεοτιδικές βάσεις μήκος και 70% ομοιότητα μεταξύ τους στην περιοχή μεταξύ των γονιδίων στα γονιδιώματα. Από τη μελέτη των CNEs πρoέκυψε ότι τα μισά περίπου από αυτά δεν έχουν ανιχνευθεί από τις μέχρι τώρα συγκρίσεις γονιδιωμάτων. Επιπλέον, παρουσιάζουν τα σημαντικότερα χαρακτηριστικά των συντηρημένων αλληλουχιών, όπως αυτά έχουν καθοριστεί από προηγούμενες εργασίες. Τα αποτελέσματά μας δείχνουν την μειωμένη παρουσία CNEs στην ομάδα των τελεόστεων σε σχέση με τα υπόλοιπα σπονδυλωτά. Λέξεις κλειδιά: Τελεόστεοι, γονιδίωμα, συντηρημένες αλληλουχίες. STUDY OF THE CONSERVED NON-CODING ELEMENTS IN FISH GENOMES Manousaki T. 1,2, Lagnel J. 1, Ladoukakis M. 2, Magoulas A. 1, Kotoulas G. 1, Tsigenopoulos C Institute of Marine Biology and Genetics, Hellenic Centre for Marine Research 2 Biology Department, University of Crete Abstract In the era of meta-genomics, conserved non-coding regions have attracted the attention of the researchers. They are believed, and in many cases proven, to play important key-role in the evolution of the vertebrates genomes. In this study, we explored the intergenic, non-coding part of the genomes of 5 fish, Zebrafish, Fugu, Tetraodon, Medaka and Stickleback. We designed an algorithm, which extracted the intergenic sequences of each genome, identified the conserved non-coding elements (CNEs) between them and compared them with those found in other studies and organisms. Fish found to contain only a few CNEs, 103, compared to other groups and other studies that used species with similar evolutionary distance. Half of them are shared with the other vertebrates, while the other half seem to be new to the known set of CNEs. An important fraction of their flanking genes are associated with regulation of transcription and development. They seem to be syntenic in most of the species studied, and they are mainly located near genes, also forming clusters. Thus, we propose that the new set of CNEs may play an important role in teleost or even vertebrate evolution. Keywords: Teleosts, non-coding, genome, conserved sequences. 1. Εισαγωγή Η ομάδα των τελεόστεων περιλαμβάνει περίπου το 95% των ψαριών και 50% όλων των σύγχρονων σπονδυλωτών και παρουσιάζει ιδιαίτερα υψηλά επίπεδα ποικιλότητας που, εκτός από την οικολογία, τη μορφολογία, τη συμπεριφορά και άλλες όψεις της βιολογίας των ψαριών, επηρεάζει έντονα τα γονιδιώματά τους. Η εξέλιξή τους επηρεάστηκε σημαντικά από τον επιπλέον διπλασιασμό του γονιδιώματος, που έλαβε χώρα στην αρχή της εξελικτικής τους πορείας τους μετά το διαχωρισμό τους από τα υπόλοιπα ψάρια (Volff, 2005). Σύμφωνα με την πιο πρόσφατη θεωρία, είχαν προηγηθεί δύο άλλοι διπλασιασμοί ολόκληρου γονιδιώματος στην αρχή της εξελικτικής πορείας των σπον

2 9 th Symposium on Oceanography & Fisheries, Proceedings, Volume ΙΙ δυλωτών και ένας μετά το διαχωρισμό των τελεόστεων (Volff, 2005). Η μελέτη του γονιδιώματος των σύγχρονων τελεόστεων μας οδηγεί στην ανίχνευση των γεγονότων που έλαβαν χώρα κατά την εξέλιξη, αλλά και των επιπτώσεών τους στους οργανισμούς. Από τις μελέτες αυτές προκύπτει ότι οι περιοχές των γονιδιωμάτων που δεν κωδικοποιούν πρωτεΐνες παίζουν καθοριστικό ρόλο. Το μη κωδικοποιούν DNA (non-coding DNA, ncdna) αποτελεί ένα από τα χαρακτηριστικά των γονιδιωμάτων των μεταζώων που είναι σε μεγάλο βαθμό δύσκολο να εξηγηθεί. Για δεκαετίες οι επιστήμονες το αποκαλούν «DNA σκουπίδι» («junk DNA»). Τα τελευταία χρόνια, όμως, εμφανίζονται όλο και περισσότερες ενδείξεις σύμφωνα με τις οποίες το ncdna, ή ένα τμήμα αυτού, αποτελεί σημαντικό λειτουργικό κομμάτι των γονιδιωμάτων. Το λειτουργικό ncdna περιλαμβάνει cis ρυθμιστικά στοιχεία όπως ενισχυτές (enhancers), υποκινητές (promoters), matrix ή scaffold attachment regions, μονωτές (insulators) και αποσιωπητές (silencers) (Ludwig 2002). Η μελέτη της εξέλιξης των ρυθμιστικών στοιχείων έχει δύο σκέλη. Το πρώτο είναι η άμεση λειτουργική (functional) προσέγγιση, ενώ δεύτερη προσέγγιση αφορά στη σύγκριση γονιδιωμάτων. Η βασική ιδέα που κυριαρχεί στο χώρο της συγκριτικής γονιδιωματικής είναι ότι οι αλληλουχίες που παραμένουν σημαντικά συντηρημένες μεταξύ εξελικτικά απομακρυσμένων οργανισμών είναι, πιθανότατα, λειτουργικές (Elgar & Vavouri, 2008). Η σύγκριση της περιοχής του γονιδιώματος, που δεν κωδικοποιεί πρωτεΐνες, έφερε στο φως την ύπαρξη αλληλουχιών που παραμένουν συντηρημένες ακόμα και σε μακρινά φυλογενετικά είδη. Τα συντηρημένα, και πιθανότατα λειτουργικά, στοιχεία που εμφανίστηκαν με τη σύγκριση του ανθρώπινου γονιδιώματος με τα υπόλοιπα σπονδυλωτά ονομάζονται συντηρημένα στοιχεία της περιοχής του DNA που δεν κωδικοποιεί πρωτεΐνες, ή εν συντομία CNEs (conserved non-coding elements). Οι μελέτες που έχουν γίνει μέχρι τώρα και αφορούν συντηρημένες αλληλουχίες στα γονιδιώματα των σπονδυλωτών, έχουν επικεντρωθεί στις αλληλουχίες που έχουν από κοινού ο άνθρωπος με τα υπόλοιπα σπονδυλωτά. Οι αλληλουχίες αυτές φαίνεται να παίζουν σημαντικό λειτουργικό ρόλο όπως δείχνουν οι λειτουργικές μελέτες που πραγματοποιούνται. Από τις μέχρι τώρα μελέτες τα CNEs φαίνεται να διακρίνονται από τα παρακάτω χαρακτηριστικά (Elgar & Vavouri, 2008): Είναι παρόντα στα γονιδιώματα των περισσότερων μεταζώων. Βρίσκονται μεταξύ των γονιδίων, αλλά και μέσα στα γονίδια στις μη μεταφραζόμενες περιοχές (untrancribed regions, UTRs) και σε ιντρόνια (introns). Έχουν ιδιαίτερα χαμηλό ρυθμό αντικατάστασης ακόμα και σε μεγάλες εξελικτικές αποστάσεις. Η παρουσία τους στα χρωμοσώματα θεωρείται ότι προκαλεί έντονα το φαινόμενο της συνταινίας. Στην πλειονότητά τους, θεωρούνται ρυθμιστικά στοιχεία (π.χ., ενισχυτές, μονωτές). Συχνά, βρίσκονται κοντά σε γονίδια που συμμετέχουν στην ανάπτυξη των οργανισμών. Έτσι έχουν αναλυθεί, σχεδόν αποκλειστικά, συντηρημένα στοιχεία που εμφανίστηκαν στην εξελικτική πορεία των τετραπόδων (σύγκριση ανθρώπου με τα υπόλοιπα τετράποδα) ή των σπονδυλωτών γενικότερα (σύγκριση ανθρώπου ψαριού). Συνεπώς, προκύπτει το ερώτημα για την ύπαρξη λειτουργικών στοιχείων που εμφανίστηκαν και εξελίχθηκαν στην γραμμή των τελεόστεων, μετά το διαχωρισμό τους από τα τετράποδα. Σκοπός της παρούσας εργασίας είναι η μελέτη των γονιδιωμάτων των τελεόστεων για την ανίχνευση και τον χαρακτηρισμό συντηρημένων στοιχείων σε αυτά. 2. Υλικά και Μέθοδοι Η παρούσα εργασία υλοποιήθηκε αποκλειστικά με χρήση εργαλείων βιοπληροφορικής και την ανάπτυξη αλγορίθμων. Χρησιμοποιήθηκε το τοπικό υπολογιστικό σύστημα του Ινστιτούτου Θαλάσσιας Βιολογίας και Γενετικής που αποτελείται από 8 επεξεργαστές Intel Xeon 64-bit, 3GHZ και 32 GBytes RAM

3 9 ο Πανελλήνιο Συμπόσιο Ωκεανογραφίας & Αλιείας Πρακτικά, Τόμος ΙΙ Χρησιμοποιήθηκαν αλληλουχίες από γονιδιώματα των ψαριών Danio rerio, Takifugu rubripes, Tetraodon nigroviridis, Oryzias latipes και Gasterosteus aculeatus και έγινε απομόνωση των περιοχών μεταξύ των γονιδίων στα 5 γονιδιώματα με χρήση FASTA αρχείων και των πληροφοριών που περιέχονταν στη βάση δεδομένων της Ensembl (www.ensembl.org). Στη συνέχεια, ανιχνεύθηκαν οι συντηρημένες περιοχές που ήταν μεγαλύτερες από 99 νουκλεοτιδικές βάσεις (bp) και είχαν τουλάχιστον 70% ομοιότητα. Οι αλληλουχίες που βρέθηκαν χαρτογραφήθηκαν στα χρωμοσώματα με χρήση του λογισμικού MAPCHART (Voorrips, 2001). Μελετήθηκαν οι κατηγορίες Gene Ontology των κοντινότερων σε αυτές γονιδίων και οι αποστάσεις τους από αυτά. Τα βήματα του αλγορίθμου στο σύνολό του (Εικ. 1), όπως αυτός υλοποιήθηκε, ήταν τα εξής: Απομόνωση των περιοχών μεταξύ των γονιδίων (intergenic) για κάθε γονιδίωμα με χρήση της βάσης δεδομένων της Ensembl και των αρχείων FASTA. Με αυτό τον τρόπο επιλέγουμε και τις περιοχές που δεν κωδικοποιούν (non-coding). Δημιουργία ενός αρχείου FASTA για κάθε είδος που περιείχε τις, μεταξύ των γονιδίων, περιοχές. Blast των αρχείων αυτών με αποτέλεσμα την ανίχνευση των περιοχών που υπάρχουν τουλάχιστον σε 2 είδη. Δημιουργία βάσης δεδομένων με τα blast outputs. Για κάθε περιοχή που βρέθηκε μεταξύ 2 ειδών γίνεται έλεγχος για την παρουσία της και στα άλλα 3 είδη. Δημιουργία βάσης δεδομένων με τις αλληλουχίες που βρίσκονται και στα 5 είδη που μελετώνται, με κριτήριο να είναι μεγαλύτερες από 99 bp και να έχουν τουλάχιστον 70% ομοιότητα. Εικ. 1: Διάγραμμα που περιγράφει τον αλγόριθμο που υλοποιήθηκε

4 9 th Symposium on Oceanography & Fisheries, Proceedings, Volume ΙΙ 3. Αποτελέσματα Στην παρούσα εργασία, απομονώθηκε το τμήμα των γονιδιωμάτων των ειδών Takifugu rubripes, Tetraodon nigroviridis, Danio rerio, Oryzias latipes και Gasterosteous aculeatus, που δεν κωδικοποιεί πρωτεΐνες και βρίσκεται μεταξύ των γονιδίων. Από τη σύγκριση των γονιδιωμάτων προέκυψαν 731 συντηρημένες αλληλουχίες (CNEs), που είχαν τουλάχιστον 100 νουκλεοτιδικές βάσεις μήκος και 70% ομοιότητα μεταξύ τους). Οι αλληλουχίες αυτές ελέγχθηκαν με το λογισμικό RepeatMasker (www.repeatmasker.com) για να αποκλειστούν εκείνες που αποτελούσαν επαναλαμβανόμενα στοιχεία. Έτσι, καταλήξαμε σε 109 CNEs εκ των οποίων 6 υπάρχουν σε 2 αντίγραφα. Ο έλεγχος για την ύπαρξη των στοιχείων αυτών, σε βάσεις δεδομένων στο διαδίκτυο (CONDOR, TFCONES), έδειξαν ότι τα 57 από τα 103 CNEs έχουν ήδη αναγνωρισθεί από άλλες συγκρίσεις (κυρίως, ανθρώπου fugu). Ένα βασικό χαρακτηριστικό των CNEs ήταν η κατανομή τους, καθώς έχουν την τάση να συγκεντρώνονται σε ομάδες (clusters) και να μην κατανέμονται ομοιόμορφα στα χρωμοσώματα. Επιπλέον, από την κατανομή τους, παρατηρούμε ότι υπάρχει μεγάλη αντιστοιχία μεταξύ των χρωμοσωμάτων των ειδών. Είναι εύκολο να παρατηρήσει κανείς τη συνταινία που εμφανίζουν, καθώς ομάδες από γειτονικά CNEs χαρτογραφούνται σε «κοντινές» αποστάσεις μεταξύ τους στα χρωμοσώματα (Εικ. 2). Είναι εμφανές ότι, όταν εστιάζουμε σε εξελικτικά «κοντινά» είδη, η σχετική τους θέση δεν αλλάζει με εξαίρεση κάποιους ανασυνδυασμούς, τύπου αναστροφής, που έχουν λάβει χώρα σε μερικές περιπτώσεις. Στο σύνολο των συγκρίσεων διαπιστώνουμε ότι το Danio rerio παρουσιάζει τις μεγαλύτερες διαφορές σε σχέση με τα με τα υπόλοιπα είδη. Εικ. 2: Κατανομή των CNEs του χρωμοσώματος 2 του Tetraodon, στα χρωμοσώματα των υπόλοιπων ειδών και συγκριτική θέση αυτών. Εξαιρείται το Fugu που δεν έχει σαφώς διαχωρισμένες ομάδες σύνδεσης. Με έγχρωμες γραμμές παρουσιάζονται τα ομόλογα CNEs. Η μελέτη των CNEs συμπεριλάμβανε και τη μελέτη των κοντινότερών τους γονιδίων στην 5 και 3 πλευρά τους. Η μελέτη αυτή περιλαμβάνει 2 σκέλη. Το ένα είναι η βιολογική λειτουργία με την οποία σχετίζονται τα γονίδια (www.geneontology.org/go.doc.shtml) και το δεύτερο η απόστασή τους από τα CNEs. Όπως φάνηκε, το μεγαλύτερο ποσοστό και στις δύο κατευθύνσεις κατέχουν τα γονίδια που συμμετέχουν στη διαδικασία της μεταγραφής (Εικ. 3). Υψηλό ποσοστό έχουν και τα γονίδια που σχετίζονται με την ανάπτυξη των οργανισμών αλλά και τη μεταγωγή σήματος. Όσον

5 9 ο Πανελλήνιο Συμπόσιο Ωκεανογραφίας & Αλιείας Πρακτικά, Τόμος ΙΙ αφορά στην απόσταση, φαίνεται πως τα περισσότερα είναι «κοντά» σε γονίδια καθώς απέχουν λιγότερο από 200Kb. Εικ. 3: Η ποσοστιαία κατανομή της λειτουργίας των γονιδίων που είναι πλησιέστερα στα CNEs ανεξάρτητα από την κατεύθυνσή τους, σύμφωνα με το χαρακτηρισμό Gene Ontology (GO) των γονιδίων. Γονίδια που σχετίζονται με τη μεταγραφή και τη ρύθμισή της καταλαμβάνουν το 48% του συνόλου. 4. Συζήτηση Τα αποτελέσματα που περιγράφηκαν στην προηγούμενη ενότητα συμπληρώνουν τη γνώση που μέχρι τώρα υπάρχει για τις συντηρημένες περιοχές μεταξύ ειδών τόσο απομακρυσμένων εξελικτικά, όσο οι τελεόστεοι που χρησιμοποιήθηκαν. Είναι γεγονός ότι προηγούμενες μελέτες ανίχνευσης CNEs σε είδη παρόμοιας εξελικτικής απόστασης με τα είδη που χρησιμοποιήσαμε, δηλαδή περίπου 310 εκ. χρόνια, έφεραν στο φως ένα πολύ μεγαλύτερο αριθμό τέτοιων στοιχείων. Παραδείγματα τέτοιων μελετών είναι η σύγκριση ανθρώπου σκύλου κοτόπουλου (310 εκ.χρόνια) (Hedges & Kumar 2003) που κατέληξε στην ύπαρξη 2343 συντηρημένων στοιχείων και η σύγκριση ανθρώπου fugu (450 εκ. χρόνια, Woolfe et al. 2005) κατέληξε σε 3583 στοιχεία. Όσον αφορά στη σύγκριση της εργασίας μας με τις υπόλοιπες δεν είναι δυνατόν να γίνει με έγκυρο τρόπο, καθώς θα έπρεπε να γνωρίζουμε την εικόνα στις UTRs και τα ιντρόνια. Ο αριθμός των 103 CNEs που βρέθηκε στη παρούσα εργασία αναμένεται να αυξηθεί ιδιαίτερα μετά την προσθήκη των CNEs που θα προκύψουν με τη μελέτη των UTRs και των ιντρονίων. Εντούτοις, και πάλι φαίνεται να είναι ιδιαίτερα χαμηλός. Η τόσο μειωμένη παρουσία συντηρημένων στοιχείων μεταξύ των ψαριών έχει τονιστεί και άλλη μια φορά στο πρόσφατο άρθρο των Stephen et al., (2008), όπου έγινε η σύγκριση 2 υπο-συνόλων, με 3 είδη ψαριών σε κάθε ένα από αυτά. Σε κάθε υποσύνολο, η μελέτη του έφερε 40 περίπου συντηρημένες αλληλουχίες (>99bp, 100% όμοιες), με μόνο τις 20 να είναι κοινές και στα δύο. Η πιθανότερη εξήγηση είναι ότι οι τελεόστεοι υπέστησαν έναν επιπλέον διπλασιασμό ολόκληρου του γονιδιώματός τους που πιθανότατα «χαλάρωσε» την εξελικτική πίεση που ασκείται στα συντηρημένα στοιχεία. Είναι εντυπωσιακό, πως ενώ κάθε ένα από τα ψάρια έχει σχετικά μεγάλο αριθμό CNEs όταν συγκρίνεται με τον άνθρωπο, σαν σύνολο έχουν ελάχιστα κοινά μεταξύ τους. Αυτό σημαίνει ότι κάθε ένα από αυτά έχει διατηρήσει ένα διαφορετικό υποσύνολο από το αρχικό σύνολο των CNEs που κληρονόμησαν από τον κοινό πρόγονο τελεόστεων τετραπόδων. Από την ανάλυση, συμπεραίνουμε ότι τα 103 CNEs που βρέθηκαν στην παρούσα εργασία δι

6 9 th Symposium on Oceanography & Fisheries, Proceedings, Volume ΙΙ ατηρούν τα χαρακτηριστικά των CNEs που έχουν αναγνωριστεί και σε άλλες μελέτες (Bejerano et al., 2004; Woolfe et al., 2005 κ.λπ.), όπως: συγκέντρωση σε ομάδες (clusters), συνταινία, υπεραντιπροσώπευση γονιδίων που σχετίζονται με τη μεταγραφή στο σύνολο των γειτονικών τους γονιδίων, βρίσκονται «κοντά» σε γονίδια (μέσα στα πλαίσια που έχουν οριστεί για την αλληλεπίδραση στοιχείων με γονίδια). Τέλος, ιδιαίτερα σημαντική είναι η ανίχνευση 46 νέων CNEs. Τα στοιχεία αυτά φαίνεται να είναι ιδιαίτερα σημαντικά για την εξέλιξη των γονιδιωμάτων των σπονδυλωτών και κρίνεται απαραίτητη η περαιτέρω διερεύνηση του ρόλου τους που μέχρι τώρα παραμένει σε μεγάλο βαθμό άγνωστος. 5. Ευχαριστίες Η μελέτη χρηματοδοτήθηκε από το έργο «Αριστεία του Ι.ΘΑ.ΒΙ.Γ.-ΕΛ.ΚΕ.Θ.Ε. (Επιχειρησιακό Σχέδιο )», από το οποίο επίσης χορηγήθηκε υποτροφία για την εκπόνηση ΜΤΕ στην Τ. Μανουσάκη. 6. Βιβλιογραφικές Αναφορές Bejerano, G., Pheasant, M., Makunin, I., Stephen, S., Kent, W.J., Mattick, J.S. & Haussler, D., Ultraconserved elements in the human genome. Science, 304: Ludwig, M.Z Functional evolution of noncoding DNA. Current Opinion in Genetics & Development, 12(6): Elgar, G. & Vavouri, T., Tuning in to the signals: noncoding sequence conservation in vertebrate genomes. Trends in Genetics, 24: Hedges, S.B. & Kumar, S., Genomic clocks and evolutionary timescales. Trends in Genetics, 19: Stephen, S., Pheasant, M., Makunin, I. V. & Mattick, J. S Large-Scale Appearance of Ultraconserved Elements in Tetrapod Genomes and Slowdown of the Molecular Clock. Molecular Biology and Evolution, 25(2): Volff, J.N., 2005.Genome evolution and biodiversity in teleost fish. Heredity, 94(3): Voorrips, R.E., MapChart: software for the graphical presentation of linkage maps and QTLs. Journal of Heredity, 93: Woolfe, A., Goodson, M., Goode, D.K., Snell, P., Mcewen, G.K., Vavouri, T., Smith, S.F., North, P., Callaway, H., Kelly, K., Walter, K., Abnizova, I., Gilks, W., Edwards, Y.J., Cooke, J.E. & Elgar, G., Highly conserved non-coding sequences are associated with vertebrate development. PloS Biology, 3:

ΕΘΝΙΚΟ ΜΕΤΣΟΒΙΟ ΠΟΛΥΤΕΧΝΕΙΟ

ΕΘΝΙΚΟ ΜΕΤΣΟΒΙΟ ΠΟΛΥΤΕΧΝΕΙΟ ΕΘΝΙΚΟ ΜΕΤΣΟΒΙΟ ΠΟΛΥΤΕΧΝΕΙΟ ΣΧΟΛΗ ΗΛΕΚΤΡΟΛΟΓΩΝ ΜΗΧΑΝΙΚΩΝ ΚΑΙ ΜΗΧΑΝΙΚΩΝ ΥΠΟΛΟΓΙΣΤΩΝ ΤΟΜΕΑΣ ΤΕΧΝΟΛΟΓΙΑΣ ΠΛΗΡΟΦΟΡΙΚΗΣ ΚΑΙ ΥΠΟΛΟΓΙΣΤΩΝ Σύστημα Διαχείρισης Διαχρονικών Δεδομένων για Γονίδια ΔΙΠΛΩΜΑΤΙΚΗ ΕΡΓΑΣΙΑ

Διαβάστε περισσότερα

Splice site recognition between different organisms

Splice site recognition between different organisms NATIONAL AND KAPODISTRIAN UNIVERSITY OF ATHENS SCHOOL OF SCIENCE DEPARTMENT OF INFORMATICS AND TELECOMMUNICATIONS INTERDEPARTMENTAL POSTGRADUATE PROGRAM "INFORMATION TECHNOLOGIES IN MEDICINE AND BIOLOGY"

Διαβάστε περισσότερα

Βιοπληροφορική Ι. Παντελής Μπάγκος. Παν/µιο Στερεάς Ελλάδας

Βιοπληροφορική Ι. Παντελής Μπάγκος. Παν/µιο Στερεάς Ελλάδας Βιοπληροφορική Ι Παντελής Μπάγκος Παν/µιο Στερεάς Ελλάδας Λαµία 2006 1 Βιοπληροφορική Ι Εισαγωγή: Ορισµός της Βιοπληροφορικής, Υποδιαιρέσεις της Βιοπληροφορικής, Τα είδη των δεδοµένων στη Βιοπληροφορική.

Διαβάστε περισσότερα

Βάσεις δεδομένων χαρτογράφησης γονιδιωμάτων

Βάσεις δεδομένων χαρτογράφησης γονιδιωμάτων Βάσεις δεδομένων χαρτογράφησης γονιδιωμάτων Vasilis Promponas Bioinformatics Research Laboratory Department of Biological Sciences University of Cyprus http://en.wikipedia.org/wiki/image:cyprus_topo.png

Διαβάστε περισσότερα

Εθνικό και Καποδιστριακό Πανεπιστήμιο Αθηνών ΣΧΟΛΗ ΘΕΤΙΚΩΝ ΕΠΙΣΤΗΜΩΝ ΤΜΗΜΑ ΒΙΟΛΟΓΙΑΣ ΤΟΜΕΑΣ ΒΙΟΧΗΜΕΙΑΣ ΚΑΙ ΜΟΡΙΑΚΗΣ ΒΙΟΛΟΓΙΑΣ ΔΙΔΑΚΤΟΡΙΚΗ ΔΙΑΤΡΙΒΗ

Εθνικό και Καποδιστριακό Πανεπιστήμιο Αθηνών ΣΧΟΛΗ ΘΕΤΙΚΩΝ ΕΠΙΣΤΗΜΩΝ ΤΜΗΜΑ ΒΙΟΛΟΓΙΑΣ ΤΟΜΕΑΣ ΒΙΟΧΗΜΕΙΑΣ ΚΑΙ ΜΟΡΙΑΚΗΣ ΒΙΟΛΟΓΙΑΣ ΔΙΔΑΚΤΟΡΙΚΗ ΔΙΑΤΡΙΒΗ ΕΛΛΗΝΙΚΗ ΔΗΜΟΚΡΑΤΙΑ Εθνικό και Καποδιστριακό Πανεπιστήμιο Αθηνών ΣΧΟΛΗ ΘΕΤΙΚΩΝ ΕΠΙΣΤΗΜΩΝ ΤΜΗΜΑ ΒΙΟΛΟΓΙΑΣ ΤΟΜΕΑΣ ΒΙΟΧΗΜΕΙΑΣ ΚΑΙ ΜΟΡΙΑΚΗΣ ΒΙΟΛΟΓΙΑΣ ΔΙΔΑΚΤΟΡΙΚΗ ΔΙΑΤΡΙΒΗ ΥΠΟΛΟΓΙΣΤΙΚΗ ΜΕΛΕΤΗ ΤΗΣ ΔΟΜΗΣ ΚΑΙ

Διαβάστε περισσότερα

ΕΝΔΕΙΚΤΙΚΕΣ ΑΠΑΝΤΗΣΕΙΣ ΒΙΟΛΟΓΙΑΣ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ

ΕΝΔΕΙΚΤΙΚΕΣ ΑΠΑΝΤΗΣΕΙΣ ΒΙΟΛΟΓΙΑΣ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ ΕΝΔΕΙΚΤΙΚΕΣ ΑΠΑΝΤΗΣΕΙΣ ΒΙΟΛΟΓΙΑΣ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ ΘΕΜΑ Α Α1 δ Α2 γ Α3 β Α4 γ Α5 β ΘΕΜΑ Β Β1 Κατά σειρά τα βήματα που οδηγούν στην κατασκευή του καρυότυπου είναι τα ακόλουθα: 4 2 1 6 3 5 Β2 α DNA πολυμεράσες

Διαβάστε περισσότερα

ΣΤΟΙΧΕΙΑ ΠΟΙΚΙΛΟΤΗΤΑΣ ΚΑΙ ΚΑΤΑ ΜΗΚΟΣ ΣΥΝΘΕΣΕΙΣ 4 ΕΙΔΩΝ ΨΑΡΙΩΝ ΑΝΑ ΑΛΙΕΥΤΙΚΟ ΕΡΓΑΛΕΙΟ ΣΤΟΝ ΚΕΡΚΥΡΑΪΚΟ

ΣΤΟΙΧΕΙΑ ΠΟΙΚΙΛΟΤΗΤΑΣ ΚΑΙ ΚΑΤΑ ΜΗΚΟΣ ΣΥΝΘΕΣΕΙΣ 4 ΕΙΔΩΝ ΨΑΡΙΩΝ ΑΝΑ ΑΛΙΕΥΤΙΚΟ ΕΡΓΑΛΕΙΟ ΣΤΟΝ ΚΕΡΚΥΡΑΪΚΟ 9 ο Πανελλήνιο Συμπόσιο Ωκεανογραφίας & Αλιείας 2009 - Πρακτικά, Τόμος ΙΙ ΣΤΟΙΧΕΙΑ ΠΟΙΚΙΛΟΤΗΤΑΣ ΚΑΙ ΚΑΤΑ ΜΗΚΟΣ ΣΥΝΘΕΣΕΙΣ 4 ΕΙΔΩΝ ΨΑΡΙΩΝ ΑΝΑ ΑΛΙΕΥΤΙΚΟ ΕΡΓΑΛΕΙΟ ΣΤΟΝ ΚΕΡΚΥΡΑΪΚΟ Παπαδοπούλου Κ.-Ν., Λιουδάκης

Διαβάστε περισσότερα

Βαρβάρα Τραχανά Επίκουρος Καθηγήτρια Κυτταρικής Βιολογίας

Βαρβάρα Τραχανά Επίκουρος Καθηγήτρια Κυτταρικής Βιολογίας Διαλέξεις Βιολογίας ΙI 2014-20152015 Τμήμα Ιατρικής Πανεπιστήμιο Θεσσαλίας Βαρβάρα Τραχανά Επίκουρος Καθηγήτρια Κυτταρικής Βιολογίας Κυτταρική Βιολογία Είναι η ακαδημαϊκή περιοχή που μελετά τα κύτταρα

Διαβάστε περισσότερα

TreeTOPS. ένα εισαγωγικό παιχνίδι για τα φυλογενετικά δέντρα. Teacher s Guide. ELLS European Learning Laboratory for the Life Sciences

TreeTOPS. ένα εισαγωγικό παιχνίδι για τα φυλογενετικά δέντρα. Teacher s Guide. ELLS European Learning Laboratory for the Life Sciences TreeTOPS ένα εισαγωγικό παιχνίδι για τα φυλογενετικά δέντρα Teacher s Guide ELLS European Learning Laboratory for the Life Sciences 1 Γενικός σκοπός Το συγκεκριμένο παιχνίδι έχει ως στόχο να εισάγει τους

Διαβάστε περισσότερα

Department of Biological Sciences, Texas Tech University, MS 43131, Lubbock,Texas 79409-3131. 3

Department of Biological Sciences, Texas Tech University, MS 43131, Lubbock,Texas 79409-3131. 3 1 Τμήμα Βιολογίας, Πανεπιστήμιο Κρήτης, Ηράκλειο Κρήτης. 2 Department of Biological Sciences, Texas Tech University, MS 43131, Lubbock,Texas 79409-3131. 3 Department of Biology, Faculty of Science, Dokuz

Διαβάστε περισσότερα

Chalkou I. C. [PROJECT] Ανάθεση εργασιών.

Chalkou I. C. [PROJECT] Ανάθεση εργασιών. Πληροφορική της Υγείας 2014 Chalkou I. C. [PROJECT] Ανάθεση εργασιών. Περιεχόμενα 1. Ομάδα Γ... 3 1.1 Σαψάκη Δ. - Σαψάκη Π.... 3 1.2 Βλάχου - Γεωργοπούλου... 3 1.3 Μπέρτσου - Τσάμη... 4 1.4 Καραγιάννη

Διαβάστε περισσότερα

Ινστιτούτο Θαλάσσιας Βιολογίας & Γενετικής ΠΤΥΧΙΑΚΗ ΕΡΓΑΣΙΑ

Ινστιτούτο Θαλάσσιας Βιολογίας & Γενετικής ΠΤΥΧΙΑΚΗ ΕΡΓΑΣΙΑ Πανεπιστήµιο Αιγαίου Τµήµα Επιστηµών της Θάλασσας Ινστιτούτο Θαλάσσιας Βιολογίας & Γενετικής Κρήτης (Ι.ΘΑ.ΒΙ.Γ) ΠΤΥΧΙΑΚΗ ΕΡΓΑΣΙΑ «ΧΑΡΤΟΓΡΑΦΗΣΗ ΤΟΥ ΓΟΝΙ ΙΩΜΑΤΟΣ ΤΗΣ ΤΣΙΠΟΥΡΑΣ (Sparus aurata) ΚΑΙ ΣΥΓΚΡΙΣΗ

Διαβάστε περισσότερα

9 th Symposium on Oceanography & Fisheries, 2009 - Proceedings, Volume ΙΙ

9 th Symposium on Oceanography & Fisheries, 2009 - Proceedings, Volume ΙΙ -946-9 th Symposium on Oceanography & Fisheries, 2009 - Proceedings, Volume ΙΙ ΕΠΙΣΚΟΠΗΣΗ ΤΗΣ ΒΙΒΛΙΟΓΡΑΦΙΑΣ ΠΟΥ ΑΦΟΡΑ ΣΤΗ ΧΡΗΣΗ ΔΕΙΚΤΩΝ ΩΣ ΣΥΜΒΟΥΛΕΥΤΙΚΩΝ ΕΡΓΑΛΕΙΩΝ ΣΤΗΝ ΑΛΙΕΥΤΙΚΗ ΔΙΑΧΕΙΡΙΣΗ ΤΗΣ ΜΕΣΟΓΕΙΟΥ

Διαβάστε περισσότερα

Πτυχιακή Εργασία. Παραδοσιακά Προϊόντα Διατροφική Αξία και η Πιστοποίηση τους

Πτυχιακή Εργασία. Παραδοσιακά Προϊόντα Διατροφική Αξία και η Πιστοποίηση τους ΑΛΕΞΑΝΔΡΕΙΟ ΤΕΧΝΟΛΟΓΙΚΟ ΕΚΠΑΙΔΕΥΤΙΚΟ ΙΔΡΥΜΑ ΣΧΟΛΗ ΤΕΧΝΟΛΟΓΙΑΣ ΤΡΟΦΙΜΩΝ ΚΑΙ ΔΙΑΤΡΟΦΗΣ ΤΜΗΜΑ ΔΙΑΤΡΟΦΗΣ ΚΑΙ ΔΙΑΙΤΟΛΟΓΙΑΣ Πτυχιακή Εργασία Παραδοσιακά Προϊόντα Διατροφική Αξία και η Πιστοποίηση τους Εκπόνηση:

Διαβάστε περισσότερα

ΘΕΜΑ 1 Ο ΜΑΘΗΜΑ / ΤΑΞΗ : ΑΠΑΝΤΗΣΕΙΣ ΒΙΟΛΟΓΙΑΣ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ ΣΕΙΡΑ: ΘΕΡΙΝΑ ΗΜΕΡΟΜΗΝΙΑ: 01/12/2013

ΘΕΜΑ 1 Ο ΜΑΘΗΜΑ / ΤΑΞΗ : ΑΠΑΝΤΗΣΕΙΣ ΒΙΟΛΟΓΙΑΣ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ ΣΕΙΡΑ: ΘΕΡΙΝΑ ΗΜΕΡΟΜΗΝΙΑ: 01/12/2013 ΜΑΘΗΜΑ / ΤΑΞΗ : ΑΠΑΝΤΗΣΕΙΣ ΒΙΟΛΟΓΙΑΣ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ ΣΕΙΡΑ: ΘΕΡΙΝΑ ΗΜΕΡΟΜΗΝΙΑ: 01/12/2013 ΘΕΜΑ 1 Ο Να επιλέξετε την φράση που συμπληρώνει ορθά κάθε μία από τις ακόλουθες προτάσεις: 1. Τα

Διαβάστε περισσότερα

ΤΕΧΝΟΛΟΓΙΚΟ ΠΑΝΕΠΙΣΤΗΜΙΟ ΚΥΠΡΟΥ ΣΧΟΛΗ ΕΠΙΣΤΗΜΩΝ ΥΓΕΙΑΣ ΤΜΗΜΑ ΝΟΣΗΛΕΥΤΙΚΗΣ

ΤΕΧΝΟΛΟΓΙΚΟ ΠΑΝΕΠΙΣΤΗΜΙΟ ΚΥΠΡΟΥ ΣΧΟΛΗ ΕΠΙΣΤΗΜΩΝ ΥΓΕΙΑΣ ΤΜΗΜΑ ΝΟΣΗΛΕΥΤΙΚΗΣ ΤΕΧΝΟΛΟΓΙΚΟ ΠΑΝΕΠΙΣΤΗΜΙΟ ΚΥΠΡΟΥ ΣΧΟΛΗ ΕΠΙΣΤΗΜΩΝ ΥΓΕΙΑΣ ΤΜΗΜΑ ΝΟΣΗΛΕΥΤΙΚΗΣ Πτυχιακή Διατριβή Επιβλέπουσα καθηγήτρια: Κα Παναγιώτα Ταμανά ΣΤΑΣΕΙΣ ΚΑΙ ΠΕΠΟΙΘΗΣΕΙΣ ΑΤΟΜΩΝ ΑΠΕΝΑΝΤΙ ΣΤΟ ΕΜΒΟΛΙΟ ΚΑΤΑ ΤΟΥ ΚΑΡΚΙΝΟΥ

Διαβάστε περισσότερα

ΑΠΑΝΤΗΣΕΙΣ. ΘΕΜΑ Α Α1. β Α2. γ Α3. δ Α4. γ Α5. β

ΑΠΑΝΤΗΣΕΙΣ. ΘΕΜΑ Α Α1. β Α2. γ Α3. δ Α4. γ Α5. β ΘΕΜΑ Α Α1. β Α2. γ Α3. δ Α4. γ Α5. β 1 ΕΙΣΑΓΩΓΙΚΕΣ ΕΞΕΤΑΣΕΙΣ ΤΕΚΝΩΝ ΕΛΛΗΝΩΝ ΤΟΥ ΕΞΩΤΕΡΙΚΟΥ ΚΑΙ ΤΕΚΝΩΝ ΕΛΛΗΝΩΝ ΥΠΑΛΛΗΛΩΝ ΣΤΟ ΕΞΩΤΕΡΙΚΟ ΤΕΤΑΡΤΗ 10 ΣΕΠΤΕΜΒΡΙΟΥ 2014 ΕΞΕΤΑΖΟΜΕΝΟ ΜΑΘΗΜΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ:

Διαβάστε περισσότερα

ΕΠΑΝΑΛΗΠΤΙΚΕΣ ΠΑΝΕΛΛΑΔΙΚΕΣ ΕΞΕΤΑΣΕΙΣ Γ ΤΑΞΗΣ ΗΜΕΡΗΣΙΟΥ ΓΕΝΙΚΟΥ ΛΥΚΕΙΟΥ ΠΕΜΠΤΗ 11 ΙΟΥΝΙΟΥ 2015 ΕΞΕΤΑΖΟΜΕΝΟ ΜΑΘΗΜΑ: ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ

ΕΠΑΝΑΛΗΠΤΙΚΕΣ ΠΑΝΕΛΛΑΔΙΚΕΣ ΕΞΕΤΑΣΕΙΣ Γ ΤΑΞΗΣ ΗΜΕΡΗΣΙΟΥ ΓΕΝΙΚΟΥ ΛΥΚΕΙΟΥ ΠΕΜΠΤΗ 11 ΙΟΥΝΙΟΥ 2015 ΕΞΕΤΑΖΟΜΕΝΟ ΜΑΘΗΜΑ: ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ 1 ΕΠΑΝΑΛΗΠΤΙΚΕΣ ΠΑΝΕΛΛΑΔΙΚΕΣ ΕΞΕΤΑΣΕΙΣ Γ ΤΑΞΗΣ ΗΜΕΡΗΣΙΟΥ ΓΕΝΙΚΟΥ ΛΥΚΕΙΟΥ ΠΕΜΠΤΗ 11 ΙΟΥΝΙΟΥ 2015 ΕΞΕΤΑΖΟΜΕΝΟ ΜΑΘΗΜΑ: ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ ΑΠΑΝΤΗΣΕΙΣ ΘΕΜΑ Α Α1. β Α2. γ Α3. α Α4. γ Α5. δ ΘΕΜΑ Β Β1.

Διαβάστε περισσότερα

«ΑΓΡΟΤΟΥΡΙΣΜΟΣ ΚΑΙ ΤΟΠΙΚΗ ΑΝΑΠΤΥΞΗ: Ο ΡΟΛΟΣ ΤΩΝ ΝΕΩΝ ΤΕΧΝΟΛΟΓΙΩΝ ΣΤΗΝ ΠΡΟΩΘΗΣΗ ΤΩΝ ΓΥΝΑΙΚΕΙΩΝ ΣΥΝΕΤΑΙΡΙΣΜΩΝ»

«ΑΓΡΟΤΟΥΡΙΣΜΟΣ ΚΑΙ ΤΟΠΙΚΗ ΑΝΑΠΤΥΞΗ: Ο ΡΟΛΟΣ ΤΩΝ ΝΕΩΝ ΤΕΧΝΟΛΟΓΙΩΝ ΣΤΗΝ ΠΡΟΩΘΗΣΗ ΤΩΝ ΓΥΝΑΙΚΕΙΩΝ ΣΥΝΕΤΑΙΡΙΣΜΩΝ» I ΑΡΙΣΤΟΤΕΛΕΙΟ ΠΑΝΕΠΙΣΤΗΜΙΟ ΘΕΣΣΑΛΟΝΙΚΗΣ ΣΧΟΛΗ ΝΟΜΙΚΩΝ ΟΙΚΟΝΟΜΙΚΩΝ ΚΑΙ ΠΟΛΙΤΙΚΩΝ ΕΠΙΣΤΗΜΩΝ ΤΜΗΜΑ ΟΙΚΟΝΟΜΙΚΩΝ ΕΠΙΣΤΗΜΩΝ ΠΡΟΓΡΑΜΜΑ ΜΕΤΑΠΤΥΧΙΑΚΩΝ ΣΠΟΥΔΩΝ ΣΤΗΝ «ΔΙΟΙΚΗΣΗ ΚΑΙ ΟΙΚΟΝΟΜΙΑ» ΚΑΤΕΥΘΥΝΣΗ: ΟΙΚΟΝΟΜΙΚΗ

Διαβάστε περισσότερα

Περιεχόμενα. 1 Η ιστορία της εξελικτικής βιολογίας: Εξέλιξη και Γενετική 2 Η Προέλευση της Μοριακής Βιολογίας 3 Αποδείξεις για την εξέλιξη 89

Περιεχόμενα. 1 Η ιστορία της εξελικτικής βιολογίας: Εξέλιξη και Γενετική 2 Η Προέλευση της Μοριακής Βιολογίας 3 Αποδείξεις για την εξέλιξη 89 Περιεχόμενα Οι Συγγραφείς Πρόλογος της Ελληνικής Έκδοσης Πρόλογος της Αμερικανικής Έκδοσης Σκοπός και Αντικείμενο του Βιβλίου ΜΕΡΟΣ Ι ΜΙΑ ΕΠΙΣΚΟΠΗΣΗ ΤΗΣ ΕΞΕΛΙΚΤΙΚΗΣ ΒΙΟΛΟΓΙΑΣ 1 Η ιστορία της εξελικτικής

Διαβάστε περισσότερα

Επιβλέπουσα Καθηγήτρια: ΣΟΦΙΑ ΑΡΑΒΟΥ ΠΑΠΑΔΑΤΟΥ

Επιβλέπουσα Καθηγήτρια: ΣΟΦΙΑ ΑΡΑΒΟΥ ΠΑΠΑΔΑΤΟΥ EΛΛΗΝΙΚΗ ΔΗΜΟΚΡΑΤΙΑ ΕΚΠΑΙΔΕΥΤΙΚΟ ΤΕΧΝΟΛΟΓΙΚΟ ΙΔΡΥΜΑ ΤΕΙ ΙΟΝΙΩΝ ΝΗΣΩΝ ΤΜΗΜΑ ΔΗΜΟΣΙΩΝ ΣΧΕΣΕΩΝ & ΕΠΙΚΟΙΝΩΝΙΑΣ Ταχ. Δ/νση : Λεωφ. Αντ.Τρίτση, Αργοστόλι Κεφαλληνίας Τ.Κ. 28 100 τηλ. : 26710-27311 fax : 26710-27312

Διαβάστε περισσότερα

Πανελλήνιες Εξετάσεις Ημερήσιων Γενικών Λυκείων. Εξεταζόμενο Μάθημα: Βιολογία Θετικής Κατεύθυνσης, Ημ/νία: 04 Ιουνίου 2014. Απαντήσεις Θεμάτων

Πανελλήνιες Εξετάσεις Ημερήσιων Γενικών Λυκείων. Εξεταζόμενο Μάθημα: Βιολογία Θετικής Κατεύθυνσης, Ημ/νία: 04 Ιουνίου 2014. Απαντήσεις Θεμάτων Πανελλήνιες Εξετάσεις Ημερήσιων Γενικών Λυκείων Εξεταζόμενο Μάθημα: Βιολογία Θετικής Κατεύθυνσης, Ημ/νία: 04 Ιουνίου 2014 Απαντήσεις Θεμάτων ΘΕΜΑ Α A1. Τα πλασμίδια είναι: δ. κυκλικά δίκλωνα μόρια DNA

Διαβάστε περισσότερα

ΤΕΧΝΟΛΟΓΙΚΟ ΠΑΝΕΠΙΣΤΗΜΙΟ ΚΥΠΡΟΥ ΣΧΟΛΗ ΕΠΙΣΤΗΜΩΝ ΥΓΕΙΑΣ

ΤΕΧΝΟΛΟΓΙΚΟ ΠΑΝΕΠΙΣΤΗΜΙΟ ΚΥΠΡΟΥ ΣΧΟΛΗ ΕΠΙΣΤΗΜΩΝ ΥΓΕΙΑΣ ΤΕΧΝΟΛΟΓΙΚΟ ΠΑΝΕΠΙΣΤΗΜΙΟ ΚΥΠΡΟΥ ΣΧΟΛΗ ΕΠΙΣΤΗΜΩΝ ΥΓΕΙΑΣ Πτυχιακή Εργασία "Η ΣΗΜΑΝΤΙΚΟΤΗΤΑ ΤΟΥ ΜΗΤΡΙΚΟΥ ΘΗΛΑΣΜΟΥ ΣΤΗ ΠΡΟΛΗΨΗ ΤΗΣ ΠΑΙΔΙΚΗΣ ΠΑΧΥΣΑΡΚΙΑΣ" Ειρήνη Σωτηρίου Λεμεσός 2014 ΤΕΧΝΟΛΟΓΙΚΟ ΠΑΝΕΠΙΣΤΗΜΙΟ

Διαβάστε περισσότερα

ΤΕΧΝΟΛΟΓΙΚΟ ΠΑΝΕΠΙΣΤΗΜΙΟ ΚΥΠΡΟΥ ΣΧΟΛΗ ΕΠΙΣΤΗΜΩΝ ΥΓΕΙΑΣ. Πτυχιακή εργασία Η ΚΑΤΑΘΛΙΨΗ ΣΕ ΕΦΗΒΟΥΣ ΜΕ ΣΑΚΧΑΡΩΔΗ ΔΙΑΒΗΤΗ ΤΥΠΟΥ 1

ΤΕΧΝΟΛΟΓΙΚΟ ΠΑΝΕΠΙΣΤΗΜΙΟ ΚΥΠΡΟΥ ΣΧΟΛΗ ΕΠΙΣΤΗΜΩΝ ΥΓΕΙΑΣ. Πτυχιακή εργασία Η ΚΑΤΑΘΛΙΨΗ ΣΕ ΕΦΗΒΟΥΣ ΜΕ ΣΑΚΧΑΡΩΔΗ ΔΙΑΒΗΤΗ ΤΥΠΟΥ 1 ΤΕΧΝΟΛΟΓΙΚΟ ΠΑΝΕΠΙΣΤΗΜΙΟ ΚΥΠΡΟΥ ΣΧΟΛΗ ΕΠΙΣΤΗΜΩΝ ΥΓΕΙΑΣ Πτυχιακή εργασία Η ΚΑΤΑΘΛΙΨΗ ΣΕ ΕΦΗΒΟΥΣ ΜΕ ΣΑΚΧΑΡΩΔΗ ΔΙΑΒΗΤΗ ΤΥΠΟΥ 1 ΑΝΔΡΕΑΣ ΑΝΔΡΕΟΥ Φ.Τ:2008670839 Λεμεσός 2014 ΤΕΧΝΟΛΟΓΙΚΟ ΠΑΝΕΠΙΣΤΗΜΙΟ ΚΥΠΡΟΥ

Διαβάστε περισσότερα

ΤΕΧΝΟΛΟΓΙΚΟ ΠΑΝΕΠΙΣΤΗΜΙΟ ΚΥΠΡΟΥ ΣΧΟΛΗ ΕΠΙΣΤΗΜΩΝ ΥΓΕΙΑΣ ΤΜΗΜΑ ΝΟΣΗΛΕΥΤΙΚΗΣ

ΤΕΧΝΟΛΟΓΙΚΟ ΠΑΝΕΠΙΣΤΗΜΙΟ ΚΥΠΡΟΥ ΣΧΟΛΗ ΕΠΙΣΤΗΜΩΝ ΥΓΕΙΑΣ ΤΜΗΜΑ ΝΟΣΗΛΕΥΤΙΚΗΣ ΤΕΧΝΟΛΟΓΙΚΟ ΠΑΝΕΠΙΣΤΗΜΙΟ ΚΥΠΡΟΥ ΣΧΟΛΗ ΕΠΙΣΤΗΜΩΝ ΥΓΕΙΑΣ ΤΜΗΜΑ ΝΟΣΗΛΕΥΤΙΚΗΣ ΚΑΠΝΙΣΤΙΚΕΣ ΣΥΝΗΘΕΙΕΣ ΓΟΝΕΩΝ ΚΑΙ ΕΠΙΡΡΟΗ ΤΟΥΣ ΣΤΗΝ ΕΝΑΡΞΗ ΤΟΥ ΚΑΠΝΙΣΜΑΤΟΣ ΣΤΟΥΣ ΕΦΗΒΟΥΣ Ονοματεπώνυμο Φοιτήτριας: Χριστοφόρου Έλενα

Διαβάστε περισσότερα

Νέες Τεχνολογίες και Μουσεία: εργαλείο, τροχοπέδη ή συρµός;

Νέες Τεχνολογίες και Μουσεία: εργαλείο, τροχοπέδη ή συρµός; Νέες Τεχνολογίες και Μουσεία: εργαλείο, τροχοπέδη ή συρµός; Μαρία Οικονόµου* ΠΕΡΙΛΗΨΗ Ο χώρος του πολιτισµού έχει κάποιες σηµαντικές ιδιαιτερότητες και χαρακτηριστικά σε σχέση µε το χώρο των επιχειρήσεων,

Διαβάστε περισσότερα

ΤΕΧΝΟΛΟΓΙΚΟ ΠΑΝΕΠΙΣΤΗΜΙΟ ΚΥΠΡΟΥ ΤΜΗΜΑ ΝΟΣΗΛΕΥΤΙΚΗΣ

ΤΕΧΝΟΛΟΓΙΚΟ ΠΑΝΕΠΙΣΤΗΜΙΟ ΚΥΠΡΟΥ ΤΜΗΜΑ ΝΟΣΗΛΕΥΤΙΚΗΣ ΤΕΧΝΟΛΟΓΙΚΟ ΠΑΝΕΠΙΣΤΗΜΙΟ ΚΥΠΡΟΥ ΤΜΗΜΑ ΝΟΣΗΛΕΥΤΙΚΗΣ Επιβλέπων Καθηγητής: Δρ. Νίκος Μίτλεττον Η ΣΧΕΣΗ ΤΟΥ ΜΗΤΡΙΚΟΥ ΘΗΛΑΣΜΟΥ ΜΕ ΤΗΝ ΕΜΦΑΝΙΣΗ ΣΑΚΧΑΡΩΔΗ ΔΙΑΒΗΤΗ ΤΥΠΟΥ 2 ΣΤΗΝ ΠΑΙΔΙΚΗ ΗΛΙΚΙΑ Ονοματεπώνυμο: Ιωσηφίνα

Διαβάστε περισσότερα

ΤΕΧΝΟΛΟΓΙΚΟ ΠΑΝΕΠΙΣΤΗΜΙΟ ΚΥΠΡΟΥ ΣΧΟΛΗ ΕΠΙΣΤΗΜΩΝ ΥΓΕΙΑΣ. Πτυχιακή Εργασία. Κόπωση και ποιότητα ζωής ασθενών με καρκίνο.

ΤΕΧΝΟΛΟΓΙΚΟ ΠΑΝΕΠΙΣΤΗΜΙΟ ΚΥΠΡΟΥ ΣΧΟΛΗ ΕΠΙΣΤΗΜΩΝ ΥΓΕΙΑΣ. Πτυχιακή Εργασία. Κόπωση και ποιότητα ζωής ασθενών με καρκίνο. ΤΕΧΝΟΛΟΓΙΚΟ ΠΑΝΕΠΙΣΤΗΜΙΟ ΚΥΠΡΟΥ ΣΧΟΛΗ ΕΠΙΣΤΗΜΩΝ ΥΓΕΙΑΣ Πτυχιακή Εργασία Κόπωση και ποιότητα ζωής ασθενών με καρκίνο Μαργαρίτα Μάου Λευκωσία 2012 ΤΕΧΝΟΛΟΓΙΚΟ ΠΑΝΕΠΙΣΤΗΜΙΟ ΚΥΠΡΟΥ ΣΧΟΛΗ ΕΠΙΣΤΗΜΩΝ ΥΓΕΙΑΣ ΤΜΗΜΑ

Διαβάστε περισσότερα

Η θέση ύπνου του βρέφους και η σχέση της με το Σύνδρομο του αιφνίδιου βρεφικού θανάτου. ΤΕΧΝΟΛΟΓΙΚΟ ΠΑΝΕΠΙΣΤΗΜΙΟ ΚΥΠΡΟΥ ΣΧΟΛΗ ΕΠΙΣΤΗΜΩΝ ΥΓΕΙΑΣ

Η θέση ύπνου του βρέφους και η σχέση της με το Σύνδρομο του αιφνίδιου βρεφικού θανάτου. ΤΕΧΝΟΛΟΓΙΚΟ ΠΑΝΕΠΙΣΤΗΜΙΟ ΚΥΠΡΟΥ ΣΧΟΛΗ ΕΠΙΣΤΗΜΩΝ ΥΓΕΙΑΣ ΤΕΧΝΟΛΟΓΙΚΟ ΠΑΝΕΠΙΣΤΗΜΙΟ ΚΥΠΡΟΥ ΣΧΟΛΗ ΕΠΙΣΤΗΜΩΝ ΥΓΕΙΑΣ ΠΤΥΧΙΑΚΗ ΕΡΓΑΣΙΑ Η θέση ύπνου του βρέφους και η σχέση της με το Σύνδρομο του αιφνίδιου βρεφικού θανάτου. Χρυσάνθη Στυλιανού Λεμεσός 2014 ΤΕΧΝΟΛΟΓΙΚΟ

Διαβάστε περισσότερα

Νόσος Parkinson-Νέοι ορίζοντες Ξηροµερήσιου Γεωργία Νευρολόγος-Μέλος ερευνητικής οµάδας Νευρογενετικής Αίτια της νόσου Parkinson Περιβαλλοντικοί παράγοντες Γενετικοί παράγοντες Γενετική βλάβη (παθογόνα

Διαβάστε περισσότερα

ΠΕΡΙΕΧΟΜΕΝΑ. Μάρκετινγκ Αθλητικών Τουριστικών Προορισμών 1

ΠΕΡΙΕΧΟΜΕΝΑ. Μάρκετινγκ Αθλητικών Τουριστικών Προορισμών 1 ΠΑΝΕΠΙΣΤΗΜΙΟ ΑΙΓΑΙΟΥ ΣΧΟΛΗ ΕΠΙΣΤΗΜΩΝ ΤΗΣ ΔΙΟΙΚΗΣΗΣ ΤΜΗΜΑ ΔΙΟΙΚΗΣΗΣ ΕΠΙΧΕΙΡΗΣΕΩΝ ΔΙΑΤΜΗΜΑΤΙΚΟ ΠΡΟΓΡΑΜΜΑ ΜΕΤΑΠΤΥΧΙΑΚΩΝ ΣΠΟΥΔΩΝ «Σχεδιασμός, Διοίκηση και Πολιτική του Τουρισμού» ΜΑΡΚΕΤΙΝΓΚ ΑΘΛΗΤΙΚΩΝ ΤΟΥΡΙΣΤΙΚΩΝ

Διαβάστε περισσότερα

Μελέτη της έκφρασης του ογκοκατασταλτικού γονιδίου Cyld στον καρκίνο του μαστού

Μελέτη της έκφρασης του ογκοκατασταλτικού γονιδίου Cyld στον καρκίνο του μαστού Σχολή Θετικών Επιστημών Τμήμα Βιολογίας Πρόγραμμα Μεταπτυχιακών Σπουδών Κατεύθυνση: Εφαρμοσμένη γενετική και βιοτεχνολογία ΜΕΤΑΠΤΥΧΙΑΚΗ ΔΙΠΛΩΜΑΤΙΚΗ ΕΡΓΑΣΙΑ Μελέτη της έκφρασης του ογκοκατασταλτικού γονιδίου

Διαβάστε περισσότερα

ΒΙΟΛΟΓΙΑ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ 16-2-2014 ΘΕΜΑ 1 ο Α. Να βάλετε σε κύκλο το γράμμα που αντιστοιχεί στη σωστή απάντηση. (Μονάδες 25)

ΒΙΟΛΟΓΙΑ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ 16-2-2014 ΘΕΜΑ 1 ο Α. Να βάλετε σε κύκλο το γράμμα που αντιστοιχεί στη σωστή απάντηση. (Μονάδες 25) ΤΣΙΜΙΣΚΗ &ΚΑΡΟΛΟΥ ΝΤΗΛ ΓΩΝΙΑ THΛ: 270727 222594 ΑΡΤΑΚΗΣ 12 - Κ. ΤΟΥΜΠΑ THΛ: 919113 949422 ΕΠΩΝΥΜΟ:... ΟΝΟΜΑ:... ΤΜΗΜΑ:... ΗΜΕΡΟΜΗΝΙΑ:... ΒΙΟΛΟΓΙΑ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ 16-2-2014 ΘΕΜΑ 1 ο Α. Να βάλετε σε

Διαβάστε περισσότερα

ΕΘΝΙΚΟ ΜΕΤΣΟΒΙΟ ΠΟΛΥΤΕΧΝΕΙΟ

ΕΘΝΙΚΟ ΜΕΤΣΟΒΙΟ ΠΟΛΥΤΕΧΝΕΙΟ ΕΘΝΙΚΟ ΜΕΤΣΟΒΙΟ ΠΟΛΥΤΕΧΝΕΙΟ ΣΧΟΛΗ ΗΛΕΚΤΡΟΛΟΓΩΝ ΜΗΧΑΝΙΚΩΝ ΚΑΙ ΜΗΧΑΝΙΚΩΝ ΥΠΟΛΟΓΙΣΤΩΝ ΤΟΜΕΑΣ ΤΕΧΝΟΛΟΓΙΑΣ ΠΛΗΡΟΦΟΡΙΚΗΣ ΚΑΙ ΥΠΟΛΟΓΙΣΤΩΝ Σημασιολογική Συσταδοποίηση Αντικειμένων Με Χρήση Οντολογικών Περιγραφών.

Διαβάστε περισσότερα

Βιοπληροψορική, συσιημική βιολογία και εξατομικευμένη θεραπεία

Βιοπληροψορική, συσιημική βιολογία και εξατομικευμένη θεραπεία Βιοπληροψορική, συσιημική βιολογία και εξατομικευμένη θεραπεία Φραγκίσκος Κολίσης Καθηγητής Βιοτεχνολογίας, Σχολή Χημικών Μηχανικών ΕΜΠ, Διευθυντής Ινστιτούτου Βιολογικών Ερευνών και Βιοτεχνολογίας, EIE

Διαβάστε περισσότερα

Δασική Γενετική Εισαγωγή: Βασικές έννοιες

Δασική Γενετική Εισαγωγή: Βασικές έννοιες Δασική Γενετική Εισαγωγή: Βασικές έννοιες Χειμερινό εξάμηνο 2014-2015 Γενετική Πειραματική επιστήμη της κληρονομικότητας Προέκυψε από την ανάγκη κατανόησης της κληρονόμησης οικονομικά σημαντικών χαρακτηριστικών

Διαβάστε περισσότερα

ΑΝΟΙΧΤΑ ΑΚΑΔΗΜΑΙΚΑ ΜΑΘΗΜΑΤΑ ΑΡΙΣΤΟΤΕΛΕΙΟ ΠΑΝΕΠΙΣΤΗΜΙΟ ΘΕΣΣΑΛΟΝΙΚΗΣ ΒΙΟΠΛΗΡΟΦΟΡΙΚΗ. Ενότητα 1 η : Εισαγωγή. Ηλίας Καππάς Τμήμα Βιολογίας

ΑΝΟΙΧΤΑ ΑΚΑΔΗΜΑΙΚΑ ΜΑΘΗΜΑΤΑ ΑΡΙΣΤΟΤΕΛΕΙΟ ΠΑΝΕΠΙΣΤΗΜΙΟ ΘΕΣΣΑΛΟΝΙΚΗΣ ΒΙΟΠΛΗΡΟΦΟΡΙΚΗ. Ενότητα 1 η : Εισαγωγή. Ηλίας Καππάς Τμήμα Βιολογίας ΑΡΙΣΤΟΤΕΛΕΙΟ ΠΑΝΕΠΙΣΤΗΜΙΟ ΘΕΣΣΑΛΟΝΙΚΗΣ ΑΝΟΙΧΤΑ ΑΚΑΔΗΜΑΙΚΑ ΜΑΘΗΜΑΤΑ ΒΙΟΠΛΗΡΟΦΟΡΙΚΗ Ενότητα 1 η : Εισαγωγή Ηλίας Καππάς Άδειες Χρήσης Το παρόν εκπαιδευτικό υλικό υπόκειται σε άδειες χρήσης Creative Commons.

Διαβάστε περισσότερα

ΠΡΟΤΕΙΝΟΜΕΝΕΣ ΑΠΑΝΤΗΣΕΙΣ ΒΙΟΛΟΓΙΑ ΚΑΤΕΥΘΥΝΣΗΣ 2014

ΠΡΟΤΕΙΝΟΜΕΝΕΣ ΑΠΑΝΤΗΣΕΙΣ ΒΙΟΛΟΓΙΑ ΚΑΤΕΥΘΥΝΣΗΣ 2014 ΦΡΟΝΤΙΣΤΗΡΙΑ ΜΕΣΗΣ ΕΚΠΑΙΔΕΥΣΗΣ : - ΠΡΟΤΕΙΝΟΜΕΝΕΣ ΑΠΑΝΤΗΣΕΙΣ ΒΙΟΛΟΓΙΑ ΚΑΤΕΥΘΥΝΣΗΣ 2014 ΘΕΜΑ A Α1. δ Α2. γ Α3. β Α4. γ Α5. β ΘΕΜΑ B Β1. 4 2 1 6 3 5 Β2. α. DNA πολυμεράση β. Πριμόσωμα γ. DNA δεσμάση δ. DNA

Διαβάστε περισσότερα

ΤΕΧΝΟΛΟΓΙΚΟ ΠΑΝΕΠΙΣΤΗΜΙΟ ΚΥΠΡΟΥ ΣΧΟΛΗ ΕΠΙΣΤΗΜΩΝ ΥΓΕΙΑΣ ΤΜΗΜΑ ΝΟΣΗΛΕΥΤΙΚΗΣ

ΤΕΧΝΟΛΟΓΙΚΟ ΠΑΝΕΠΙΣΤΗΜΙΟ ΚΥΠΡΟΥ ΣΧΟΛΗ ΕΠΙΣΤΗΜΩΝ ΥΓΕΙΑΣ ΤΜΗΜΑ ΝΟΣΗΛΕΥΤΙΚΗΣ 0 ΤΕΧΝΟΛΟΓΙΚΟ ΠΑΝΕΠΙΣΤΗΜΙΟ ΚΥΠΡΟΥ ΣΧΟΛΗ ΕΠΙΣΤΗΜΩΝ ΥΓΕΙΑΣ ΤΜΗΜΑ ΝΟΣΗΛΕΥΤΙΚΗΣ ΠΤΥΧΙΑΚΗ ΕΡΓΑΣΙΑ Επιβλέπων Καθηγητής: Δρ. Βασίλειος Ραφτόπουλος ΔΙΕΡΕΥΝΗΣΗ ΤΗΣ ΣΤΑΣΗΣ ΤΩΝ ΝΟΣΗΛΕΥΤΩΝ ΓΙΑ ΤΗΝ ΕΥΘΑΝΑΣΙΑ Ονοματεπώνυμο:

Διαβάστε περισσότερα

ΑΝΑΠΤΥΞΗ ΤΟΥ ΠΤΥΧΙΑΚΗ. Λεμεσός

ΑΝΑΠΤΥΞΗ ΤΟΥ ΠΤΥΧΙΑΚΗ. Λεμεσός ΤΕΧΝΟΛΟΓΙΚΟ ΠΑΝΕΠΙΣΤΗΜΙΟ ΚΥΠΡΟΥ ΤΜΗΜΑ ΝΟΣΗΛΕΥΤΙΚΗΣ ΤΟ ΚΑΠΝΙΣΜΑ ΚΑΤΑ ΤΗΝ ΕΓΚΥΜΟΣΥΝΗ ΚΑΙ Η ΒΛΑΠΤΙΚΗ ΕΠΙΔΡΑ ΑΣΗ ΤΟΥ ΣΤΗΝ ΑΝΑΠΤΥΞΗ ΤΟΥ ΝΕΟΓΝΟΥ ΠΤΥΧΙΑΚΗ ΕΡΓΑΣΙΑ Ονοματεπώνυμο Αγγελική Παπαπαύλου Αριθμός Φοιτητικής

Διαβάστε περισσότερα

ΔΙΠΛΩΜΑΤΙΚΗ ΕΡΓΑΣΙΑ. Τα γνωστικά επίπεδα των επαγγελματιών υγείας Στην ανοσοποίηση κατά του ιού της γρίπης Σε δομές του νομού Λάρισας

ΔΙΠΛΩΜΑΤΙΚΗ ΕΡΓΑΣΙΑ. Τα γνωστικά επίπεδα των επαγγελματιών υγείας Στην ανοσοποίηση κατά του ιού της γρίπης Σε δομές του νομού Λάρισας ΠΑΝΕΠΙΣΤΗΜΙΟ ΘΕΣΣΑΛΙΑΣ ΣΧΟΛΗ ΕΠΙΣΤΗΜΩΝ ΥΓΕΙΑΣ ΤΜΗΜΑ ΙΑΤΡΙΚΗΣ ΠΡΟΓΡΑΜΜΑ ΜΕΤΑΠΤΥΧΙΑΚΩΝ ΣΠΟΥΔΩΝ ΠΡΩΤΟΒΑΘΜΙΑ ΦΡΟΝΤΙΔΑ ΥΓΕΙΑΣ ΔΙΠΛΩΜΑΤΙΚΗ ΕΡΓΑΣΙΑ Τα γνωστικά επίπεδα των επαγγελματιών υγείας Στην ανοσοποίηση

Διαβάστε περισσότερα

ΣτοιχεΙα βιολογιας και οικολογιας δυο βαθυβιων ψαριων του Ν.Α. ΙονΙου

ΣτοιχεΙα βιολογιας και οικολογιας δυο βαθυβιων ψαριων του Ν.Α. ΙονΙου -822-9 th Symposium on Oceanography & Fisheries, 2009 - Proceedings, Volume ΙΙ ΣτοιχεΙα βιολογιας και οικολογιας δυο βαθυβιων ψαριων του Ν.Α. ΙονΙου Αναστασοπούλου Α., Βασιλοπούλου B. Ινστιτούτο Θαλάσσιων

Διαβάστε περισσότερα

ΠΤΥΧΙΑΚΗ ΕΡΓΑΣΙΑ ΜΗΤΡΙΚΟΣ ΘΗΛΑΣΜΟΣ ΚΑΙ ΠΑΙΔΙΚΗ ΠΑΧΥΣΑΡΚΙΑ

ΠΤΥΧΙΑΚΗ ΕΡΓΑΣΙΑ ΜΗΤΡΙΚΟΣ ΘΗΛΑΣΜΟΣ ΚΑΙ ΠΑΙΔΙΚΗ ΠΑΧΥΣΑΡΚΙΑ ΤΕΧΝΟΛΟΓΙΚΟ ΠΑΝΕΠΙΣΤΗΜΙΟ ΚΥΠΡΟΥ ΤΜΗΜΑ ΝΟΣΗΛΕΥΤΙΚΗΣ ΠΤΥΧΙΑΚΗ ΕΡΓΑΣΙΑ ΜΗΤΡΙΚΟΣ ΘΗΛΑΣΜΟΣ ΚΑΙ ΠΑΙΔΙΚΗ ΠΑΧΥΣΑΡΚΙΑ Ονοματεπώνυμο: Μιχαέλλα Σάββα Λεμεσός 2014 ΤΕΧΝΟΛΟΓΙΚΟ ΠΑΝΕΠΙΣΤΗΜΙΟ ΚΥΠΡΟΥ ΤΜΗΜΑ ΝΟΣΗΛΕΥΤΙΚΗΣ

Διαβάστε περισσότερα

Πανελλήνιες Εξετάσεις Ημερήσιων Γενικών Λυκείων. Εξεταζόμενο Μάθημα: Βιολογία Θετικής Κατεύθυνσης, Ημ/νία: 04 Ιουνίου 2014. Απαντήσεις Θεμάτων

Πανελλήνιες Εξετάσεις Ημερήσιων Γενικών Λυκείων. Εξεταζόμενο Μάθημα: Βιολογία Θετικής Κατεύθυνσης, Ημ/νία: 04 Ιουνίου 2014. Απαντήσεις Θεμάτων Πανελλήνιες Εξετάσεις Ημερήσιων Γενικών Λυκείων Εξεταζόμενο Μάθημα: Βιολογία Θετικής Κατεύθυνσης, Ημ/νία: 04 Ιουνίου 2014 Απαντήσεις Θεμάτων ΘΕΜΑ Α A1. Τα πλασμίδια είναι: δ. κυκλικά δίκλωνα μόρια DNA

Διαβάστε περισσότερα

EΞΕΛΙΚΤΙΚΗ ΟΙΚΟΛΟΓΙΑ. Εισηγητής Επικ. Καθ. Πουλακάκης Νίκος poulakakis@nhmc.uoc.gr

EΞΕΛΙΚΤΙΚΗ ΟΙΚΟΛΟΓΙΑ. Εισηγητής Επικ. Καθ. Πουλακάκης Νίκος poulakakis@nhmc.uoc.gr EΞΕΛΙΚΤΙΚΗ ΟΙΚΟΛΟΓΙΑ Εισηγητής Επικ. Καθ. Πουλακάκης Νίκος poulakakis@nhmc.uoc.gr Διαλέξεις Μία φορά την εβδομάδα Τρίτη 14:00-17:00 A.Περιγραφή μαθήματος Το μάθημα αποτελεί μία εισαγωγή σε αυτό που σήμερα

Διαβάστε περισσότερα

ΠΑΝΕΠΙΣΤΗΜΙΟ ΠΑΤΡΩΝ ΠΟΛΥΤΕΧΝΙΚΗ ΣΧΟΛΗ ΤΜΗΜΑ ΜΗΧΑΝΙΚΩΝ Η/Υ & ΠΛΗΡΟΦΟΡΙΚΗΣ. του Γεράσιμου Τουλιάτου ΑΜ: 697

ΠΑΝΕΠΙΣΤΗΜΙΟ ΠΑΤΡΩΝ ΠΟΛΥΤΕΧΝΙΚΗ ΣΧΟΛΗ ΤΜΗΜΑ ΜΗΧΑΝΙΚΩΝ Η/Υ & ΠΛΗΡΟΦΟΡΙΚΗΣ. του Γεράσιμου Τουλιάτου ΑΜ: 697 ΠΑΝΕΠΙΣΤΗΜΙΟ ΠΑΤΡΩΝ ΠΟΛΥΤΕΧΝΙΚΗ ΣΧΟΛΗ ΤΜΗΜΑ ΜΗΧΑΝΙΚΩΝ Η/Υ & ΠΛΗΡΟΦΟΡΙΚΗΣ ΔΙΠΛΩΜΑΤΙΚΗ ΕΡΓΑΣΙΑ ΣΤΑ ΠΛΑΙΣΙΑ ΤΟΥ ΜΕΤΑΠΤΥΧΙΑΚΟΥ ΔΙΠΛΩΜΑΤΟΣ ΕΙΔΙΚΕΥΣΗΣ ΕΠΙΣΤΗΜΗ ΚΑΙ ΤΕΧΝΟΛΟΓΙΑ ΤΩΝ ΥΠΟΛΟΓΙΣΤΩΝ του Γεράσιμου Τουλιάτου

Διαβάστε περισσότερα

ΑΠΑΝΤΗΣΕΙΣ ΣΤΗ ΒΙΟΛΟΓΙΑ ΚΑΤΕΥΘΥΝΣΗΣ 24 ΜΑΪΟΥ 2013

ΑΠΑΝΤΗΣΕΙΣ ΣΤΗ ΒΙΟΛΟΓΙΑ ΚΑΤΕΥΘΥΝΣΗΣ 24 ΜΑΪΟΥ 2013 ΑΠΑΝΤΗΣΕΙΣ ΣΤΗ ΒΙΟΛΟΓΙΑ ΚΑΤΕΥΘΥΝΣΗΣ 24 ΜΑΪΟΥ 2013 ΘΕΜΑ Α Α1. γ Α2. β Α3. α Α4. δ Α5. α ΘΕΜΑ Β Β1. Σελ. 123 124 σχολ. βιβλίου: «Η διαδικασία που ακολουθείται παράγουν το ένζυμο ADA». Β2. Σελ. 133 σχολ.

Διαβάστε περισσότερα

Ενδεικτικές απαντήσεις βιολογίας κατεύθυνσης 2014

Ενδεικτικές απαντήσεις βιολογίας κατεύθυνσης 2014 Θέμα Α Α1. δ Α2. γ Α3. β Α4. γ Α5. β Θέμα Β ΑΓ.ΚΩΝΣΤΑΝΤΙΝΟΥ 11 -- ΠΕΙΡΑΙΑΣ -- 18532 -- ΤΗΛ. 210-4224752, 4223687 Ενδεικτικές απαντήσεις βιολογίας κατεύθυνσης 2014 Β1. 4 2 1 6 3 5 Β2. α. DNA πολυμεράση

Διαβάστε περισσότερα

Απαντήσεις Θεμάτων Πανελληνίων Εξετάσεων Ημερησίων Γενικών Λυκείων

Απαντήσεις Θεμάτων Πανελληνίων Εξετάσεων Ημερησίων Γενικών Λυκείων 4 Ιουνίου 2014 ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ Απαντήσεις Θεμάτων Πανελληνίων Εξετάσεων Ημερησίων Γενικών Λυκείων ΘΕΜΑ Α Α.1δ Α.2 γ Α.3 β Α.4 γ Α.5 β ΘΕΜΑ Β B.1 4 2 1 6 3 5 B.2 α. DNAπολυμεράση β. πριμόσωμα

Διαβάστε περισσότερα

ΕΞΕΤΑΖΟΜΕΝΟ ΜΑΘΗΜΑ ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ

ΕΞΕΤΑΖΟΜΕΝΟ ΜΑΘΗΜΑ ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ ΕΞΕΤΑΖΟΜΕΝΟ ΜΑΘΗΜΑ ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ ΘΕΜΑ Α Να γράψετε στο τετράδιό σας τον αριθμό καθεμιάς από τις παρακάτω ημιτελείς προτάσεις Α1 έως Α5 και δίπλα το γράμμα που αντιστοιχεί στη λέξη

Διαβάστε περισσότερα

ΤΕΧΝΟΛΟΓΙΚΟ ΠΑΝΕΠΙΣΤΗΜΙΟ ΚΥΠΡΟΥ ΣΧΟΛΗ ΕΠΙΣΤΗΜΩΝ ΥΓΕΙΑΣ

ΤΕΧΝΟΛΟΓΙΚΟ ΠΑΝΕΠΙΣΤΗΜΙΟ ΚΥΠΡΟΥ ΣΧΟΛΗ ΕΠΙΣΤΗΜΩΝ ΥΓΕΙΑΣ ΤΕΧΝΟΛΟΓΙΚΟ ΠΑΝΕΠΙΣΤΗΜΙΟ ΚΥΠΡΟΥ ΣΧΟΛΗ ΕΠΙΣΤΗΜΩΝ ΥΓΕΙΑΣ Πτυχιακή Εργασία Χαμηλά επίπεδα βιταμίνης D σχετιζόμενα με το βρογχικό άσθμα στα παιδιά και στους έφηβους Κουρομπίνα Αλεξάνδρα Λεμεσός [2014] i ΤΕΧΝΟΛΟΓΙΚΟ

Διαβάστε περισσότερα

8ο Πανελλήνιο Συμποσιο Ωκεανογραφίας & Αλιείας 637

8ο Πανελλήνιο Συμποσιο Ωκεανογραφίας & Αλιείας 637 8ο Πανελλήνιο Συμποσιο Ωκεανογραφίας & Αλιείας 637 Υλοποιηση νεων τεχνολογιων (Web GIS, Application Servers) για τη δυναμικη προσβαση μεσω διαδικτυου στη βαση δεδομενων του Ελληνικου Εθνικου Κεντρου Ωκεανογραφικων

Διαβάστε περισσότερα

Χρηματοοικονομική Ανάπτυξη, Θεσμοί και

Χρηματοοικονομική Ανάπτυξη, Θεσμοί και ΑΡΙΣΤΟΤΕΛΕΙΟ ΠΑΝΕΠΙΣΤΗΜΙΟ ΘΕΣΣΑΛΟΝΙΚΗΣ ΣΧΟΛΗ ΝΟΜΙΚΩΝ, ΟΙΚΟΝΟΜΙΚΩΝ ΚΑΙ ΠΟΛΙΤΙΚΩΝ ΕΠΙΣΤΗΜΩΝ ΤΜΗΜΑ ΟΙΚΟΝΟΜΙΚΩΝ ΕΠΙΣΤΗΜΩΝ Τομέας Ανάπτυξης και Προγραμματισμού Χρηματοοικονομική Ανάπτυξη, Θεσμοί και Οικονομική

Διαβάστε περισσότερα

ΤΑ ΣΧΕΔΙΑ ΤΩΝ ΜΑΘΗΤΩΝ Γ ΛΥΚΕΙΟΥ ΤΗΣ ΡΟΔΟΥ ΜΕΤΑ ΤΗΝ ΑΠΟΦΟΙΤΗΣΗ ΤΟΥΣ. ΤΑ ΑΠΟΤΕΛΕΣΜΑΤΑ ΜΙΑΣ ΕΜΠΕΙΡΙΚΗΣ ΕΡΕΥΝΑΣ

ΤΑ ΣΧΕΔΙΑ ΤΩΝ ΜΑΘΗΤΩΝ Γ ΛΥΚΕΙΟΥ ΤΗΣ ΡΟΔΟΥ ΜΕΤΑ ΤΗΝ ΑΠΟΦΟΙΤΗΣΗ ΤΟΥΣ. ΤΑ ΑΠΟΤΕΛΕΣΜΑΤΑ ΜΙΑΣ ΕΜΠΕΙΡΙΚΗΣ ΕΡΕΥΝΑΣ Ελληνικό Στατιστικό Ινστιτούτο Πρακτικά 18 ου Πανελληνίου Συνεδρίου Στατιστικής (2005) σελ.49-54 ΤΑ ΣΧΕΔΙΑ ΤΩΝ ΜΑΘΗΤΩΝ Γ ΛΥΚΕΙΟΥ ΤΗΣ ΡΟΔΟΥ ΜΕΤΑ ΤΗΝ ΑΠΟΦΟΙΤΗΣΗ ΤΟΥΣ. ΤΑ ΑΠΟΤΕΛΕΣΜΑΤΑ ΜΙΑΣ ΕΜΠΕΙΡΙΚΗΣ ΕΡΕΥΝΑΣ

Διαβάστε περισσότερα

ΠΑΝΕΠΙΣΤΗΜΙΟ ΠΑΤΡΩΝ ΣΧΟΛΗ ΑΝΘΡΩΠΙΣΤΙΚΩΝ ΚΑΙ ΚΟΙΝΩΝΙΚΩΝ ΕΠΙΣΤΗΜΩΝ ΤΜΗΜΑ ΦΙΛΟΛΟΓΙΑΣ

ΠΑΝΕΠΙΣΤΗΜΙΟ ΠΑΤΡΩΝ ΣΧΟΛΗ ΑΝΘΡΩΠΙΣΤΙΚΩΝ ΚΑΙ ΚΟΙΝΩΝΙΚΩΝ ΕΠΙΣΤΗΜΩΝ ΤΜΗΜΑ ΦΙΛΟΛΟΓΙΑΣ ΠΑΝΕΠΙΣΤΗΜΙΟ ΠΑΤΡΩΝ ΣΧΟΛΗ ΑΝΘΡΩΠΙΣΤΙΚΩΝ ΚΑΙ ΚΟΙΝΩΝΙΚΩΝ ΕΠΙΣΤΗΜΩΝ ΤΜΗΜΑ ΦΙΛΟΛΟΓΙΑΣ Π.Μ.Σ: «Σύγχρονες Προσεγγίσεις στη γλώσσα και στα κείμενα» ΚΑΤΕΥΘΥΝΣΗ ΓΛΩΣΣΟΛΟΓΙΑΣ ΜΕΤΑΠΤΥΧΙΑΚΗ ΔΙΑΤΡΙΒΗ Το φωνηεντικό

Διαβάστε περισσότερα

γραπτή εξέταση στo μάθημα ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ

γραπτή εξέταση στo μάθημα ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ γραπτή εξέταση στo μάθημα ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ Γ ' ΛΥΚΕΙΟΥ Τάξη: Γ Λυκείου Τμήμα: Βαθμός: Ονοματεπώνυμο: Καθηγητές: ΠΑΣΣΙΑ Α. Θ Ε Μ Α A 1. Να επιλέξετε τη σωστή απάντηση: Α1. Κάθε μεταφορικό RNA

Διαβάστε περισσότερα

ΒΙΟΛΟΓΙΑ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ

ΒΙΟΛΟΓΙΑ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ ΒΙΟΛΟΓΙΑ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ ΑΠΑΝΤΗΣΕΙΣ ΘΕΜΑ Α. Α1. δ Α2. γ Α3. β Α4. γ Α5. β ΘΕΜΑ Β. Β1. 4-2-1-6-3-5 Β2. α) DNA πολυμεράσες β) πριμόσωμα γ) DNA δεσμάσεις δ) DNA ελικάσες ε) RNA πολυμεράσες Β3. σελ 98:

Διαβάστε περισσότερα

ΠΑΝΕΠΙΣΤΗΜΙΟ ΚΥΠΡΟΥ ΕΠΛ 450 ΥΠΟΛΟΓΙΣΤΙΚΗ ΒΙΟΛΟΓΙΑ. Παύλος Αντωνίου

ΠΑΝΕΠΙΣΤΗΜΙΟ ΚΥΠΡΟΥ ΕΠΛ 450 ΥΠΟΛΟΓΙΣΤΙΚΗ ΒΙΟΛΟΓΙΑ. Παύλος Αντωνίου ΠΑΝΕΠΙΣΤΗΜΙΟ ΚΥΠΡΟΥ ΕΠΛ 450 ΥΠΟΛΟΓΙΣΤΙΚΗ ΒΙΟΛΟΓΙΑ Παύλος Αντωνίου Με μια ματιά: Εισαγωγή στη Βιολογία Ευθυγράμμιση Ακολουθιών Αναζήτηση ομοίων ακολουθιών από βάσεις δεδομενων Φυλογενετική πρόβλεψη Πρόβλεψη

Διαβάστε περισσότερα

ΤΕΧΝΟΛΟΓΙΚΟ ΠΑΝΕΠΙΣΤΗΜΙΟ ΚΥΠΡΟΥ ΣΧΟΛΗ ΕΠΙΣΤΗΜΩΝ ΥΓΕΙΑΣ. Πτυχιακή διατριβή Ο ΡΟΛΟΣ ΤΟΥ ΜΗΤΡΙΚΟΥ ΚΑΠΝΙΣΜΑΤΟΣ ΣΤΗΝ ΑΝΑΠΤΥΞΗ ΠΑΙΔΙΚΟΥ ΑΣΘΜΑΤΟΣ

ΤΕΧΝΟΛΟΓΙΚΟ ΠΑΝΕΠΙΣΤΗΜΙΟ ΚΥΠΡΟΥ ΣΧΟΛΗ ΕΠΙΣΤΗΜΩΝ ΥΓΕΙΑΣ. Πτυχιακή διατριβή Ο ΡΟΛΟΣ ΤΟΥ ΜΗΤΡΙΚΟΥ ΚΑΠΝΙΣΜΑΤΟΣ ΣΤΗΝ ΑΝΑΠΤΥΞΗ ΠΑΙΔΙΚΟΥ ΑΣΘΜΑΤΟΣ ΤΕΧΝΟΛΟΓΙΚΟ ΠΑΝΕΠΙΣΤΗΜΙΟ ΚΥΠΡΟΥ ΣΧΟΛΗ ΕΠΙΣΤΗΜΩΝ ΥΓΕΙΑΣ Πτυχιακή διατριβή Ο ΡΟΛΟΣ ΤΟΥ ΜΗΤΡΙΚΟΥ ΚΑΠΝΙΣΜΑΤΟΣ ΣΤΗΝ ΑΝΑΠΤΥΞΗ ΠΑΙΔΙΚΟΥ ΑΣΘΜΑΤΟΣ Φιλίππου Άντρη Λευκωσία 2012 ΤΕΧΝΟΛΟΓΙΚΟ ΠΑΝΕΠΙΣΤΗΜΙΟ ΚΥΠΡΟΥ ΣΧΟΛΗ

Διαβάστε περισσότερα

Πανεπιστήμιο Δυτικής Μακεδονίας. Τμήμα Μηχανικών Πληροφορικής & Τηλεπικοινωνιών. Βιοπληροφορική. Ενότητα 1: Εισαγωγή στη Βιοπληροφορική

Πανεπιστήμιο Δυτικής Μακεδονίας. Τμήμα Μηχανικών Πληροφορικής & Τηλεπικοινωνιών. Βιοπληροφορική. Ενότητα 1: Εισαγωγή στη Βιοπληροφορική Τμήμα Μηχανικών Πληροφορικής & Τηλεπικοινωνιών Βιοπληροφορική Ενότητα 1: Εισαγωγή στη Βιοπληροφορική Αν. καθηγητής Αγγελίδης Παντελής e-mail: paggelidis@uowm.gr ΕΕΔΙΠ Μπέλλου Σοφία e-mail: sbellou@uowm.gr

Διαβάστε περισσότερα

ΘΕΜΑ 1 Ο ΜΑΘΗΜΑ / ΤΑΞΗ : ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ ΣΕΙΡΑ: ΗΜΕΡΟΜΗΝΙΑ: 22/09/2013

ΘΕΜΑ 1 Ο ΜΑΘΗΜΑ / ΤΑΞΗ : ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ ΣΕΙΡΑ: ΗΜΕΡΟΜΗΝΙΑ: 22/09/2013 ΜΑΘΗΜΑ / ΤΑΞΗ : ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ ΣΕΙΡΑ: ΗΜΕΡΟΜΗΝΙΑ: 22/09/2013 ΘΕΜΑ 1 Ο Να επιλέξετε την φράση που συμπληρώνει ορθά κάθε μία από τις ακόλουθες προτάσεις: 1. Το ζεύγος των φυλετικών

Διαβάστε περισσότερα

ΤΕΧΝΟΛΟΓΙΚΟ ΠΑΝΕΠΙΣΤΗΜΙΟ ΚΥΠΡΟΥ ΤΜΗΜΑ ΝΟΣΗΛΕΥΤΙΚΗΣ

ΤΕΧΝΟΛΟΓΙΚΟ ΠΑΝΕΠΙΣΤΗΜΙΟ ΚΥΠΡΟΥ ΤΜΗΜΑ ΝΟΣΗΛΕΥΤΙΚΗΣ ΤΕΧΝΟΛΟΓΙΚΟ ΠΑΝΕΠΙΣΤΗΜΙΟ ΚΥΠΡΟΥ ΤΜΗΜΑ ΝΟΣΗΛΕΥΤΙΚΗΣ ΠΤΥΧΙΑΚΗ ΕΡΓΑΣΙΑ ΨΥΧΟΛΟΓΙΚΕΣ ΕΠΙΠΤΩΣΕΙΣ ΣΕ ΓΥΝΑΙΚΕΣ ΜΕΤΑ ΑΠΟ ΜΑΣΤΕΚΤΟΜΗ ΓΕΩΡΓΙΑ ΤΡΙΣΟΚΚΑ Λευκωσία 2012 ΤΕΧΝΟΛΟΓΙΚΟ ΠΑΝΕΠΙΣΤΗΜΙΟ ΚΥΠΡΟΥ ΣΧΟΛΗ ΕΠΙΣΤΗΜΩΝ

Διαβάστε περισσότερα

Η ΔΙΑΣΤΡΕΥΛΩΣΗ ΤΗΣ ΕΛΛΗΝΙΚΗΣ ΓΛΩΣΣΑΣ ΜΕΣΩ ΤΩΝ SOCIAL MEDIA ΤΗΝ ΤΕΛΕΥΤΑΙΑ ΠΕΝΤΑΕΤΙΑ ΠΤΥΧΙΑΚΗ ΕΡΓΑΣΙΑ ΤΗΣ ΑΝΑΣΤΑΣΙΑΣ-ΜΑΡΙΝΑΣ ΔΑΦΝΗ

Η ΔΙΑΣΤΡΕΥΛΩΣΗ ΤΗΣ ΕΛΛΗΝΙΚΗΣ ΓΛΩΣΣΑΣ ΜΕΣΩ ΤΩΝ SOCIAL MEDIA ΤΗΝ ΤΕΛΕΥΤΑΙΑ ΠΕΝΤΑΕΤΙΑ ΠΤΥΧΙΑΚΗ ΕΡΓΑΣΙΑ ΤΗΣ ΑΝΑΣΤΑΣΙΑΣ-ΜΑΡΙΝΑΣ ΔΑΦΝΗ Η ΔΙΑΣΤΡΕΥΛΩΣΗ ΤΗΣ ΕΛΛΗΝΙΚΗΣ ΓΛΩΣΣΑΣ ΜΕΣΩ ΤΩΝ SOCIAL MEDIA ΤΗΝ ΤΕΛΕΥΤΑΙΑ ΠΕΝΤΑΕΤΙΑ ΠΤΥΧΙΑΚΗ ΕΡΓΑΣΙΑ ΤΗΣ ΑΝΑΣΤΑΣΙΑΣ-ΜΑΡΙΝΑΣ ΔΑΦΝΗ Τμήμα Δημοσίων Σχέσεων & Επικοινωνίας Τεχνολογικό Εκπαιδευτικό Ίδρυμα Ιονίων

Διαβάστε περισσότερα

«-» vasalap@otenet.gr. andreadou@rhodes.aegean.gr - ( ), ( ). -. - -,. - ( ),, - ( ). - /, -.

«-» vasalap@otenet.gr. andreadou@rhodes.aegean.gr - ( ), ( ). -. - -,. - ( ),, - ( ). - /, -. παιδαγωγικά ρεύµατα στο Αιγαίο Θεωρείο 10 «-» 1 vasalap@otenet.gr 2 andreadou@rhodes.aegean.gr - ( ), ( ). -. - -,. - ( ),, - ( ). - /, -. Abstract In the survey we investigated the views of those who

Διαβάστε περισσότερα

ΒΙΟΛΟΓΙΑ ΚΑΤΕΥΘΥΝΣΗΣ

ΒΙΟΛΟΓΙΑ ΚΑΤΕΥΘΥΝΣΗΣ ΘΕΜΑ Α Α1 δ Α2 γ Α3 β Α4 γ Α5 β ΒΙΟΛΟΓΙΑ ΚΑΤΕΥΘΥΝΣΗΣ ΘΕΜΑ Β Β1. 4 2 1 6 3 5 Β2. α. DNA πολυμεράση β. πριμόσωμα γ. DNA δεσμάση δ. DNA ελκάση ε. RNA πολυμεράση Β3. Σχολικό βιβλίο, Σελ.: 98: «Η διάγνωση των

Διαβάστε περισσότερα

ΤΕΧΝΟΛΟΓΙΚΟ ΠΑΝΕΠΙΣΤΗΜΙΟ ΚΥΠΡΟΥ ΣΧΟΛΗ ΕΠΙΣΤΗΜΩΝ ΥΓΕΙΑΣ. Πτυχιακή διατριβή Η ΚΑΤΑΘΛΙΨΗ ΩΣ ΠΑΡΑΓΟΝΤΑΣ ΚΙΝΔΥΝΟΥ ΓΙΑ ΑΠΟΠΕΙΡΑ ΑΥΤΟΚΤΟΝΙΑΣ

ΤΕΧΝΟΛΟΓΙΚΟ ΠΑΝΕΠΙΣΤΗΜΙΟ ΚΥΠΡΟΥ ΣΧΟΛΗ ΕΠΙΣΤΗΜΩΝ ΥΓΕΙΑΣ. Πτυχιακή διατριβή Η ΚΑΤΑΘΛΙΨΗ ΩΣ ΠΑΡΑΓΟΝΤΑΣ ΚΙΝΔΥΝΟΥ ΓΙΑ ΑΠΟΠΕΙΡΑ ΑΥΤΟΚΤΟΝΙΑΣ ΤΕΧΝΟΛΟΓΙΚΟ ΠΑΝΕΠΙΣΤΗΜΙΟ ΚΥΠΡΟΥ ΣΧΟΛΗ ΕΠΙΣΤΗΜΩΝ ΥΓΕΙΑΣ Πτυχιακή διατριβή Η ΚΑΤΑΘΛΙΨΗ ΩΣ ΠΑΡΑΓΟΝΤΑΣ ΚΙΝΔΥΝΟΥ ΓΙΑ ΑΠΟΠΕΙΡΑ ΑΥΤΟΚΤΟΝΙΑΣ Παναγιώτου Νεοφύτα 2008969752 Επιβλέπων καθηγητής Δρ. Νίκος Μίτλεττον,

Διαβάστε περισσότερα

ΤΕΧΝΟΛΟΓΙΚΟ ΠΑΝΕΠΙΣΤΗΜΙΟ ΚΥΠΡΟΥ ΤΜΗΜΑ ΝΟΣΗΛΕΥΤΙΚΗΣ. Πτυχιακή Διατριβή

ΤΕΧΝΟΛΟΓΙΚΟ ΠΑΝΕΠΙΣΤΗΜΙΟ ΚΥΠΡΟΥ ΤΜΗΜΑ ΝΟΣΗΛΕΥΤΙΚΗΣ. Πτυχιακή Διατριβή ΤΕΧΝΟΛΟΓΙΚΟ ΠΑΝΕΠΙΣΤΗΜΙΟ ΚΥΠΡΟΥ ΤΜΗΜΑ ΝΟΣΗΛΕΥΤΙΚΗΣ Πτυχιακή Διατριβή Η ΣΥΝΗΘΕΙΑ ΤΟΥ ΑΛΚΟΟΛ ΚΑΤΑ ΤΗΝ ΠΕΡΙΟΔΟ ΤΗΣ ΕΓΚΥΜΟΣΥΝΗΣ, ΚΑΙ Η ΕΠΙΔΡΑΣΕΙΣ ΤΟΥ ΣΤΟ ΕΜΒΡΥΟ ΣΤΕΦΑΝΗ ΘΡΑΣΥΒΟΥΛΟΥ Λεμεσός 2014 ΤΕΧΝΟΛΟΓΙΚΟ

Διαβάστε περισσότερα

ΠΑΝΕΛΛΑΔΙΚΕΣ ΕΞΕΤΑΣΕΙΣ Γ ΤΑΞΗΣ ΗΜΕΡΗΣΙΟΥ ΓΕΝΙΚΟΥ ΛΥΚΕΙΟΥ ΚΑΙ ΕΠΑΛ (ΟΜΑΔΑ Β) ΤΕΤΑΡΤΗ 4 ΙΟΥΝΙΟΥ 2014 ΕΞΕΤΑΖΟΜΕΝΟ ΜΑΘΗΜΑ: ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ

ΠΑΝΕΛΛΑΔΙΚΕΣ ΕΞΕΤΑΣΕΙΣ Γ ΤΑΞΗΣ ΗΜΕΡΗΣΙΟΥ ΓΕΝΙΚΟΥ ΛΥΚΕΙΟΥ ΚΑΙ ΕΠΑΛ (ΟΜΑΔΑ Β) ΤΕΤΑΡΤΗ 4 ΙΟΥΝΙΟΥ 2014 ΕΞΕΤΑΖΟΜΕΝΟ ΜΑΘΗΜΑ: ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ 1 ΠΑΝΕΛΛΑΔΙΚΕΣ ΕΞΕΤΑΣΕΙΣ Γ ΤΑΞΗΣ ΗΜΕΡΗΣΙΟΥ ΓΕΝΙΚΟΥ ΛΥΚΕΙΟΥ ΚΑΙ ΕΠΑΛ (ΟΜΑΔΑ Β) ΤΕΤΑΡΤΗ 4 ΙΟΥΝΙΟΥ 2014 ΕΞΕΤΑΖΟΜΕΝΟ ΜΑΘΗΜΑ: ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ ΑΠΑΝΤΗΣΕΙΣ ΘΕΜΑ Α Α1. δ Α2. γ Α3. β Α4. γ Α5. β ΘΕΜΑ

Διαβάστε περισσότερα

ΠΕΡΙΛΗΨΗ. Εισαγωγή. Σκοπός

ΠΕΡΙΛΗΨΗ. Εισαγωγή. Σκοπός ΠΕΡΙΛΗΨΗ Εισαγωγή Η παιδική παχυσαρκία έχει φτάσει σε επίπεδα επιδημίας στις μέρες μας. Μαστίζει παιδιά από μικρές ηλικίες μέχρι και σε εφήβους. Συντείνουν αρκετοί παράγοντες που ένα παιδί γίνεται παχύσαρκο

Διαβάστε περισσότερα

ΚΑΠΝΙΣΜΑ ΚΑΙ ΣΥΝΔΡΟΜΟ ΑΙΦΝΙΔΙΟΥ ΒΡΕΦΙΚΟΥ ΘΑΝΑΤΟΥ

ΚΑΠΝΙΣΜΑ ΚΑΙ ΣΥΝΔΡΟΜΟ ΑΙΦΝΙΔΙΟΥ ΒΡΕΦΙΚΟΥ ΘΑΝΑΤΟΥ ΤΕΧΝΟΛΟΓΙΚΟ ΠΑΝΕΠΙΣΤΗΜΙΟ ΚΥΠΡΟΥ ΣΧΟΛΗ ΕΠΙΣΤΗΜΩΝ ΥΓΕΙΑΣ ΠΤΥΧΙΑΚΗ ΕΡΓΑΣΙΑ ΚΑΠΝΙΣΜΑ ΚΑΙ ΣΥΝΔΡΟΜΟ ΑΙΦΝΙΔΙΟΥ ΒΡΕΦΙΚΟΥ ΘΑΝΑΤΟΥ Ονοματεπώνυμο: Λοϊζιά Ελένη Λεμεσός 2012 ΤΕΧΝΟΛΟΓΙΚΟ ΠΑΝΕΠΙΣΤΗΜΙΟ ΚΥΠΡΟΥ ΣΧΟΛΗ ΕΠΙΣΤΗΜΩΝ

Διαβάστε περισσότερα

Πτυχιακή εργασία Ο ΡΟΛΟΣ ΤΩΝ ΚΟΙΝΟΤΙΚΩΝ ΝΟΣΗΛΕΥΤΩΝ ΣΤΗ ΔΙΔΑΣΚΑΛΙΑ ΤΟΥ ΠΑΙΔΙΟΥ ΜΕ ΧΡΟΝΙΟ ΑΣΘΜΑ

Πτυχιακή εργασία Ο ΡΟΛΟΣ ΤΩΝ ΚΟΙΝΟΤΙΚΩΝ ΝΟΣΗΛΕΥΤΩΝ ΣΤΗ ΔΙΔΑΣΚΑΛΙΑ ΤΟΥ ΠΑΙΔΙΟΥ ΜΕ ΧΡΟΝΙΟ ΑΣΘΜΑ ΤΕΧΝΟΛΟΓΙΚΟ ΠΑΝΕΠΙΣΤΗΜΙΟ ΚΥΠΡΟΥ ΣΧΟΛΗ ΕΠΙΣΤΗΜΩΝ ΥΓΕΙΑΣ ΤΜΗΜΑ ΝΟΣΗΛΕΥΤΙΚΗΣ Πτυχιακή εργασία Ο ΡΟΛΟΣ ΤΩΝ ΚΟΙΝΟΤΙΚΩΝ ΝΟΣΗΛΕΥΤΩΝ ΣΤΗ ΔΙΔΑΣΚΑΛΙΑ ΤΟΥ ΠΑΙΔΙΟΥ ΜΕ ΧΡΟΝΙΟ ΑΣΘΜΑ ΟΝΟΜΑΤΕΠΩΝΥΜΟ: ΚΥΡΙΑΚΟΣ ΛΟΙΖΟΥ ΑΡΙΘΜΟΣ

Διαβάστε περισσότερα

ΤΕΧΝΟΛΟΓΙΚΟ ΠΑΝΕΠΙΣΤΗΜΙΟ ΚΥΠΡΟΥ ΣΧΟΛΗ ΕΠΙΣΤΗΜΩΝ ΥΓΕΙΑΣ. Πτυχιακή Εργασία ΕΠΙΛΟΧΕΙΑ ΚΑΤΑΘΛΙΨΗ: Ο ΡΟΛΟΣ ΤΗΣ ΚΑΤ ΟΙΚΟΝ ΝΟΣΗΛΕΙΑΣ. Φοινίκη Αλεξάνδρου

ΤΕΧΝΟΛΟΓΙΚΟ ΠΑΝΕΠΙΣΤΗΜΙΟ ΚΥΠΡΟΥ ΣΧΟΛΗ ΕΠΙΣΤΗΜΩΝ ΥΓΕΙΑΣ. Πτυχιακή Εργασία ΕΠΙΛΟΧΕΙΑ ΚΑΤΑΘΛΙΨΗ: Ο ΡΟΛΟΣ ΤΗΣ ΚΑΤ ΟΙΚΟΝ ΝΟΣΗΛΕΙΑΣ. Φοινίκη Αλεξάνδρου ΤΕΧΝΟΛΟΓΙΚΟ ΠΑΝΕΠΙΣΤΗΜΙΟ ΚΥΠΡΟΥ ΣΧΟΛΗ ΕΠΙΣΤΗΜΩΝ ΥΓΕΙΑΣ Πτυχιακή Εργασία ΕΠΙΛΟΧΕΙΑ ΚΑΤΑΘΛΙΨΗ: Ο ΡΟΛΟΣ ΤΗΣ ΚΑΤ ΟΙΚΟΝ ΝΟΣΗΛΕΙΑΣ Φοινίκη Αλεξάνδρου Λεμεσός 2014 ΤΕΧΝΟΛΟΓΙΚΟ ΠΑΝΕΠΙΣΤΗΜΙΟ ΚΥΠΡΟΥ ΤΜΗΜΑ ΕΠΙΣΤΗΜΩΝ

Διαβάστε περισσότερα

Πανελλαδικές εξετάσεις Γ Τάξης Ημερήσιου Γενικού Λυκείου Βιολογία Θετικής Κατεύθυνσης Τετάρτη 4 Ιουνίου 2014

Πανελλαδικές εξετάσεις Γ Τάξης Ημερήσιου Γενικού Λυκείου Βιολογία Θετικής Κατεύθυνσης Τετάρτη 4 Ιουνίου 2014 Πανελλαδικές εξετάσεις Γ Τάξης Ημερήσιου Γενικού Λυκείου Βιολογία Θετικής Κατεύθυνσης Τετάρτη 4 Ιουνίου 2014 ΘΕΜΑ Α Α1.δ Α2.γ Α3.β Α4.γ Α5.β ΘΕΜΑ Β Β1. 4,2,1,6,3,5 Β2. α. DNA πολυμεράση β. πριμόσωμα γ.

Διαβάστε περισσότερα

AΡΙΣΤΟΤΕΛΕΙΟ ΠΑΝΕΠΙΣΤΗΜΙΟ ΘΕΣΣΑΛΟΝΙΚΗΣ ΠΟΛΥΤΕΧΝΙΚΗ ΣΧΟΛΗ ΤΜΗΜΑ ΠΟΛΙΤΙΚΩΝ ΜΗΧΑΝΙΚΩΝ

AΡΙΣΤΟΤΕΛΕΙΟ ΠΑΝΕΠΙΣΤΗΜΙΟ ΘΕΣΣΑΛΟΝΙΚΗΣ ΠΟΛΥΤΕΧΝΙΚΗ ΣΧΟΛΗ ΤΜΗΜΑ ΠΟΛΙΤΙΚΩΝ ΜΗΧΑΝΙΚΩΝ AΡΙΣΤΟΤΕΛΕΙΟ ΠΑΝΕΠΙΣΤΗΜΙΟ ΘΕΣΣΑΛΟΝΙΚΗΣ ΠΟΛΥΤΕΧΝΙΚΗ ΣΧΟΛΗ ΤΜΗΜΑ ΠΟΛΙΤΙΚΩΝ ΜΗΧΑΝΙΚΩΝ ΠΡΟΓΡΑΜΜΑ ΜΕΤΑΠΤΥΧΙΑΚΩΝ ΣΠΟΥΔΩΝ ΕΙΔΙΚΕΥΣΗΣ ΠΡΟΣΤΑΣΙΑ ΠΕΡΙΒΑΛΛΟΝΤΟΣ ΚΑΙ ΒΙΩΣΙΜΗ ΑΝΑΠΤΥΞΗ ΔΙΕΡΕΥΝΗΣΗ ΤΩΝ ΠΙΕΣΕΩΝ ΣΤΟ ΠΕΡΙΒΑΛΛΟΝ

Διαβάστε περισσότερα

Κυριακή 15/02/2015 Ημερομηνία

Κυριακή 15/02/2015 Ημερομηνία Διαγώνισμα 2014-15 Ενδεικτικές απαντήσεις Κυριακή 15/02/2015 Ημερομηνία Βιολογία Κατεύθυνσης Εξεταζόμενο μάθημα Γ Λυκείου Τάξη Θέμα 1 ο : 1 α, 2 γ, 3 ε, 4 α, 5 ε Θέμα 2 ο : Α. Η απεικόνιση των μεταφασικών

Διαβάστε περισσότερα

Εκπαιδευτήριο TO ΠΑΓΚΡΗΤΙΟΝ Σχολικό Έτος 2007-2008 Συνθετικές εργασίες στο μάθημα Πληροφορική Τεχνολογία της Β Γυμνασίου: Όψεις της Τεχνολογίας

Εκπαιδευτήριο TO ΠΑΓΚΡΗΤΙΟΝ Σχολικό Έτος 2007-2008 Συνθετικές εργασίες στο μάθημα Πληροφορική Τεχνολογία της Β Γυμνασίου: Όψεις της Τεχνολογίας Εκπαιδευτήριο TO ΠΑΓΚΡΗΤΙΟΝ Σχολικό Έτος 2007-2008 Συνθετικές εργασίες στο μάθημα Πληροφορική Τεχνολογία της Β Γυμνασίου: Όψεις της Τεχνολογίας Θέμα: DNA Τμήμα: ΗΥ: Ομάδα: Β2 pc29 Μηλαθιανάκης Μιχάλης

Διαβάστε περισσότερα

ΑΣΚΗΣΕΙΣ στο 2 ο κεφάλαιο

ΑΣΚΗΣΕΙΣ στο 2 ο κεφάλαιο ΑΣΚΗΣΕΙΣ στο 2 ο κεφάλαιο 1. Ένας κλώνος ενός γονιδίου προκαρυωτικού κυττάρου έχει την παρακάτω αλληλουχία βάσεων: AAAATGTATACGGGCGCTGATACGGCAAACCCACTCATGTAA Βρείτε: Α) την αλληλουχία των βάσεων του mrna

Διαβάστε περισσότερα

ΠΑΝΕΠΙΣΤΗΜΙΟ ΚΥΠΡΟΥ ΤΜΗΜΑ ΒΙΟΛΟΓΙΚΩΝ ΕΠΙΣΤΗΜΩΝ

ΠΑΝΕΠΙΣΤΗΜΙΟ ΚΥΠΡΟΥ ΤΜΗΜΑ ΒΙΟΛΟΓΙΚΩΝ ΕΠΙΣΤΗΜΩΝ ΠΑΝΕΠΙΣΤΗΜΙΟ ΚΥΠΡΟΥ ΤΜΗΜΑ ΒΙΟΛΟΓΙΚΩΝ ΕΠΙΣΤΗΜΩΝ (ΒΙΟ 650) Ειδικά Θέματα Βιοπληροφορικής Διδάσκων: Βασίλειος Ι. Προμπονάς, Ph.D. Λέκτορας Βιοπληροφορικής ΓΕΝΙΚΕΣ ΠΛΗΡΟΦΟΡΙΕΣ Διαλέξεις Δευτέρα και Πέμπτη

Διαβάστε περισσότερα

ΑΠΑΝΤΗΣΕΙΣ ΘΕΜΑΤΩΝ ΒΙΟΛΟΓΙΑ ΚΑΤΕΥΘΥΝΣΗΣ 01-06-2004

ΑΠΑΝΤΗΣΕΙΣ ΘΕΜΑΤΩΝ ΒΙΟΛΟΓΙΑ ΚΑΤΕΥΘΥΝΣΗΣ 01-06-2004 ΘΕΜΑ 1ο 1. δ, ΑΠΑΝΤΗΣΕΙΣ ΘΕΜΑΤΩΝ ΒΙΟΛΟΓΙΑ ΚΑΤΕΥΘΥΝΣΗΣ 01-06-2004 2. β, 3. β, 4. γ, 5. δ. ΘΕΜΑ2ο 1. Σχολικό βιβλίο, σελίδα 31: «Υπάρχουν τέσσερα είδη μορίων RNA και το μεταφέρει στη θέση της πρωτεϊνοσύνθεσης».

Διαβάστε περισσότερα

Σχέση στεφανιαίας νόσου και άγχους - κατάθλιψης

Σχέση στεφανιαίας νόσου και άγχους - κατάθλιψης Τρίμηνη, ηλεκτρονική έκδοση του Τμήματος Νοσηλευτικής Α, Τεχνολογικό Εκπαιδευτικό Ίδρυμα Αθήνας _ΑΝΑΣΚΟΠΗΣΗ_ Πολυκανδριώτη Μαρία 1, Φούκα Γεωργία 2 1. Καθηγήτρια Εφαρμογών Νοσηλευτικής Α, ΤΕΙ Αθήνας 2.

Διαβάστε περισσότερα

ΘΕΜΑ Α Α1. γ Α2. γ Α3. α Α4. β Α5. β ΘΕΜΑ B B1. B2.

ΘΕΜΑ Α Α1. γ Α2. γ Α3. α Α4. β Α5. β ΘΕΜΑ B B1. B2. ΘΕΜΑ Α Α1. γ (το πριμόσωμα) Α2. γ (οι υποκινητές και οι μεταγραφικοί παράγοντες κάθε γονιδίου) Α3. α (μεταφέρει ένα συγκεκριμένο αμινοξύ στο ριβόσωμα) Α4. β (αποδιάταξη των δύο συμπληρωματικών αλυσίδων)

Διαβάστε περισσότερα

«Χρήσεις γης, αξίες γης και κυκλοφοριακές ρυθμίσεις στο Δήμο Χαλκιδέων. Η μεταξύ τους σχέση και εξέλιξη.»

«Χρήσεις γης, αξίες γης και κυκλοφοριακές ρυθμίσεις στο Δήμο Χαλκιδέων. Η μεταξύ τους σχέση και εξέλιξη.» ΕΘΝΙΚΟ ΜΕΤΣΟΒΙΟ ΠΟΛΥΤΕΧΝΕΙΟ ΣΧΟΛΗ ΑΓΡΟΝΟΜΩΝ ΚΑΙ ΤΟΠΟΓΡΑΦΩΝ ΜΗΧΑΝΙΚΩΝ ΤΟΜΕΑΣ ΓΕΩΓΡΑΦΙΑΣ ΚΑΙ ΠΕΡΙΦΕΡΕΙΑΚΟΥ ΣΧΕΔΙΑΣΜΟΥ ΔΙΠΛΩΜΑΤΙΚΗ ΕΡΓΑΣΙΑ: «Χρήσεις γης, αξίες γης και κυκλοφοριακές ρυθμίσεις στο Δήμο Χαλκιδέων.

Διαβάστε περισσότερα

Σελίδα 123 σχολικού βιβλίου : Η διαδικασία που ακολουθείται... και εισάγεται πάλι

Σελίδα 123 σχολικού βιβλίου : Η διαδικασία που ακολουθείται... και εισάγεται πάλι ΠΡΟΤΕΙΝΟΜΕΝΕΣ ΑΠΑΝΤΗΣΕΙΣ ΒΙΟΛΟΓΙΑΣ ΚΑΤΕΥΘΥΝΣΗΣ ΘΕΜΑ Α Α1. γ Α2. β Α3. α Α4. δ Α5. α ΘΕΜΑ Β Β1. Σελίδα 123 σχολικού βιβλίου : Η διαδικασία που ακολουθείται... και εισάγεται πάλι σ αυτόν. Β2. Σελίδα 133

Διαβάστε περισσότερα

Μιχαήλ Νικητάκης 1, Ανέστης Σίτας 2, Γιώργος Παπαδουράκης Ph.D 1, Θοδωρής Πιτηκάρης 3

Μιχαήλ Νικητάκης 1, Ανέστης Σίτας 2, Γιώργος Παπαδουράκης Ph.D 1, Θοδωρής Πιτηκάρης 3 Information literacy and the autonomous learner Μιχαήλ Νικητάκης 1, Ανέστης Σίτας 2, Γιώργος Παπαδουράκης Ph.D 1, Θοδωρής Πιτηκάρης 3 1) Τεχνολογικό Εκπαιδευτικό Ίδρυµα Κρήτης, nikit@lib.teiher.gr, r,

Διαβάστε περισσότερα

SEGMENTATION ANALYSIS OF LONG TERM SIGNIFICANT WAVE HEIGHT TIME SERIES

SEGMENTATION ANALYSIS OF LONG TERM SIGNIFICANT WAVE HEIGHT TIME SERIES 9 ο Πανελλήνιο Συμπόσιο Ωκεανογραφίας & Αλιείας 2009 - Πρακτικά, Τόμος Ι ΚΑΤΑΤΜΗΣΗ ΜΑΚΡΟΧΡΟΝΙΩΝ ΧΡΟΝΟΣΕΙΡΩΝ ΣΗΜΑΝΤΙΚΟΥ ΥΨΟΥΣ ΚΥΜΑΤΟΣ Σουκισιάν Τ., Φωτιάδου Χ. Ινστιτούτο Ωκεανογραφίας, Ελληνικό Κέντρο

Διαβάστε περισσότερα

þÿ»» ± - ±»» ± - ½É¼ ½ ±Ã»

þÿ»» ± - ±»» ± - ½É¼ ½ ±Ã» Neapolis University HEPHAESTUS Repository School of Economic Sciences and Business http://hephaestus.nup.ac.cy Master Degree Thesis 2015 þÿ µâ ĵǽ» ³ µâ º±¹ µºà± µ þÿàµá ÀÄÉÃ Ä Â µåäµá ² ¼¹± þÿµºà± µåã

Διαβάστε περισσότερα

ΤΕΧΝΟΛΟΓΙΚΟ ΠΑΝΕΠΙΣΤΗΜΙΟ ΚΥΠΡΟΥ ΣΧΟΛΗ ΕΠΙΣΤΗΜΩΝ ΥΓΕΙΑΣ. Πτυχιακή Εργασία

ΤΕΧΝΟΛΟΓΙΚΟ ΠΑΝΕΠΙΣΤΗΜΙΟ ΚΥΠΡΟΥ ΣΧΟΛΗ ΕΠΙΣΤΗΜΩΝ ΥΓΕΙΑΣ. Πτυχιακή Εργασία ΤΕΧΝΟΛΟΓΙΚΟ ΠΑΝΕΠΙΣΤΗΜΙΟ ΚΥΠΡΟΥ ΣΧΟΛΗ ΕΠΙΣΤΗΜΩΝ ΥΓΕΙΑΣ Πτυχιακή Εργασία Η ΑΠΟΤΕΛΕΣΜΑΤΙΚΟΤΗΤΑ ΚΑΙ ΑΝΕΚΤΙΚΟΤΗΤΑ ΤΗΣ ΛΑΚΟΣΑΜΙΔΗΣ ΣΕ ΠΑΙΔΙΑ ΜΕ ΦΑΡΜΑΚΟΑΝΘΕΚΤΙΚΗ ΕΣΤΙΑΚΗ ΕΠΙΛΗΨΙΑ Κωνσταντίνα Κυπριανού Α.Τ.:

Διαβάστε περισσότερα

ΘΕΜΑ 1 Ο Α. Να επιλέξετε την φράση που συμπληρώνει ορθά κάθε μία από τις ακόλουθες προτάσεις:

ΘΕΜΑ 1 Ο Α. Να επιλέξετε την φράση που συμπληρώνει ορθά κάθε μία από τις ακόλουθες προτάσεις: ΜΑΘΗΜΑ / ΤΑΞΗ : ΑΠΑΝΤΗΣΕΙΣ ΒΙΟΛΟΓΙΑΣ ΚΑΤΕΥΘΥΝΣΗΣ / Γ ΛΥΚΕΙΟΥ (ΧΕΙΜΕΡΙΝΑ) ΣΕΙΡΑ: ΗΜΕΡΟΜΗΝΙΑ: 17/02/2013 ΘΕΜΑ 1 Ο Α. Να επιλέξετε την φράση που συμπληρώνει ορθά κάθε μία από τις ακόλουθες προτάσεις: 1. Τα

Διαβάστε περισσότερα

ΣΤΗΝ ΟΛΟΚΛΗΡΩΜΕΝΗ ΙΑΧΕΙΡΙΣΗ ΚΑΙ ΑΝΑΠΤΥΞΗ ΑΓΡΟΤΙΚΟΥ ΧΩΡΟΥ ΠΕΡΙΒΑΛΛΟΝΤΙΚΕΣ ΜΗ ΚΥΒΕΡΝΗΤΙΚΕΣ ΟΡΓΑΝΩΣΕΙΣ ΠΟΣΟ «ΠΡΑΣΙΝΕΣ ΕΙΝΑΙ»;

ΣΤΗΝ ΟΛΟΚΛΗΡΩΜΕΝΗ ΙΑΧΕΙΡΙΣΗ ΚΑΙ ΑΝΑΠΤΥΞΗ ΑΓΡΟΤΙΚΟΥ ΧΩΡΟΥ ΠΕΡΙΒΑΛΛΟΝΤΙΚΕΣ ΜΗ ΚΥΒΕΡΝΗΤΙΚΕΣ ΟΡΓΑΝΩΣΕΙΣ ΠΟΣΟ «ΠΡΑΣΙΝΕΣ ΕΙΝΑΙ»; Γ Ε Ω Π Ο Ν Ι Κ Ο ΠΑΝΕΠΙΣΤΗΜΙΟ ΑΘΗΝΩΝ ΤΜΗΜΑ:Αγροτικής οικονοµιας & Ανάπτυξης ΜΕΤΑΠΤΥΧΙΑΚΟ ΠΡΟΓΡΑΜΜΑ ΣΠΟΥ ΩΝ ΣΤΗΝ ΟΛΟΚΛΗΡΩΜΕΝΗ ΙΑΧΕΙΡΙΣΗ ΚΑΙ ΑΝΑΠΤΥΞΗ ΑΓΡΟΤΙΚΟΥ ΧΩΡΟΥ ΠΕΡΙΒΑΛΛΟΝΤΙΚΕΣ ΜΗ ΚΥΒΕΡΝΗΤΙΚΕΣ ΟΡΓΑΝΩΣΕΙΣ

Διαβάστε περισσότερα

ΓΙΔΡΔΤΝΗΗ ΣΗ ΑΝΑΓΝΩΣΙΚΗ ΤΜΠΔΡΙΦΟΡΑ ΣΩΝ ΥΡΗΣΩΝ ΣΩΝ ΑΚΑΓΗΜΑΪΚΩΝ ΒΙΒΛΙΟΘΗΚΩΝ: Η ΠΔΡΙΠΣΩΗ ΣΟΤ ΙΟΝΙΟΤ ΠΑΝΔΠΙΣΗΜΙΟΤ

ΓΙΔΡΔΤΝΗΗ ΣΗ ΑΝΑΓΝΩΣΙΚΗ ΤΜΠΔΡΙΦΟΡΑ ΣΩΝ ΥΡΗΣΩΝ ΣΩΝ ΑΚΑΓΗΜΑΪΚΩΝ ΒΙΒΛΙΟΘΗΚΩΝ: Η ΠΔΡΙΠΣΩΗ ΣΟΤ ΙΟΝΙΟΤ ΠΑΝΔΠΙΣΗΜΙΟΤ ΓΙΔΡΔΤΝΗΗ ΣΗ ΑΝΑΓΝΩΣΙΚΗ ΤΜΠΔΡΙΦΟΡΑ ΣΩΝ ΥΡΗΣΩΝ ΣΩΝ ΑΚΑΓΗΜΑΪΚΩΝ ΒΙΒΛΙΟΘΗΚΩΝ: Η ΠΔΡΙΠΣΩΗ ΣΟΤ ΙΟΝΙΟΤ ΠΑΝΔΠΙΣΗΜΙΟΤ Οιέλνγινπ, Άλλα Μαξία 1 θαη Χξηζηίλα Μπάλνπ 2 Τκήκα Αξρεηνλνκίαο Βηβιηνζεθνλνκίαο, Ηφλην Παλεπηζηήκην,

Διαβάστε περισσότερα

ΑΡΙΣΤΟΤΕΛΕΙΟ ΠΑΝΕΠΙΣΤΗΜΙΟ ΘΕΣΣΑΛΟΝΙΚΗΣ ΤΜΗΜΑ ΟΔΟΝΤΙΑΤΡΙΚΗΣ ΕΡΓΑΣΤΗΡΙΟ ΟΔΟΝΤΙΚΗΣ ΚΑΙ ΑΝΩΤΕΡΑΣ ΠΡΟΣΘΕΤΙΚΗΣ

ΑΡΙΣΤΟΤΕΛΕΙΟ ΠΑΝΕΠΙΣΤΗΜΙΟ ΘΕΣΣΑΛΟΝΙΚΗΣ ΤΜΗΜΑ ΟΔΟΝΤΙΑΤΡΙΚΗΣ ΕΡΓΑΣΤΗΡΙΟ ΟΔΟΝΤΙΚΗΣ ΚΑΙ ΑΝΩΤΕΡΑΣ ΠΡΟΣΘΕΤΙΚΗΣ ΑΡΙΣΤΟΤΕΛΕΙΟ ΠΑΝΕΠΙΣΤΗΜΙΟ ΘΕΣΣΑΛΟΝΙΚΗΣ ΤΜΗΜΑ ΟΔΟΝΤΙΑΤΡΙΚΗΣ ΕΡΓΑΣΤΗΡΙΟ ΟΔΟΝΤΙΚΗΣ ΚΑΙ ΑΝΩΤΕΡΑΣ ΠΡΟΣΘΕΤΙΚΗΣ ΣΥΓΚΡΙΤΙΚΗ ΜΕΛΕΤΗ ΤΗΣ ΣΥΓΚΡΑΤΗΤΙΚΗΣ ΙΚΑΝΟΤΗΤΑΣ ΟΡΙΣΜΕΝΩΝ ΠΡΟΚΑΤΑΣΚΕΥΑΣΜΕΝΩΝ ΣΥΝΔΕΣΜΩΝ ΑΚΡΙΒΕΙΑΣ

Διαβάστε περισσότερα

«ΕΡΕΥΝΑ ΓΙΑ ΤΗΝ ΗΛΕΚΤΡΟΝΙΚΗ ΠΡΟΩΘΗΣΗ ΜΟΥΣΙΚΟΥ ΥΛΙΚΟΥ ΑΝΕΞΑΡΤΗΤΩΝ ΚΑΛΛΙΤΕΧΝΩΝ»

«ΕΡΕΥΝΑ ΓΙΑ ΤΗΝ ΗΛΕΚΤΡΟΝΙΚΗ ΠΡΟΩΘΗΣΗ ΜΟΥΣΙΚΟΥ ΥΛΙΚΟΥ ΑΝΕΞΑΡΤΗΤΩΝ ΚΑΛΛΙΤΕΧΝΩΝ» ΤΕΧΝΟΛΟΓΙΚΟ ΕΚΠΑΙΔΕΥΤΙΚΟ ΙΔΡΥΜΑ ΙΟΝΙΩΝ ΝΗΣΩΝ ΤΜΗΜΑ ΤΕΧΝΟΛΟΓΙΑΣ ΗΧΟΥ ΚΑΙ ΜΟΥΣΙΚΩΝ ΟΡΓΑΝΩΝ «ΕΡΕΥΝΑ ΓΙΑ ΤΗΝ ΗΛΕΚΤΡΟΝΙΚΗ ΠΡΟΩΘΗΣΗ ΜΟΥΣΙΚΟΥ ΥΛΙΚΟΥ ΑΝΕΞΑΡΤΗΤΩΝ ΚΑΛΛΙΤΕΧΝΩΝ» ΠΤΥΧΙΑΚΗ ΕΡΓΑΣΙΑ ΦΑΜΠΡΙΤΣΙΟ ΛΑΖΑΚΗΣ

Διαβάστε περισσότερα

H Χρήση του DNA και της τεχνολογίας DNA-Barcoding για την μελέτη της βιοποικιλότητας και τη διάκριση των ειδών και των τοπικών ποικιλιών οσπρίων

H Χρήση του DNA και της τεχνολογίας DNA-Barcoding για την μελέτη της βιοποικιλότητας και τη διάκριση των ειδών και των τοπικών ποικιλιών οσπρίων H Χρήση του DNA και της τεχνολογίας DNA-Barcoding για την μελέτη της βιοποικιλότητας και τη διάκριση των ειδών και των τοπικών ποικιλιών οσπρίων Dr. Παναγιώτης Μαδέσης pmadesis@certh.gr Ι. Γανόπουλος,

Διαβάστε περισσότερα

υγεία των νοσηλευτών που συστηματικά εμπλέκονται στην παρασκευή και χορήγηση τους.

υγεία των νοσηλευτών που συστηματικά εμπλέκονται στην παρασκευή και χορήγηση τους. ΠΕΡΙΛΗΨΗ Εισαγωγή: Τα χημειοθεραπευτικά φάρμακα έχουν αποδειχθεί οτι θέτουν σε κίνδυνο την υγεία των νοσηλευτών που συστηματικά εμπλέκονται στην παρασκευή και χορήγηση τους. Σκοπός: Σκοπός της παρούσας

Διαβάστε περισσότερα

Διαδικασία Ελέγχου Μηδενικών Υποθέσεων

Διαδικασία Ελέγχου Μηδενικών Υποθέσεων Διαδικασία Ελέγχου Μηδενικών Υποθέσεων Πέτρος Ρούσσος, Τμήμα Ψυχολογίας, ΕΚΠΑ Η λογική της διαδικασίας Ο σάκος περιέχει έναν μεγάλο αλλά άγνωστο αριθμό (αρκετές χιλιάδες) λευκών και μαύρων βόλων: 1 Το

Διαβάστε περισσότερα

Σύγχρονες μεθοδολογίες μοριακής βιολογίας και γενετικής στη γυναικολογία

Σύγχρονες μεθοδολογίες μοριακής βιολογίας και γενετικής στη γυναικολογία ΣΥΓΧΡΟΝΕΣ ΜΕΘΟΔΟΛΟΓΙΕΣ ΜΟΡΙΑΚΗΣ ΒΙΟΛΟΓΙΑΣ - ΓΕΝΕΤΙΚΗΣ Σύγχρονες μεθοδολογίες μοριακής βιολογίας και γενετικής στη γυναικολογία ΠΑΠΑΝΙΚΟΛΑΟΥ ΕΛΕΝΗ, Ph.D. Λέκτορας Εργαστήριο Βιολογίας, Ιατρική Σχολή Αθηνών

Διαβάστε περισσότερα

ΑΝΑΖΗΤΗΣΗ ΟΜΟΙΟΤΗΤΩΝ ΣΕ ΒΑΣΕΙΣ Ε ΟΜΕΝΩΝ ΑΚΟΛΟΥΘΙΩΝ

ΑΝΑΖΗΤΗΣΗ ΟΜΟΙΟΤΗΤΩΝ ΣΕ ΒΑΣΕΙΣ Ε ΟΜΕΝΩΝ ΑΚΟΛΟΥΘΙΩΝ Αναζήτηση οµοιοτήτων ΑΝΑΖΗΤΗΣΗ ΟΜΟΙΟΤΗΤΩΝ ΣΕ ΒΑΣΕΙΣ Ε ΟΜΕΝΩΝ ΑΚΟΛΟΥΘΙΩΝ Σελίδα 1 εδοµένα Ακολουθία επερώτησης (query sequence) Ακολουθίες στη Βάση εδοµένων (subject sequences) Αναζήτηση Μέθοδοι δυναµικού

Διαβάστε περισσότερα

Μέθοδοι Ανάλυσης Συγκριτικής Γονιδιωματικής

Μέθοδοι Ανάλυσης Συγκριτικής Γονιδιωματικής ΓΕΩΠΟΝΙΚΟ ΠΑΝΕΠΙΣΤΗΜΙΟ ΑΘΗΝΑΣ ΤΜΗΜΑ ΒΙΟΤΕΧΝΟΛΟΓΙΑΣ ΙΕΡΑ ΟΔΟΣ 75, 118 55 ΑΘΗΝΑ Μεταπτυχιακή Διατριβή για το Μεταπτυχιακό Δίπλωμα Ειδίκευσης (Μ.Δ.Ε) "Εφαρμογές της Βιοτεχνολογίας στη Γεωπονία" Μέθοδοι Ανάλυσης

Διαβάστε περισσότερα

Συνδεδεµένα Γονίδια. Γενετικός Ανασυνδυασµός Κλασσική Γενετική Χαρτογράφηση ΑΘΑΝΑΣΙΟΣ ΜΑΥΡΟΜΑΤΗΣ - ΤΑΝΙΑ ΜΑΡΚΟΠΟΥΛΟΥ

Συνδεδεµένα Γονίδια. Γενετικός Ανασυνδυασµός Κλασσική Γενετική Χαρτογράφηση ΑΘΑΝΑΣΙΟΣ ΜΑΥΡΟΜΑΤΗΣ - ΤΑΝΙΑ ΜΑΡΚΟΠΟΥΛΟΥ 8η ιάλεξη Συνδεδεµένα Γονίδια Γενετικός Ανασυνδυασµός Κλασσική Γενετική Χαρτογράφηση ΑΘΑΝΑΣΙΟΣ ΜΑΥΡΟΜΑΤΗΣ - ΤΑΝΙΑ ΜΑΡΚΟΠΟΥΛΟΥ Εργαστήριο Γενετικής & Βελτίωσης φυτών Κύρια σηµεία - Ορισµοί Συνταινικά =

Διαβάστε περισσότερα