Supporting Information

Transcript

1 Supporting Information New Prodigiosin Derivatives obtained by Mutasynthesis in Pseudomonas putida Andreas S. Klein, Andreas Domröse, Patrick Bongen, Hannah U.C. Brass, Thomas Classen, Anita Loeschcke, Thomas Drepper, Luca Laraia, Sonja Sievers, Karl Erich Jaeger and Jörg Pietruszka* A. S. Klein, M.Sc.; Dr. P. Bongen; H. Brass, M.Sc.; Prof. Dr. J. Pietruszka Institute of Bioorganic Chemistry, Heinrich Heine University Düsseldorf located at Forschungszentrum Jülich Stetternicher Forst, Building 15.8, Jülich (Germany) E mail: j.pietruszka@fz juelich.de; Website: duesseldorf.de A. Domröse, M.Sc.; Dr. A. Loeschcke; Dr. T. Drepper; Prof. Dr. K. E. Jaeger Institute of Molecular Enzyme Technology, Heinrich Heine University Düsseldorf located at Forschungszentrum Jülich Stetternicher Forst, Building 15.8, Jülich (Germany) Dr. L. Laraia Department of Chemical Biology, Max Planck Institute of Molecular Physiology, Dortmund (Germany) Otto Hahn Str. 11, Dortmund (Germany) Dr. S. Sievers Compound Management and Screening Center (COMAS), Max Planck Institute of Molecular Physiology Otto Hahn Str. 11, Dortmund (Germany) Prof. Dr. J. Pietruszka; Dr. T. Classen; Prof. Dr. K. E. Jaeger Insitute of Bio and Geosciences (IBG 1) Forschungszentrum Jülich Jülich (Germany)

2 Table of Contents General methods for biological procedures Construction of P. putida pig r2 ΔpigD mutant strain Mutasynthesis experiments Expression of the pigc gene General methods for chemical synthesis procedures Experimental procedures for the preparation of compounds Compound characterization NMR Spectra of synthesized compounds LC MS traces of prodiginines produced by precursor directed biosynthesis Effective precursor concentration and DMSO toxicity LC MS traces of prodiginines produced by mutasynthesis NMR Spectra of prodiginines (mutasynthesis: preparative scale) LC MS traces of prodiginines produced by in vitro biotransformation with PigC Extinction coefficients of prodiginines EC 50 values Vector maps References S1 S2 S3 S3 S4 S6 S11 S20 S43 S44 S45 S52 S58 S65 S66 S67 S68

3 S1. General methods for biological procedures Table S 1 List of primers used in this study # name 5ꞌ 3ꞌ sequence 1 AD44seqGApigCfwd ACGCTCGTCGTTTGGTATGG 2 AD48inpigC AGCAACCAGGCGTTTAAG 3 AD49aadAfwd CATATCGCGCGCGTCTGATTATGGAGCAGCAACGATG 4 AD50aadArev GTCGCGCGATCGCTTATTTGCCGACTACCTTGG 5 AD61seqaadAfwd AGTCCATCCACAGGCACAAC 6 AD62seqaadAfwd2 AATGTACGGCCAGCAACGTC 7 AD79aadAStart AAAGCTCGCCGCGTTGTTTC 8 AD80aadAStop AAATCGCGCCGAAGGATGTC 9 AD81pigC1 GTATGGCGTGATGGCCGAAC 10 AD82pigE1 TGAAGATCGAGCCGGGTTGC 11 ga_pigc_fw GTGCCGCGCGGCAGCCACATATGATGAATCCTACCCTGGTGGTT 12 ga_pigc_rv AGTGGTGGTGGTGGTGGTGCCTCGAGCTAGCCATCGGCACGTTC S1

4 S2. Construction of P. putida pig r2 ΔpigD mutant strain Figure S 1 HPLC analysis of chemical synthesized MBC (5), cultivation media and cell extract of P. putida pig r2 ΔpigD. Column: Chiralpak IA (250 x 4.6 mm, 5 µm); Flow: 0.5 ml min 1 ; Detection: 365 nm; Solvent: Heptane:2 propanol (80:20). t R = 14.7 min. S2

5 S3. Mutasynthesis experiments Figure S 2 Mutasynthesis pretest: Feeding of MAP (6a) to the prodigiosin (1a) producing strain P. putida pig r2 in ethanol [6% (v/v)]. Supplementation of 3 mm MAP resulted in 52% higher production of prodigiosin. S4. Expression of the pigc gene Figure S 3 SDS PAGE of pigc gene expression. Conditions: Gel (NuPAGE 4 12% Bis TRIS Gel, Invitrogen) with colloidal Coomassie stain. M marker Roti Mark ; 1 whole cells; 2 cell free supernatant after ultra sonication; 3 supernatant of the cell free lysate after ultracentrifugation, 4 membrane fraction after ultracentrifugation. MW of PigC calculated = 99.3 kda. S3

6 S5. General methods for chemical synthesis procedures Reagents and solvents: All chemical reagents were purchased from Sigma Aldrich, Steinheim, Germany, Alfa Aesar, Karlsruhe, Germany or TCI Europe, Zwijndrecht, Belgium. Petroleum ether (PE), ethyl acetate (EtOAc), diethyl ether and dichloromethane were distilled prior to use. All other chemicals and solvents were used as purchased without further purification. Reaction handling: All reactions under inert atmosphere were carried out in oven dried glassware under an atmosphere of nitrogen using standard Schlenk techniques and magnetic stirring. Reactions were monitored by thin layer chromatography (TLC) on pre coated plastic sheets (Polygram SIL G/UV254, Macherey Nagel, Düren, Germany) with detection by UVlight at 245 nm or via oxidative staining; plates were soaked with KMnO 4 stain (1.5 g KMnO 4, 10 g K 2 CO 3 and 1.25 ml 10% (v/v) NaOH in 200 ml water) or p anisaldehyde stain (3 ml p anisaldehyde and 6 ml conc. H 2 SO 4 in 300 ml AcOH) and dried with a hot air blow dryer. Solvent removal was performed at 40 C in vacuo. Preparative column chromatography was performed using silica gel 60 (particle size mm, mesh). Mass spectrometry: GC MS analysis was performed on a HP 6890 series gas chromatograph (Hewlett Packard) equipped with a HP 6890 series injector and a split injection system, fitted with a HP 5 ms column (30 m x 0.25 mm, 0.25 μm, Agilent Technologies) and coupled with a mass selective detector 5973 mass spectrometer. The temperatures of the injector and the detector were fixed at 250 C and 230 C, respectively. Helium was used as the carrier gas at 0.57 bar. Mass spectra were collected in the electron impact mode at 70 ev. The column temperature was initially 60 C for 1 min, then raised to 185 C at a rate of 15 C min 1, subsequently raised to 280 C at a rate of 120 C min 1 and maintained at that temperature for 5 min. NMR spectroscopy: 1 H and 13 C NMR spectra were recorded on an Advance/DRX 600 nuclear magnetic resonance spectrometer (Bruker, Billerica, USA) at ambient temperature in CDCl 3 at 600 and 151 MHz, respectively. The chemical shifts are given in ppm relative to tetramethylsilane [ 1 H: δ(sime 4 ) = 0.00 ppm] as an internal standard or relative to the solvent [ 13 C: δ(cdcl 3 ) = ppm]. Signals were assigned by means of H COSY, HSQC and HMBCexperiments; splitting patterns are given as singlet (s), doublet (d), triplet (t), doublet of doublet (dd), multiplet (m) and broad singlet (brs) plus coupling constants (J) are reported in Hz. IR spectroscopy: IR data were recorded on a SpectrumOne instrument (PerkinElmer, Waltham, USA) as thin film. Absorbance frequencies are reported in cm 1. LC MS (achiral stationary phase): Analytes were separated and analyzed using a LC MS Agilent 1100 series equipped with a diode array and API electrospray mass detector. Substances were separated by the reversed phase stationary phase Atlantis T3 3 µm (3.00* mm). Water + 0.1% formic acid (v/v) and methanol + 0.1% formic acid (v/v) S4

7 were used as eluents for the following gradient program: 0.00 min: 90:10 water + 0.1% formic acid (v/v) : methanol + 0.1% formic acid (v/v), 4.00 min: 40:60 water + 0.1% formic acid (v/v) : methanol + 0.1% formic acid (v/v), 6.00 min: 100% methanol + 0.1% formic acid (v/v). The program was stopped after min. Flow rate was set to 0.6 ml/min. The column temperature was kept at 30 C. Detection wavelengths were 510 nm, 520 nm, 530 nm, 540 nm, 3D field (190 nm 800 nm). 10 µl of sample were injected. MS detection mode was set to positive mode with a range of m/z = Substances were identified by their UV absorption spectra and their mass to charge ratio (m/z). Names are in accordance with the IUPAC nomenclature. S5

8 S6. Experimental procedures for the preparation of compounds Table S 2 List of monopyrroles used in this study. # monopyrrole R 1 R 2 procedure overall yield [%] 1 6b methyl H C c methyl methyl A d methyl n propyl A e methyl n butyl A a methyl n pentyl A f methyl n hexyl A g methyl n octyl A h methyl n decyl A i methyl n dodecyl A j H ethyl B k H n propyl B l H n pentyl B m H n hexyl B n H n octyl B o H n undecyl B p ethyl n pentyl A q n butyl n propyl A r n pentyl n butyl A s n hexyl n pentyl A t methyl 2 propenyl A u methyl 4 pentenyl A [a] 45 [b] [a] starting material 7 octen 2 one (16) was previously synthesized from 6 heptenoic acid. [b] overall yield is given for the synthesis starting from 6 heptenoic acid. S6

9 Procedure A for the synthesis of pyrroles (6a, c i, p u) General procedure for the synthesis of oximes (11) A mixture of the ketone (10, 16) (23.4 mmol), grounded hydroxylamine hydrochloride (2.44 g, 35.1 mmol) and pyridine (1.5 ml, 18.6 mmol) in ethanol (20 ml) was refluxed for 2 h. The completion of the reaction was monitored by TLC using a KMnO 4 solution for staining. The reaction was extracted with EtOAc (3 x 25 ml) and the organic phase was washed several times with 1 N HCl and water. The light yellow brown organic phase was dried over MgSO 4 and the solvent was evaporated providing the oximes (11) in quantitative yields. The oximes were used without further purification in the following experiment. General procedure for the synthesis of 2,3 alkylpyrroles (6a, c i, p u) 2,3 alkylpyrrole (6a, c i, p u) were synthesized using a modified procedure of Domröse, Klein et al. (2015). 1 A mixture of the oxime (11) (10 mmol), potassium hydroxide (50 mmol), DMSO (20 ml) and water (7.5 mmol) was heated at C in a three neck round bottom flask fitted with a reflux condenser under nitrogen atmosphere. A solution of 1,2 dichloroethane (35 mmol) in DMSO (3 ml) was added dropwise over a period of 2 h. A secondary amount of potassium hydroxide (50 mmol) was added carefully after 1 h of 1,2 dichloroethane addition. After stirring for an additional 2 h the reaction was poured into ice water and extracted with diethyl ether (3 x 20 ml). The combined organic layers were dried over MgSO 4 and the solvent was removed under reduced pressure. Chromatography on silica gel with PE:dichloromethane (90:10) + TEA (1% v/v) providing 2,3 alkylpyrroles (6a, c i, p u) as a light yellow oil or solid. The reaction was monitored by TLC using an acidic solution of p anisaldehyde for staining. Procedure B for the synthesis of pyrroles (6j o) N Tosylpyrrole (12) was synthesized under an inert atmosphere of dry nitrogen in a two neck round bottom flask. To a solution of sodium hydride (1.431 g, 60 mmol) in dry THF (16 ml) was added carefully pyrrole (2.07 ml, 30 mmol) within 10 min at 0 C. The reaction mixture was stirred for 30 min at room temperature followed by the addition of dissolved tosyl chloride (5.683 g, 30 mmol) in THF (8 ml). The reaction mixture was stirred for 3 h at room temperature. Afterwards it was quenched with the addition of water at 0 C and extracted with dichloromethane (3 x 30 ml). The combined organic layers were dried over MgSO 4 and the solvent was removed under reduced pressure providing compound 12 (6.127 g, 28 mmol, 93%) as a white grey solid. The reaction was monitored by TLC using an acidic solution of p anisaldehyde for staining. S7

10 General procedure for the synthesis 3 acyl N tosylpyrroles (13) 3 Acyl N tosylpyrroles (13) were synthesized using modified procedures of Katritzky et al. (2003) 2 and Huffmann et al. (2008). 3 The reaction was performed in a Schlenk flask under an inert atmosphere of dry nitrogen. To a suspension of anhydrous AlCl 3 (1.808 g, mmol) in 15 ml of dry dichloromethane at room temperature was added slowly the acyl chloride (9.04 mmol). The resulting solution was stirred for 20 min; then a solution of N tosylpyrrole (12) (1 g, 4.52 mmol) in 10 ml of dichloromethane was added slowly at 0 C. The mixture was stirred at room temperature for 3 h. The reaction mixture was quenched with ice water and the product was extracted with dichloromethane (3 x 15 ml). The combined organic layers were dried over MgSO 4 and the solvent was removed under reduced pressure. The 3 acyl N tosylpyrroles (13) were used without further purification in the following experiment. The reaction was monitored by TLC using an acidic solution of p anisaldehyde for staining. General procedure for the synthesis of 3 acylpyrroles (14) 3 Acylpyrroles were synthesized using a modified procedure of Kakushima et al. (1983). 4 A solution of the 3 acyl N tosylpyrrole (13) (3 mmol) in 1.4 dioxane (10 ml) and 5 N NaOH (10 ml) was heated at 80 C for 1.5 h in a round bottom flask under an inert atmosphere of dry nitrogen. The reaction mixture was extracted with dichloromethane (3 x 10 ml) followed by an extraction with ethyl acetate (1 x 10 ml). The combined organic layers were dried over MgSO 4 and the solvent was removed under reduced pressure. The 3 acylpyrroles (14) were used without further purification in the following experiment. The reaction was monitored by TLC using an acidic solution of p anisaldehyde for staining. General procedure for the synthesis of 3 alkylpyrroles (6j o) 3 Alklpyrroles (6j o) were synthesized using a modified procedure of He et al. (2011). 5 The reaction was performed in a Schlenk flask fitted with a reflux condenser under an inert atmosphere of dry nitrogen. LiAlH 4 (190 mg, 5 mmol) was added slowly to a solution of the 3 acylpyrrole (14) (2.5 mmol) in dry THF (10 ml) at 0 C. Thereafter the reaction mixture was refluxed for 1.5 h followed by a second addition of LiAlH 4 (190 mg, 5 mmol) at 0 C. The reaction mixture was again refluxed for 1.5 h and quenched with a saturated solution of sodium sulfate at 0 C. The reaction mixture was extracted with dichloromethane (3 x 30 ml). The combined organic layers were dried over MgSO 4 and the solvent was removed under reduced pressure. Chromatography on silica gel with PE:dichloromethane (75:25) + TEA (1% v/v) providing 3 alkylpyrroles (6j o) as a light yellow S8

11 oil or solid. The reaction was monitored by TLC using an acidic solution of p anisaldehyde for staining. Synthesis of 2 Methylpyrrole (6b) (procedure C ) 1H Pyrrole 2 carbaldehyde (15) was synthesized under an inert atmosphere of dry nitrogen in a two neck round bottom flask fitted with a reflux condenser. POCl 3 (1.02 ml, 11 mmol) is slowly added to N,N dimethylformamide (847 µl, 11 mmol) at 0 C and the reaction mixture is warmed to room temperature after 10 min. The resulting Vilsmeier reagent is diluted with 1,2 dichloroethane (5 ml) and again cooled to 0 C after 10 min. Pyrrole (707 µl, 10 mmol) is dissolved in 1,2 dichloroethane (4 ml) and the mixture is slowly added to the Vilsmeier reagent over 25 min. Thereafter the reaction was refluxed for 20 min at 85 C and is subsequently cooled to room temperature. Sodium acetate (7.4 g, mmol), dissolved in 15 ml of water, is slowly added to the reaction mixture during 15 min followed by refluxing for 30 min at 85 C. Afterwards the reaction mixture is cooled to room temperature and extracted with diethyl ether (3 x 15 ml). The combined organic layers were washed with a saturated solution of NaHCO 3, dried over MgSO 4 and the solvent was removed under reduced pressure. The crude product was purified by flash chromatography on silica gel with PE:EtOAc (80:20) + TEA (1% v/v) providing compound 15 (901 mg, 9.5 mmol, 95%) as a brown oil, which solidified on standing. 2 Methylpyrrole (6b) was synthesized using the general procedure for the synthesis of 3 alkylpyrroles (6j o). The crude product was purified by flash chromatography on silica gel with PE:dichloromethane (75:25) + TEA (1% v/v) providing compound 6b (667 mg, 8.2 mmol, 49%) as a light yellow oil. Synthesis of 7 octen 2 one (16) N Methoxy N methylhept 6 enamide (17) was synthesized under an inert atmosphere of dry nitrogen in a Schlenk flask. The synthesis of the Weinreb Nahm amide based on a Steglich esterification. To a solution of 6 heptenoic acid (2.0 ml, 14.8 mmol) in dichloromethane (50 ml) was added N,O dimethylhydroxylamine hydrochloride (2.160 g, 22.1 mmol), N (3 dimethylaminopropyl) N ethylcarbodiimide hydrochloride (4.245 g, 22.1 mmol) and 4 (dimethylamino)pyridine (2.705 g, 22.1 mmol). The reaction mixture was stirred for 22 h at room temperature. The reaction was quenched with a saturated solution of NaCl and extracted with dichloromethane (3 x 30 ml). The combined organic layers were first washed with 1 N HCl and subsequently with a saturated solution of NaHCO 3. The organic layers were dried over MgSO 4 and the solvent was removed under reduced pressure providing compound (17) as a light yellow oil in quantitative yields. The product was used S9

12 without further purification in the following experiment. The reaction was monitored by TLC using an acidic solution of p anisaldehyde for staining. 7 Octen 2 one (16) was synthesized under an inert atmosphere of dry nitrogen in a two neck round bottom flask. To a solution of N methoxy N methylhept 6 enamide (17) (1.0 g, 5.8 mmol) in dry THF (30 ml) was slowly added methylmagnesium bromide (3 M in diethyl ether, 5.84 ml, 5.8 mmol) within 15 min at 0 C. The reaction mixture was stirred for 1.5 h at 0 C and quenched with a saturated solution of NH 4 Cl and extracted with ethyl acetate (3 x 20 ml). The combined organic layers were dried over MgSO 4 and the solvent was removed under reduced pressure providing compound (16) as a light yellow oil in quantitative yields. The product was used without further purification for the synthesis of 2 methyl 3 (pent 4 en 1 yl) 1H pyrrole (6u) applying procedure A. The reaction was monitored by TLC using an acidic solution of p anisaldehyde for staining. S10

13 S7. Compound characterization 2,3 Dimethyl 1H pyrrole (6c) Pyrrole 6c was obtained by procedure A as a light yellow oil (507 mg, 5.3 mmol, 47%). 1 H NMR (600 MHz, CDCl 3 ): δ = 2.02 (s, 3H, 1 H), 2.17 (s, 3H, 1 H), 5.98 (t, 3 J 4,5 = 2.9 Hz, 4 J 4,1 = 2.9 Hz, 1H, 4 H), 6.57 (t, 3 J 5,4 = 2.7 Hz, 3 J 5,1 = 2.7 Hz, 1H, 5 H), 7.70 (brs, 1H, 1 NH); 13 C NMR (151 MHz, CDCl 3 ): δ = (C 1 ), (C 1 ), (C 4), (C 3), (C 5), (C 2); IR (atr film): ῦ [cm 1 ] = 3374; 2921; 2866; 1590; 1465; 1386; 1279; 1246; 1169; 1102; 1058; 954; 898; 831; 707; MS (EI, 70 ev): m/z = 95 [(M) + ], 94, 80, 67, 53 The 1 H NMR data is in accordance to literature. 6 2 Methyl 3 propyl 1H pyrrole (6d) Pyrrole 6d was obtained by procedure A as a light yellow oil (1.27 g, 10.3 mmol, 59%). 1 H NMR (600 MHz, CDCl 3 ): δ = 0.94 (t, 3 J 3,2 = 7.3 Hz, 3H, 3 H), (m, 2H, 2 H), 2.18 (s, 3H, 1 H), 2.36 (t, 3 J 1,2 = 7.6 Hz, 2H, 1 H), 6.01 (t, 3 J 4,5 = 2.8 Hz, 4 J 4,1 = 2.8 Hz, 1H, 4 H), 6.59 (t, 3 J 5,4 = 2.7 Hz, 3 J 5,1 = 2.7 Hz, 1H, 5 H), 7.70 (brs, 1H, 1 NH); 13 C NMR (151 MHz, CDCl 3 ): δ = (C 1 ), (C 3 ), (C 2 ), (C 1 ), (C 4), (C 5), (C 3), (C 2); IR (atr film): ῦ [cm 1 ] = 3380; 2957; 2927; 2871; 1713; 1584; 1464; 1377; 1277; 1106; 1068; 956; 904; 832; 801; 709; MS (EI, 70 ev): m/z = 123 [(M) + ], 108, 94, 80, 67, 53; HRMS (ESI FTMS, positive ion): calculated for C 8 H 14 N (M + H) + = found = Butyl 2 methyl 1H pyrrole (6e) Pyrrole 6e was obtained by procedure A as a light yellow oil (813 mg, 5.9 mmol, 48%). 1 H NMR (600 MHz, CDCl 3 ): δ = 0.92 (t, 3 J 4,3 = 7.4 Hz, 3H, 4 H), (m, 2H, 3 H), (m, 2H, 2 H), 2.18 (s, 3H, 1 H), 2.38 (t, 3 J 1,2 = 7.7 Hz, 2H, 1 H), 6.01 (t, 3 J 4,5 = 2.7 Hz, 4 J 4,1 = 2.7 Hz, 1H, 4 H), 6.58 (t, 3 J 5,4 = 2.7 Hz, 3 J 5,1 = 2.7 Hz, 1H, 5 H), 7.69 (brs, 1H, 1 NH); 13 C NMR (151 MHz, CDCl 3 ): δ = (C 1 ), (C 4 ), (C 3 ), (C 1 ), (C 2 ), (C 4), (C 5), (C 3), (C 2); IR (atr film): ῦ [cm 1 ] = 3379; 2957; 2926; 2857; 1585; 1465; 1378; 1274; 1247; 1106; 1065; 955; 902; 832; 709; 666; MS (EI, 70 ev): m/z = 137 [(M) + ], 122, 120, 108, 106,.94, 80, 67, 53; HRMS (ESI FTMS, positive ion): calculated for C 9 H 16 N (M + H) + = found = S11

14 2 Methyl 3 pentyl 1H pyrrole (2 Methyl 3 amyl 1H pyrrole, MAP, 6a) Pyrrole 6a was obtained by procedure A as a light yellow oil (1,13 g, 7,47 mmol, 49%). 1 H NMR (600 MHz, CDCl 3 ): δ = 0.89 (t, 3 J 5,4 = 6.9 Hz, 2H, 5 H), (m, 4H, 3, 4 H), 1.53 (m, 2H, 2 H), 2.18 (s, 3H, 1 H), 2.37 (t, 3 J 1,2 = 7.7 Hz, 2H, 1 H), 6.01 (t, 3 J 4,5 = 2.7 Hz, 4 J 4,1 = 2.6 Hz, 1H, 4 H), 6.58 (t, 3 J 5,4 = 2.7 Hz, 4 J 5,1 = 2.6Hz, 1H, 5 H), 7.70 (brs, 1H, 1 NH); 13 C NMR (151 MHz, CDCl 3 ): δ = (C 1 ), (C 5 ), (C 4 ), (C 1 ), (C 2 ), (C 3 ), (C 4), (C 5), (C 3), (C 2); IR (atr film): ῦ [cm 1 ] = 3381; 2957; 2856; 1464; 1378; 1108; 901; 832; 711; 667; MS (EI, 70 ev): m/z = 151 [(M) + ], 94, 80, 67 The NMR, IR and MS data are in accordance to literature. 7 3 Hexyl 2 methyl 1H pyrrole (6f) Pyrrole 6f was obtained by procedure A as a light yellow oil (771 mg, 4.7 mmol, 49%). 1 H NMR (600 MHz, CDCl 3 ): δ = 0.88 (t, 3 J 6,5 = 6.3 Hz, 3H, 6 H), (m, 6H, 3, 4, 5 H), (m, 2H, 2 H), 2.17 (s, 3H, 1 H), 2.37 (t, 3 J 1,2 = 7.7 Hz, 2H, 1 H), 6.01 (t, 3 J 4,5 = 2.8 Hz, 4 J 4,1 = 2.8 Hz, 1H, 4 H), 6.58 (t, 3 J 5,4 = 2.7 Hz, 3 J 5,1 = 2.7 Hz, 1H, 5 H), 7.68 (brs, 1H, 1 NH); 13 C NMR (151 MHz, CDCl 3 ): δ = (C 1 ), (C 6 ), 22.73, (C 1 ), 29.29, (C 2 ), 31.86, (C 4), (C 5), (C 3), (C 2); IR (atr film): ῦ [cm 1 ] = 3379; 2957; 2924; 2854; 1585; 1465; 1378; 1245; 1108; 1065; 954; 902; 832; 709; 667; MS (EI, 70 ev): m/z = 165 [(M) + ], 136, 122, 106, 94, 80, 53; HRMS (ESI FTMS, positive ion): calculated for C 11 H 20 N (M + H) + = found = Methyl 3 octyl 1H pyrrole (6g) Pyrrole 6g was obtained by procedure A as a light yellow oil (1.03 g, 5.3 mmol, 49%). 1 H NMR (600 MHz, CDCl 3 ): δ = 0.88 (t, 3 J 8,7 = 6.9 Hz, 3H, 8 H), (m, 10H, 3, 4, 5, 6, 7 H), (m, 3H, 2 H), 2.18 (s, 3H, 1 H), (t, 3 J 1,2 = 7.7 Hz, 2H, 1 H), 6.01 (t, 3 J 4,5 = 2.8 Hz, 4 J 4,1 = 2.8 Hz, 1H, 4 H), 6.58 (t, 3 J 5,4 = 2.7 Hz, 3 J 5,1 = 2.7 Hz, 1H, 5 H), 7.69 (brs, 1H, 1 NH); 13 C NMR (151 MHz, CDCl 3 ): δ = (C 1 ), (C 8 ), 22.71, (C 1 ), 29.37, 29.59, 29.62, (C 2 ), 31.96, (C 4), (C 5), (C 3), (C 2); IR (atr film): ῦ [cm 1 ] = 3379; 2957; 2923; 2854; 1720; 1464; 1378; 1279; 1109; 1076; 955; 901; 832; 709; S12

15 671; MS (EI, 70 ev): m/z = 193 [(M) + ], 178, 164, 150, 136, 122, 120, 108, 94, 80, 67, 53; HRMS (ESI FTMS, positive ion): calculated for C 13 H 24 N (M + H) + = found = Decyl 2 methyl 1H pyrrole (6h) Pyrrole 6h was obtained by procedure A as a light yellow solid (754 mg, 3.4 mmol, 36%). 1 H NMR (600 MHz, CDCl 3 ): δ = 0.88 (t, 3 J 10,9 = 6.8 Hz, 3H, 10 H), (m, 14H, 3, 4,5, 6, 7, 8 H), (m, 2H, 2 H), 2.18 (s, 3H, 1 H), 2.37 (t, 3 J 1,2 = 7.7 Hz, 2H, 1 H), 6.01 (t, 3 J 4,5 = 2.8 Hz, 4 J 4,1 = 2.8 Hz, 1H, 4 H), 6.58 (t, 3 J 5,4 = 2.7 Hz, 3 J 5,1 = 2.7 Hz, 1H, 5 H), 7.69 (brs, 1H, 1 NH); 13 C NMR (151 MHz, CDCl 3 ): δ = (C 1 ), (C 10 ), 22.71, (C 1 ), 29.38, 29.62, 29.68, 29.71, 31.37, 31.93, (C 4), (C 5), (C 3), (C 2); IR (atr film): ῦ [cm 1 ] = 3379; 2922; 2853; 1465; 1378; 1246; 1110; 953; 901; 832; 709; 670; MS (EI, 70 ev): m/z = 221 [(M) + ], 206, 192, 178, 164, 150, 136, 122, 120, 108, 94, 80, 67, 53; HRMS (ESI FTMS, positive ion): calculated for C 15 H 28 N (M + H) + = found = Dodecyl 2 methyl 1H pyrrole (6i) Pyrrole 6i was obtained by procedure A as a light yellow solid (1.06 g, 4.2 mmol, 41%). 1 H NMR (600 MHz, CDCl 3 ): δ = 0.88 (t, 3 J 12,11 = 6.9 Hz, 3H, 12 H), (m, 18H, 3, 4, 5, 6, 7, 8, 9, 10, 11 H), (m, 2H, 2 H), 2.18 (s, 3H, 1 H), 2.37 (t, 3 J 1,2 = 7.7 Hz, 2H, 1 H), 6.01 (t, 3 J 4,5 = 2.8 Hz, 4 J 4,1 = 2.8 Hz, 1H, 4 H), 6.58 (t, 3 J 5,4 = 2.7 Hz, 3 J 5,1 = 2.7 Hz, 1H, 5 H), 7.69 (brs, 1H, 1 NH); 13 C NMR (151 MHz, CDCl 3 ): δ = (C 1 ), (C 12 ), 22.71, (C 1 ), 29.38, 29.63, 29.67, 29.72, (C 2 ), 31.95, (C 4), (C 5), (C 3), (C 2); IR (atr film): ῦ [cm 1 ] = 3379; 2922; 2853; 1465; 1378; 1246; 1110; 901; 831; 710; 670; MS (EI, 70 ev): m/z = 249 [(M) + ], 234, 220, 206, 192, 178, 164, 150, 136, 122, 120, 108, 94, 80, 67, 53; HRMS (ESI FTMS, positive ion): calculated for C 17 H 32 N (M + H) + = found = S13

16 2 Ethyl 3 pentyl 1H pyrrole (6p) Pyrrole 6p was obtained by procedure A as a light yellow oil (121 mg, 0.7 mmol, 7%). 1 H NMR (600 MHz, CDCl 3 ): δ = 0.89 (t, 3 J 5,4 = 7.0 Hz, 3H, 5 H), 1.19 (t, 3 J 2,1 = 7.6 Hz, 3H, 2 H), (m, 4H, 3, 4 H), (m, 2H, 2 H), 2.39 (t, 3 J 1,2 = 7.7 Hz, 2H, 1 H), 2.58 (q, 3 J 1,2 = 7.6 Hz, 2H, 1 H), 6.02 (t, 3 J 4,5 = 2.8 Hz, 4 J 4,1 = 2.8 Hz, 1H, 4 H), 6.60 (t, 3 J 5,4 = 2.7 Hz, 3 J 5,1 = 2.7 Hz, 1H, 5 H), 7.74 (brs, 1H, 1 NH); 13 C NMR (151 MHz, CDCl 3 ): δ = (C 5 ), (C 2 ), (C 1 ), (C 3 ), (C 1 ), (C 2 ), (C 4 ), (C 4), (C 5), (C 3), (C 2); IR (atr film): ῦ [cm 1 ] = 3386; 2960; 2926; 2855; 1684; 1465; 1377; 1326; 1110; 1064; 1010; 956; 900; 831; 713; MS (EI, 70 ev): m/z = 165 [(M) + ], 150, 136, 122, 108, 94, 80, 67, 53; HRMS (ESI FTMS, positive ion): calculated for C 11 H 20 N (M + H) + = found = Butyl 3 propyl 1H pyrrole (6q) Pyrrole 6q was obtained by procedure A as a light yellow oil (248 mg, 1.5 mmol, 14%). 1 H NMR (600 MHz, CDCl 3 ): δ = 0.92 (t, 3 J 3,2 = 7.4 Hz, 3H, 3 H), 0.94 (t, 3 J 4,3 = 7.3 Hz, 3H, 4 H), (m, 2H, 3 H), (m, 4H, 2, 2 H), 2.36 (t, 3 J 1,2 = 7.7 Hz, 2H, 1 H), 2.54 (t, 3 J 1,2 = 7.7 Hz, 2H, 1 H), 6.01 (t, 3 J 4,5 = 2.8 Hz, 4 J 4,1 = 2.8 Hz, 1H, 4 H), 6.60 (t, 3 J 5,4 = 2.7 Hz, 3 J 5,1 = 2.7 Hz, 1H, 5 H), 7.72 (brs, 1H, 1 NH); 13 C NMR (151 MHz, CDCl 3 ): δ = (C 3 ), (C 4 ), (C 3 ), (C 2 ), (C 1 ), (C 1 ), (C 2 ), (C 4), (C 5), (C 3), (C 2); IR (atr film): ῦ [cm 1 ] = 3386; 2956; 2929; 2872; 2159; 1696; 1579; 1457; 1403; 1378; 1251; 1111; 1074; 1018; 905; 831; 803; 709; MS (EI, 70 ev): m/z = 165 [(M) + ], 136, 122, 106, 94, 80, 67, 53 The 1 H NMR and 13 C NMR data are in accordance to literature. 8 3 Butyl 2 pentyl 1H pyrrole (6r) Pyrrole 6r was obtained by procedure A as a light yellow oil (456 mg, 2.4 mmol, 27%). 1 H NMR (600 MHz, CDCl 3 ): δ = 0.89 (t, 3 J 4,3 = 6.8 Hz, 3H, 4 H), 0.92 (t, 3 J 5,4 = 7.4 Hz, 3H, 5 H), (m, 6H, 3, 4, 3 H), (m, 4H, 2, 2 H), 2.39 (t, 3 J 1,2 = 7.7 Hz, 2H, 1 H), 2.53 (t, 3 J 1,2 = 7.7 Hz, 2H, 1 H), 6.01 (t, 3 J 4,5 = 2.8 Hz, 4 J 4,1 = 2.8 Hz, 1H, 4 H), 6.60 (t, 3 J 5,4 = 2.7 Hz, 3 J 5,1 = 2.7 Hz, 1H, 5 H), 7.71 (brs, 1H, 1 NH); 13 C NMR (151 MHz, CDCl 3 ): δ = (C 4 ), (C 5 ), (C 3 ), (C 4 ), (C 1 ), (C 1 ), (C 2 ), (C 3 ), (C 2 ), S14

17 (C 4), (C 5), (C 3), (C 2); IR (atr film): ῦ [cm 1 ] = 3387; 2957; 2926; 2857; 1459; 1378; 1246; 1112; 1078; 1031; 960; 903; 832; 708; MS (EI, 70 ev): m/z = 193 [(M) + ], 150, 136, 94, 106, 94, 80, 67, 53; HRMS (ESI FTMS, positive ion): calculated for C 13 H 24 N (M + H) + = found = Hexyl 3 pentyl 1H pyrrole (6s) Pyrrole 6s was obtained by procedure A as a light yellow oil (781 mg, 3.5 mmol, 35%). 1 H NMR (600 MHz, CDCl 3 ): δ = (m, 6H, 6, 5 H), (m, 10H, 3, 4, 5, 3, 4 H), (m, 4H, 2, 2 H), 2.38 (t, 3 J 1,2 = 7.8 Hz, 2H, 1 H), 2.53 (t, 3 J 1,2 = 7.7 Hz, 2H, 1 H), 6.01 (t, 3 J 4,5 = 2.8 Hz, 4 J 4,1 = 2.8 Hz, 1H, 4 H), 6.60 (t, 3 J 5,4 = 2.7 Hz, 3 J 5,1 = 2.7 Hz, 1H, 5 H), 7.71 (brs, 1H, 1 NH); 13 C NMR (151 MHz, CDCl 3 ): δ = (C 5 ), (C 6 ), 22.64, 22.66, (C 1 ), (C 1 ), 29.18, 30.24, 31.25, 31.71, 31.89, (C 4), (C 5), (C 3), (C 2); IR (atr film): ῦ [cm 1 ] = 3385; 2956; 2925; 2855; 1460; 1378; 1113; 1075; 901; 831; 708; MS (EI, 70 ev): m/z = 221 [(M) + ], 206, 192, 178, 164, 150, 136, 120, 106, 94, 80, 67, 53; HRMS (ESI FTMS, positive ion): calculated for C 15 H 28 N (M + H) + = found = Tosyl 1H pyrrole (12) Pyrrole 12 was obtained by procedure B as a white grey solid (6.127 g, 28 mmol, 93%). 1 H NMR (600 MHz, CDCl 3 ): δ = 2.40 (s, 3H, 7 H), 6.28 (dd, 3 J 3,2/3,4/4,3/4,5 = 2.3 Hz, 2H, 3, 4 H), 7.15 (dd, 3 J 2,3/2,4/5,3/5,4 = 2.3 Hz, 2H, 2, 5 H), 7.28 (d, 3 J 3,2 /5,6 = 8.3 Hz, 2H, 3, 5 H), 7.74 (d, 3 J 2,3 /6,5 = 8.3 Hz, 2H, 2, 6 H); 13 C NMR (151 MHz, CDCl 3 ): δ = (C 7 ), (C 3, 4), (C 2, 5), (C 2, 6 ), (C 3, 5 ), (C 1 ), (C 4 ); IR (atr film): ῦ [cm 1 ] = 3142; 1596; 1538; 1494; 1459; 1401; 1360; 1309; 1292; 1182; 1169; 1078; 1058; 1034; 1016; 935; 812; 797; 755; 717; 702; 671; MS (EI, 70 ev): m/z = 221 [(M) + ], 155, 91, 65 The 1 H NMR, 13 C NMR, IR and MS data are in accordance to literature. 9 S15

18 3 Ethyl 1H pyrrole (6j) Pyrrole 6j was obtained by procedure B as a light yellow oil (123 mg, 1.3 mmol, 57%). 1 H NMR (600 MHz, CDCl 3 ): δ = 1.21 (t, 3 J 2,1 = 7.6 Hz, 3H, 2 H), 2.53 (q, 3 J 1,2 = 7.6 Hz, 2H, 1 H), (m, 1H, 4 H), (m, 1H, 2 H), (m, 1H, 5 H), 7.98 (brs, 1H, 1 NH); 13 C NMR (151 MHz, CDCl 3 ): δ = (C 2 ), (C 1 ), (C 4), (C 2), (C 5), (C 3); IR (atr film): ῦ [cm 1 ] = 3402; 2962; 2928; 2858; 1718; 1462; 1379; 1279; 1127; 1068; 965; 930; 888; 837; 762; 704; 665; MS (EI, 70 ev): m/z = 95 [(M) + ], 80, 53 The 1 H NMR data is in accordance to literature Propyl 1H pyrrole (6k) Pyrrole 6k was obtained by procedure B as a light yellow oil (161 mg, 1.5 mmol, 66%). 1 H NMR (600 MHz, CDCl 3 ): δ = 0.95 (t, 3 J 3,2 = 7.3 Hz, 3H, 3 H), (m, 2H, 2 H), 2.46 (t, 3 J 1,2 = 7.6 Hz, 2H, 1 H), (m, 1H, 4 H), (m, 1H, 2 H), (m, 1H, 5 H), 7.97 (brs, 1H, 1 NH); 13 C NMR (151 MHz, CDCl 3 ): δ = (C 3 ), (C 2 ), (C 1 ), (C 4), (C 2), (C 5), 124,49 (C 3); IR (atrfilm): ῦ [cm 1 ] = 3395; 2958; 2928; 2872; 1684; 1485; 1457; 1378; 1263; 1138; 1062; 961; 888; 839; 767; 710; MS (EI, 70 ev): m/z = 109 [(M) + ], 94, 80, 67, 53 The 13 C NMR data is in accordance to literature Pentyl 1H pyrrole (6l) Pyrrole 6l was obtained by procedure B as a light yellow oil (233 mg, 1.7 mmol, 40%). 1 H NMR (600 MHz, CDCl 3 ): δ = 0.89 (t, 3 J 5,4 = 6.2 Hz, 3H, 11 H), (m, 4H, 3, 4 H), (m, 2H, 2 H), 2.48 (t, 3 J 1,2 = 7.7 Hz, 2H, 1 H), (m, 1H, 4 H), (m, 1H, 2 H), (m, 1H, 5 H), 7.97 (brs, 1H, 1 NH); 13 C NMR (151 MHz, CDCl 3 ): δ = (C 5 ), (C 4 ), (C 1 ), (C 2 ), (C 3 ), (C 4), (C 2), (C 5), (C 3); IR (atr film): ῦ [cm 1 ] = 3396; 2957; 2925; 2856; 1710; 1485; 1466; 1379; 1290; 1138; 1061; 960; 920; 887; 841; 766; 707; MS (EI, 70 ev): m/z = 137 [(M) + ], 122, 108, 94, 80, 67, 53; HRMS (ESI FTMS, positive ion): calculated for C 9 H 16 N (M + H) + = found = The 13 C NMR data is in accordance to literature. 11 S16

19 3 Hexyl 1H pyrrole (6m) Pyrrole 6m was obtained by procedure B as a light yellow oil (96 mg, 0.6 mmol, 67%). 1 H NMR (600 MHz, CDCl 3 ): δ = 0.88 (t, 3 J 6,5 = 6.9 Hz, 3H, 6 H), (m, 6H, 3, 4, 5 H), (m, 2H, 2 H), 2.48 (t, 3 J 1,2 = 7.8 Hz, 2H, 1 H), (m, 1H, 4 H), (m, 1H, 2 H), (m, 1H, 5 H), 7.97 (brs, 1H, 1 NH); 13 C NMR (151 MHz, CDCl 3 ): δ = (C 6 ), (C 5 ), (C 1 ), (C 3 ), (C 2 ), (C 4 ), (C 4), (C 2), (C 5), (C 3); IR (atr film): ῦ [cm 1 ] = 3396; 2957; 2924; 2855; 1485; 1466; 1378; 1138; 1061; 955; 887; 840; 771; 707; MS (EI, 70 ev): m/z = 151 [(M) + ], 136, 122, 108, 94, 80, 67, 53 The 13 C NMR data is in accordance to literature Octyl 1H pyrrole (6n) Pyrrole 6n was obtained by procedure B as a light yellow solid (235 mg, 1.3 mmol, 58%). 1 H NMR (600 MHz, CDCl 3 ): δ = 0.88 (t, 3 J 8,7 = 6.8 Hz, 3H, 8 H), (m, 10H, 3, 4, 5, 6, 7 H), (m, 2H, 2 H), 2.48 (t, 3 J 1,2 = 7.8 Hz, 2H, 1 H), (m, 1H, 4 H), (m, 1H, 2 H), (m, 1H, 5 H), 7.97 (brs, 1H, 1 NH); 13 C NMR (151 MHz, CDCl 3 ): δ = (C 8 ), (C 7 ), (C 1 ), 29.35, 29.55, 29.59, (C 2 ), (C 6 ), (C 4), (C 2), (C 5), (C 3); IR (atr film): ῦ [cm 1 ] = 3394; 2956; 2923; 2854; 1465; 1378; 1062; 958; 887; 839; 767; 708; MS (EI, 70 ev): m/z = 179 [(M) + ], 150, 136, 122, 108, 94, 80, 67, 53; HRMS (ESI FTMS, positive ion): calculated for C 12 H 22 N (M + H) + = found = Undecyl 1H pyrrole (6o) Pyrrole 6o was obtained by procedure B as a light yellow solid (120 mg, 0.5 mmol, 46%). 1 H NMR (600 MHz, CDCl 3 ): δ = 0.88 (t, 3 J 11,10 = 6.9 Hz, 3H, 11 H), (m, 16H, 3, 4, 5, 6, 7, 8, 9, 10 H), (m, 2H, 2 H), 2.48 (t, 3 J 1,2 = 7.8 Hz, 2H, 1 H), (m, 1H, 4 H), (m, 1H, 2 H), (m, 1H, 5 H), 7.97 (brs, 1H, 1 NH); 13 C NMR (151 MHz, CDCl 3 ): δ = (C 11 ), 22.71, (C 1 ), 29.37, 29.58, S17

20 29.60, 29.67, 29.69, 29.72, (C 2 ), 31.94, (C 4), (C 2), (C 5), (C 3); IR (atr film): ῦ [cm 1 ] = 3393; 2922; 2853; 1466; 1378; 1138; 1062; 957; 887; 838; 768; 708; MS (EI, 70 ev): m/z = 221 [(M) + ], 192, 178, 164, 150, 136, 122, 108, 106, 94, 80, 67, 53; HRMS (ESI FTMS, positive ion): calculated for C 15 H 28 N (M + H) + = found = H Pyrrole 2 carbaldehyde (15) Pyrrole 15 was obtained by procedure C as a white solid (901 mg, 9.5 mmol, 95%). 1 H NMR (600 MHz, CDCl 3 ): δ = (m, 1H, 4 H), (m, 1H, 3 H), (m, 1H, 5 H), 9.52 (s, 1H, 1 H), (brs, 1H, 1 NH); 13 C NMR (151 MHz, CDCl 3 ): δ = (C 4), (C 3), (C 5), (C 2), (C 1 ); IR (atr film): ῦ [cm 1 ] = 3266; 2983; 2831; 1726; 1623; 1551; 1439; 1402; 1351; 1310; 1251; 1133; 1091; 1035; 965; 880; 847; 745; MS (EI, 70 ev): m/z = 95 [(M) + ], 66 The 1 H NMR and 13 C NMR data are in accordance to literature Methyl 1H pyrrole (6b) Pyrrole 6b was obtained by procedure C as a light yellow oil (667 mg, 8.2 mmol, 49%). 1 H NMR (600 MHz, CDCl 3 ): δ = 2.28 (s, 3H, 1 H), (m, 1H, 4 H), (m, 1H, 3 H), (m, 1H, 5 H), 7.86 (brs, 1H, 1 NH); 13 C NMR (151 MHz, CDCl 3 ): δ = (C 1 ), (C 4), (C 3), (C 5), (C 2); IR (atr film): ῦ [cm 1 ] = 3379; 3098; 2918; 1717; 1572; 1460; 1413; 1381; 1270; 1234; 1118; 1095; 1026; 978; 951; 885; 781; 706; MS (EI, 70 ev): m/z = 81 [(M) + ], 80, 53 The 1 H NMR and 13 C NMR data are in accordance to literature. 8 3 Allyl 2 methyl 1H pyrrole (6t) Pyrrole 6t was obtained by procedure A as a light yellow oil (440 mg, 3.6 mmol, 21%). 1 H NMR (600 MHz, CDCl 3 ): δ = 2.18 (s, 3H, 1 H), (d, 3 J 1,2 = 6.4 Hz, 2H, 1 H), 4.97 (d, 3 J 3,2 = 10.1 Hz, 1H, 3 H a ), 5.03 (dd, 3 J 3,2 = 17.1 Hz, 2 J 3a,3b = 1.8 Hz,1H, 3 H b ), 5.93 (ddt, 3 J 2,3b = 16.6 Hz, 3 J 2,3a = 10.0 Hz, 3 J 2,1 = 6.5 Hz, 1H, 2 H), 6.00 (t, 3 J 4,5 = 2.8 Hz, 4 J 4,1 = 2.7 Hz, 1H, 4 H), 6.59 (t, 3 J 5,4 = 2.7 Hz, 4 J 5,1 = 2.6Hz, 1H, 5 H), 7.74 (brs, 1H, 1 NH); 13 C NMR (151 MHz, CDCl 3 ): δ = (C 1 ), (C 1 ), (C 4), (C 3 ), (C 5), (C 3), (C 2), (C 2 ); IR (atr film): S18

21 ῦ [cm 1 ] = 3379; 3077; 2977; 2912; 1638; 1585; 1464; 1432; 1275; 1250; 1107; 993; 956; 910; 834; 771; 708; 672; MS (EI, 70 ev): m/z = 121 [(M) + ], 106, 94, 80, 53 The 1 H NMR and 13 C NMR data are in accordance to literature Methyl 3 (pent 4 en 1 yl) 1H pyrrole (6u) Pyrrole 6u was obtained by procedure A as a light yellow oil (470 mg, 3.2 mmol, 45%). 1 H NMR (600 MHz, CDCl 3 ): δ = (m, 2H, 2 H), (m, 2H, 3 H), 2.18 (s, 3H, 1 H), 2.40 (t, 3 J 1,2 = 7.8 Hz, 2H, 1 H), 4.95 (dd, 3 J 5,4 = 10.2 Hz, 2 J 5a,5b = 1.8Hz, 1H, 5 H a ), 5.02 (dd, 3 J 5,4 = 17.2 Hz, 2 J 5a,5b = 1.8Hz, 1H, 5 H b ), 5.85 (ddt, 3 J 4,5b = 17.0 Hz, 3 J 4,5a = 10.2 Hz, 3 J 4,3 = 6.6 Hz, 1H, 4 H), 6.01 (t, 3 J 4,5 = 2.8 Hz, 4 J 4,1 = 2.7 Hz, 1H, 4 H), 6.59 (t, 3 J 5,4 = 2.7 Hz, 4 J 5,1 = 2.6Hz, 1H, 5 H), 7.70 (brs, 1H, 1 NH); 13 C NMR (151 MHz, CDCl 3 ): δ = (C 1 ), (C 1 ), (C 2 ), (C 3 ), (C 4), (C 5 ), (C 5), (C 3), (C 2), (C 4 ); IR (atr film): ῦ [cm 1 ] = 3380; 3077; 2977; 2927; 2855; 1708; 1640; 1586; 1442; 1246; 1108; 991; 907; 832; 710; MS (EI, 70 ev): m/z = 149 [(M) + ], 134, 121, 107, 94, 80, 67, 53; HRMS (ESI FTMS, positive ion): calculated for C 10 H 16 N (M + H) + = found = S19

22 S8. NMR Spectra of synthesized compounds 2,3 Dimethyl 1H pyrrole (6c) Figure S 4 S20

23 2 Methyl 3 propyl 1H pyrrole (6d) Figure S 5 S21

24 3 Butyl 2 methyl 1H pyrrole (6d) Figure S 6 S22

25 2 Methyl 3 pentyl 1H pyrrole (2 Methyl 3 amyl 1H pyrrole, MAP, 6a) Figure S 7 S23

26 3 Hexyl 2 methyl 1H pyrrole (6f) Figure S 8 S24

27 2 Methyl 3 octyl 1H pyrrole (6g) Figure S 9 S25

28 3 Decyl 2 methyl 1H pyrrole (6h) Figure S 10 S26

29 3 Dodecyl 2 methyl 1H pyrrole (6i) Figure S 11 S27

30 2 Ethyl 3 pentyl 1H pyrrole (6p) Figure S 12 S28

31 2 Butyl 3 propyl 1H pyrrole (6q) Figure S 13 S29

32 3 Butyl 2 pentyl 1H pyrrole (6r) Figure S 14 S30

33 2 Hexyl 3 pentyl 1H pyrrole (6s) Figure S 15 S31

34 1 Tosyl 1H pyrrole (12) Figure S 16 S32

35 3 Ethyl 1H pyrrole (6j) Figure S 17 S33

36 3 Propyl 1H pyrrole (6k) Figure S 18 S34

37 3 Pentyl 1H pyrrole (6l) Figure S 19 S35

38 3 Hexyl 1H pyrrole (6m) Figure S 20 S36

39 3 Octyl 1H pyrrole (6n) Figure S 21 S37

40 3 Undecyl 1H pyrrole (6o) Figure S 22 S38

41 1H Pyrrole 2 carbaldehyde (15) Figure S 23 S39

42 2 Methyl 1H pyrrole (6b) Figure S 24 S40

43 3 Allyl 2 methyl 1H pyrrole (6t) Figure S 25 S41

44 2 Methyl 3 (pent 4 en 1 yl) 1H pyrrole (6u) Figure S 26 S42

45 S9. LC MS traces of prodiginines produced by precursor directed biosynthesis Precursor: 3 Butyl 2 methyl 1H pyrrole (6e) Figure S 27 Prodiginine 1e and prodigiosin (1a) Precursor: 3 Hexyl 2 methyl 1H pyrrole (6f) Figure S 28 Prodigiosin (1a) and prodiginine 1f S43

46 S10. Effective precursor concentration and DMSO toxicity Figure S 29 Prodigiosin (1a) titer of P. putida pig r2 ΔpigD supplemented with different concentrations of MAP (6a). Prodigiosin production was observed by means of photometric absorption of ethanolic extracts at 535 nm. Figure S 30 Dose response analysis of P. putida pig r2 ΔpigD exposed to DMSO. The toxicity was investigated by measuring the biomass after 15 h of cultivation. Effective concentrations are: EC 20 = 6.5%; EC 50 = 4.5%; EC 80 = 3.1%. S44

47 S11. LC MS traces of prodiginines produced by mutasynthesis Precursor: 2,3 Dimethyl 1H pyrrole (6c) Figure S 31 Prodiginine 1c Precursor: 2 Methyl 3 propyl 1H pyrrole (6d) Figure S 32 Prodiginine 1d S45

48 Precursor: 3 Butyl 2 methyl 1H pyrrole (6e) Figure S 33 Prodiginine 1e Precursor: 2 Methyl 3 pentyl 1H pyrrole (2 Methyl 3 amyl 1H pyrrole, MAP, 6a) Figure S 34 Prodigiosin (1a) S46

49 Precursor: 3 Hexyl 2 methyl 1H pyrrole (6f) Figure S 35 Prodiginine 1f Precursor: 2 Methyl 3 octyl 1H pyrrole (6g) Figure S 36 Prodiginine 1g S47

50 Precursor: 3 Decyl 2 methyl 1H pyrrole (6h) Figure S 37 Prodiginine 1h Precursor: 2 Butyl 3 propyl 1H pyrrole (6q) Figure S 38 Prodiginine 1q S48

51 Precursor: 2 Ethyl 3 pentyl 1H pyrrole (6p) Figure S 39 Prodiginine 1p Precursor: 3 Pentyl 1H pyrrole (6l) Figure S 40 Prodiginine 1l S49

52 Precursor: 3 Hexyl 1H pyrrole (6m) Figure S 41 Prodiginine 1m Precursor: 3 Octyl 1H pyrrole (6n) Figure S 42 Prodiginine 1n S50

53 Precursor: 3 Allyl 2 methyl 1H pyrrole (6t) Figure S 43 Prodiginine 1t Precursor: 2 Methyl 3 (pent 4 en 1 yl) 1H pyrrole (6u) Figure S 44 Prodiginine 1u S51

54 S12. NMR Spectra of prodiginines (mutasynthesis: preparative scale) Prodigiosin (1a) Figure S 45 S52

55 Prodiginine 1u Figure S 46 1 H NMR: Signals at 1.25 ppm and 0.89 ppm are assigned to polyurethane. S53

56 Prodiginine 1d Figure S 47 S54

57 Prodiginine 1g Figure S 48 S55

58 Prodigiosin (1a) HCl Prodigiosin (1a) was obtained by mutasynthesis in preparative scale as a dark red solid (17.2 mgl 1, 53.2 µmol, 11%). 1 H NMR (600 MHz, CDCl 3 ): δ = 0.90 (t, 3 J 11,10 = 6.9 Hz, 3H, 11 H), (m, 4H, 9 H, 10 H), (m, 2H, 7 H), 2.39 (t, 3 J 7,8 = 7.6 Hz, 2H, 7 H), 2.54 (s, 3H, 6 H), 3.99 (s, 3H, 7 H), 6.07 (d, 4 J 4,1 = 1.7 Hz, 1H, 4 H), (m, 1H, 4 H), (m, 1H, 4 H), 6.91 (ddd, 3 J 3,4 = 4.0 Hz, 4 J 3,5 = 2.4 Hz, 5 J 3,1 = 1.2 Hz, 1H, 3 H), 6.94 (s, 1H, 8 H), (m, 1H, 5 H), (brs, 1H, 1 NH), (brs, 2H, 1, 1 NH); 13 C NMR (151 MHz, CDCl 3 ): δ = (C 6 ), (C 11 ), (C 10 ), (C 7 ), (C 8 ), (C 9 ), (C 7 ), (C 4 ), (C 4), (C 8 ), (C 3), (C 2 ), (C 2), (C 5 ), (C 5), (C 4 ), (C 3 ), (C 2 ), (C 5 ), (C 3 ); IR (atr film): ῦ [cm 1 ] = 3150, 3102, 3071, 2955, 2922, 2855, 1628, 1605, 1578, 1545, 1508, 1449, 1412, 1387, 1356, 1339, 1329, 1261, 1252, 1200, 1138, 1082, 1067, 1043, 1026, 997, 989, 959, 891, 835, 808, 785, 777, 745, 737, 718, 698, 648, 623; HRMS (ESI FTMS, positive ion): calculated for C 20 H 26 N 3 O (M + H) + = found = The analytical data is in accordance to literature. 1 Prodiginine 1u, 4 methoxy 5 ((5 methyl 4 (pent 4 en 1 yl) 2H pyrrol 2 ylidene)methyl) 1H,1'H 2,2' bipyrrole HCl Prodiginine 1u was obtained by mutasynthesis in preparative scale as a dark red solid (19.8 mgl 1, 61.6 µmol, 12%). 1 H NMR (600 MHz, CDCl 3 ): δ = 1.65 (tt, 3 J 8,9 /8,7 = 7.5 Hz, 2H, 8 H), 2.10 (dd, 3 J 9,10 /9,8 = 7.2 Hz, 2H, 9 H), 2.42 (t, 3 J 7,8 = 7.7 Hz, 2H, 7 H), 2.54 (s, 3H, 6 H), 4.01 (s, 3H, 7 H), 4.99 (dd, 3 J 11 a,10 = 10.3 Hz, 2 J 11 a,11 b = 1.8 Hz, 1H, 11 a H), 5.03 (dd, 3 J 11 b,10 = 17.1 Hz, 2 J 11 b,11 a = 1.8 Hz, 1H, 11 b H), 5.82 (ddt, 3 J 10,11 b = 17.0 Hz, 3 J 10,11 a = 10.2 Hz, 3 J 10,9 a = 6.6 Hz, 1H, 10 H), 6.08 (d, 4 J 4,1 = 1.9 Hz, 1H, 4 H), (m, 1H, 4 H), (m, 1H, 4 H), (m, 1H, 3 H), 6.95 (s, 1H, 8 H), (m, 1H, 5 H), (brs, 1H, 1 NH), (brs, 2H, 1, 1 NH); 13 C NMR (151 MHz, CDCl 3 ): δ = (C 6 ), (C 7 ), (C 8 ), (C 9 ), (C 7 ), (C 4 ), (C 4), (C 11 ), (C 8 ), (C 3), (C 2 ), (C 2), (C 5 ), (C 5), (C 3 ), (C 4 ), (C 10 ), (C 2 ), (C 5 ), (C 3 ); IR (atr film): ῦ [cm 1 ] = 2958; 2928; 2858; 1728; 1631; 1605; 1577; 1545; 1514; 1464; 1377; 1277; 1123; 1071; 1041; 989; 961; 743; HRMS (ESI FTMS, positive ion): calculated for C 20 H 24 N 3 O (M + H) + = found = S56

59 Prodiginine 1d, 4 Methoxy 5 ((5 methyl 4 propyl 2H pyrrol 2 ylidene)methyl) 1H,1'H 2,2' bipyrrolee HCl Prodiginine 1d was obtained by mutasynthesis in preparative scale as a dark red solid (10.5 mgl 1, 35.5 µmol, 7%). 1 H NMR (600 MHz, CDCl 3 ): δ = 0.94 (t, 3 J 9,8 = 7.3 Hz, 3H, 9 H), (m, 2H, 8 H), 2.38 (t, 3 J 7,8 = 7.6 Hz, 2H, 7 H), 2.55 (s, 3H, 6 H), 4.00 (s, 3H, 7 H), 6.08 (d, 4 J 4,1 = 1.9 Hz, 1H, 4 H), (m, 1H, 4 H), 6.68 (d, 4 J 4,1 = 2.6 Hz, 1H, 4 H), 6.92 (ddd, 3 J 3,4 = =3.7 Hz, 4 J 3,5 = 2.4 Hz, 5 J 3,1 = 1.2 Hz, 1H, 3 H), 6.95 (s, 1H, 8 H), (m, 1H, 5 H), (brs, 1H, 1 NH), (brs, 2H, 1, 1 NH); 13 C NMR (151 MHz, CDCl 3 ): δ = (C 6 ), (C 9 ), (C 8 ), (C 7 ), (C 7 ), (C 4 ), (C 4), (C 8 ), (C 3), (C 2 ), (C 2), (C 5 ), (C 5), (C 3 ), (C 4 ), (C 2 ), (C 5 ), (C 3 ); IR (atr film): ῦ [cm 1 ] = 3157, 3100, 2959, 2926, 1724, 1635, 1607, 1575, 1542, 1513, 1451, 1416, 1338, 1279, 1263, 1250, 1157, 1135, 1083, 1067, 1043, 987, 960, 901, 881, 838, 816, 783, , 697, 665; HRMS (ESI FTMS, positive ion): calculated for C 18 H 22 N 3 O (M + H) + = found = Prodiginine 1g, 4 methoxy 5 ((5 methyl 4 octyl 2H pyrrol 2 ylidene)methyl) 1H,1'H 2,2' bipyrrole HCl Prodiginine 1g was obtained by mutasynthesis in preparative scale as a dark red solid (3.8 mgl 1, 10.4 µmol, 2%). 1 H NMR (600 MHz, CDCl 3 ): δ = 0.88 (t, 3 J 14,13 = 6.9 Hz, 3H, 14 H), (m, 10H, 9, 10, 11, 12, 13 H), (m, 2H, 8 H), 2.39 (t, 3 J 7,8 = 7.6 Hz, 2H, 7 H), 2.54 (s, 3H, 6 H), 4.00 (s, 3H, 7 H), (m, 1H, 4 H), (m, 1H, 4 H), (m, 1H, 4 H), (m, 1H, 3 H), 6.95 (s, 1H, 8 H), (m, 1H, 5 H), (brs, 1H, 1 NH), (brs, 2H, 1, 1 NH); 13 C NMR (151 MHz, CDCl 3 ): δ = (C 6 ), (C 14 ), 22.67, (C 7 ), 29.27, 29.29, 29.44, (C 8 ), 31.88, (C 7 ), (C 4 ), (C 4), (C 8 ), (C 3), (C 2 ), (C 2), (C 5 ), (C 5), (C 4 ), (C 3 ), (C 2 ), (C 5 ), (C 3 ); IR (atr film): ῦ [cm 1 ] = 3162, 3100, 2955, 2921, 2852, 1635, 1607, 1577, 1544, 1512, 1456, 1413, 1387, 1354, 1328, 1279, 1264, 1251, 1144, 1135, 1107, 1066, 1043, 1000, 988, 958, 887, 838, 813, 745, 718, 697; HRMS (ESI FTMS, positive ion): calculated for C 23 H 32 N 3 O (M + H) + = found = S57

60 S13. LC MS traces of prodiginines produced by in vitro biotransformation with PigC Precursor: 2,3 Dimethyl 1H pyrrole (6c) Figure S 49 Prodiginine 1c Precursor: 2 Methyl 3 propyl 1H pyrrole (6d) Figure S 50 Prodiginine 1d S58

61 Precursor: 3 Butyl 2 methyl 1H pyrrole (6e) Figure S 51 Prodiginine 1e Precursor: 2 Methyl 3 pentyl 1H pyrrole (2 Methyl 3 amyl 1H pyrrole, MAP, 6a) Figure S 52 Prodigiosin (1a) S59

62 Precursor: 3 Hexyl 2 methyl 1H pyrrole (6f) Figure S 53 Prodiginine 1f Precursor: 2 Methyl 3 octyl 1H pyrrole (6g) Figure S 54 Prodiginine 1g S60

63 Precursor: 3 Decyl 2 methyl 1H pyrrole (6h) Figure S 55 Prodiginine 1h Precursor: 2 Butyl 3 propyl 1H pyrrole (6q) Figure S 56 Prodiginine 1q S61

64 Precursor: 3 Butyl 2 pentyl 1H pyrrole (6r) Figure S 57 Prodiginine 1r Precursor: 2 Ethyl 3 pentyl 1H pyrrole (6p) Figure S 58 Prodiginine 1p S62

65 Precursor: 3 Pentyl 1H pyrrole (6l) Figure S 59 Prodiginine 1l Precursor: 3 Hexyl 1H pyrrole (6m) Figure S 60 Prodiginine 1m S63

66 Precursor: 3 Octyl 1H pyrrole (6n) Figure S 61 Prodiginine 1n Precursor: 2 Methyl 1H pyrrole (6b) Figure S 62 Prodiginine 1b S64

67 S14. Extinction coefficients of prodiginines Figure S 63 Determination of extinction coefficients at 535 nm in acidified ethanol (4% v/v of 1 N HCl): ε 535 (1d) = 125,776 ± 6,450 M 1 cm 1 and ε 535 (1g) = 189,904 ± 2,950 M 1 cm 1. Approximation for ε 535 (1c) = 90,943 M 1 cm 1 ε 535 (1e) = 132,946 M 1 cm 1, ε 535 (1f) = 160,948 M 1 cm 1, ε 535 (1h) = 216,952 M 1 cm 1. For prodigiosin (1a) the previously reported molar extinction coefficient ε 535 (1a) = 139,800 ± 5,100 M 1 cm 1 was used. S65

68 S15. EC 50 values Table S 3 EC 50 values of tested compounds. compound EC 50 [nm] SD 1a d g q u Obatoclax mesylate (9) S66

69 S16. Vector maps S67

70 S17. References [1] Domröse, A., Klein, A. S., Hage Hülsmann, J., Thies, S., Svensson, V., Classen, T., Pietruszka, J., Jaeger, K. E., Drepper, T., and Loeschcke, A. (2015) Efficient recombinant production of prodigiosin in Pseudomonas putida, Front. Microbiol. 6, 972. [2] Katritzky, A. R., Ledoux, S., and Nair, S. K. (2003) Benzannulation of 3 substituted pyrroles to indoles, J. Org. Chem. 68, [3] Huffman, J. W., Smith, V. J., and Padgett, L. W. (2008) Acylation of N p toluenesulfonylpyrrole under Friedel Crafts conditions: evidence for organoaluminum intermediates, Tetrahedron 64, [4] Kakushima, M., Hamel, P., Frenette, R., and Rokach, J. (1983) Regioselective synthesis of Acylpyrroles, J. Org. Chem. 48, [5] He, Y., Lin, M., Li, Z., Liang, X., Li, G., and Antilla, J. C. (2011) Direct synthesis of chiral 1,2,3,4 tetrahydropyrrolo[1,2 a]pyrazines via a catalytic asymmetric intramolecular aza Friedel Crafts reaction, Org. Lett. 13, [6] Poirel, A., De Nicola, A., Retailleau, P., and Ziessel, R. (2012) Oxidative coupling of 1,7,8 unsubstituted BODIPYs: synthesis and electrochemical and spectroscopic properties, J. Org. Chem. 77, [7] Williamson, N. R., Simonsen, H. T., Ahmed, R. A. A., Goldet, G., Slater, H., Woodley, L., Leeper, F. J., and Salmond, G. P. C. (2005) Biosynthesis of the red antibiotic, prodigiosin, in Serratia: identification of a novel 2 methyl 3 n amyl pyrrole (MAP) assembly pathway, definition of the terminal condensing enzyme, and implications for undecylprodigiosin biosynthesis in Streptomyces, Mol. Microbiol. 56, [8] Trofimov, B. A., Mikhaleva, A. b. I., Ivanov, A. V., Shcherbakova, V. S., and Ushakov, I. A. (2015) Expedient one pot synthesis of pyrroles from ketones, hydroxylamine, and 1,2 dichloroethane, Tetrahedron 71, [9] Schmidt, B., Krehl, S., and Jablowski, E. (2012) Assisted tandem catalytic RCM aromatization in the synthesis of pyrroles and furans, Org. Biomol. Chem. 10, [10] Hodgson, D. M., Bebbington, M. W. P., and Willis, P. (2003) Development of two processes for the synthesis of bridged azabicyclic systems: intermolecular radical addition homoallylic rearrangements leading to 2 azanorborn 5 enes and neophyl type radical rearrangements to 2 azabenzonorbornanes, Org. Biomol. Chem. 1, [11] Garrido, D. O. A., Buldain, G., Ojea, M. I., and Frydman, B. (1988) Synthesis of 2 alkylputrescines from 3 alkylpyrroles, J. Org. Chem. 53, [12] Law, K. R., and McErlean, C. S. (2013) Extending the Stetter reaction with 1,6 acceptors, Chem. Eur. J. 19, [13] Vasil'tsov, A. M., Mikhaleva, A. I., Nesterenko, R. N., and Sigalov, M. V. (1992) Alkenylation by 5 hexen 2 one oxime: Prototropic isomerization under Trofimov reaction conditions, Chem. Heterocycl. Compd. 28, S68