Re search Paper HPV112L1 HPV11 HPV HPV11. HPV11 VLPs, HPV(Human Papillomavirus, HPV) ( Papovaviridae), DNA, HPV( HPV16, 18) HPV HPV ,HPV ,90 %

Transcript

1 Re search Paper Acta Microbiologica Sinica 49 (11) : ; 4 November 2009 ISSN ; CN ΠQ http :ΠΠjournals. im. ac. cnπactamicrocn 11,,,,,,,, 3, (,,, ) :11 (HPV11 VLPs), ER2566 HPV112L1,, HPV112L1,,, HPV HPV11 VLPs HPV112L1, 95 % HPV112L1 DTT, 50 nm VLPs, ( ED 50 ) g, 10 6, HPV6, HPV18, HPV16, HPV11 VLPs, HPV11 : 11 ; ; ; ; :R37 :A : (2009) HPV(Human Papillomavirus, HPV) ( Papovaviridae), DNA, HPV( HPV16, 18) HPV,,,90 % HPV6, 11 [1 ], HPV11, HPV, HPV [2 ],HPV,, (Virus2like Particle, VLP) : 863 (2006AA020905) ; ( ) ; (2005DC105006) ; (NCET ) 3 Tel : ; Fax : ; E2mail : edu. cn : ( ),,,, E2mail : edu. cn : ; :

2 1528 Chunyan Yang et al. ΠActa Microbiologica Sinica (2009) 49 (11) HPV [3 ] HPV Gardasil Cervarix VLP HPV11 L1,, VLP, HPV11 VLP :pmd182t TaKaRa, Taq T4 DNA TaKaRa Marker PIERCE FPLC GE CENTRASETTE 5 PALL, 30 kda DynaPro MSΠX ( ) Protein Solutions J EM2100 EPICS XL BeckmanCoulter SPF BAL BΠc, :pto2t7 [4 ] ( Escherichia coli) DH5 ER2566 HPV6,11,16 D9 Christensen HPV11 p11l1h p11l2h Schiller 112 HPV112L1 NCBI GenBank, AF HPV112L1, 113 pto2t72hpv112l : HPV11L1 H11NF : 5 2AGTATCTCATATGTGGCGGCCTAG2 CGAC23 ; H11CR : 5 2ACTGGTCGACTTAC2 TTTCTGGTTTTGGTACG23 NdeI Sal ( ) PCR : HPV112L1 PCR, :95 5 min PCR, :95 1 min, 57 1 min,72 1 min, 25 ; min : 2 % PCR pmd182t, pmd182t2hpv112l1 Nde ΠSal pmd182t2hpv112l1 HPV112L1, pto2t7, pto2t72hpv112 L1, ( ) 114 HPV112L1 1 L pto2t72hpv112l1 (0115 mgπml) 40 L ER2566, OD , IPTG 015 mmolπl,25 8 h 1Π10 (20 mmolπl Tris ph712,150 mmolπl NaCl), 30 %, 4 4 h, 0122 m, AKTA explorer 100 CM Sepharose 4 Fast Flow, 500 mmolπl NaCl,800 mmolπl NaCl NaCl 2 molπl, Butyl Sepharose 4 Fast Flow, 20 mmolπl NaCl SDS2PAGE Western2blotting, Western2blotting HPV6, 11,16 D9 115 HPV11 VLPs HPV112L1 DTT 100 mmolπl,37 2 h (PALL ) PBS, 10, DTT, VLPs 116 HPV11 VLPs : HPV11 VLPs 0122 m,, Regulation : HPV11 VLPs 2 % ph710, 25000, 117 HPV11 VLPs HPV11 VLP : [5 ] HPV11 293FT ( Invitrogen) 96 ( Π ) 5 h, 10 %DMEM,

3 : 11.Π (2009) 49 (11) L 50 L 10 %DMEM HPV11 (moi = 011), HPV11 [5 ] 4 1 h 293FT 96, h,, = (1 - Π ) 100 % : 50 % % HPV112L1 VLP : (1) ( ED 50 ) : 3 4 BAL BΠc,HPV11 VLPs, gπ,3, 4, 10,,5,,,100, Reed2 Muench ( ED 50 ) (2) HPV6Π11Π16Π18 : 3 4 BAL BΠc HPV11 VLPs, HPV11 VLPs,, 100 gπ, 2 4, 100 g Π,,, HPV6Π11Π16Π HPV L1 GCG (licensed No , Accelrys Inc1) CLUSTAL W HPV L1 HPV, HPV6 ( AF ), HPV11 ( AF ), HPV16 ( AF ), HPV18 ( AY ), HPV33 ( M ), HPV45 ( X ), HPV52 ( X ), HPV58 (D ), 8 HPV L1, (distance methods) (Neighbor2 joining), Kimura protein distance,, GCG,, HPV112L1 1, HPV11 L1 (Lane 1) (Lane 2), 55 kda, 5 VLPs ( ),, (Lane 3), (Lane 5) (Lane 6), 95 %, VLPs 1 HPV112L1 SDS2PAGE( A) Western blot( B) Fig. 1 SDS2PAGE(A) and Western blot (B) analysis of expression and purification of HPV112L11 A, 10 % reduced SDS2PAGE; B, Western2 blotting with D9 monoclonal antibody ; M, Protein Molecular Weigh mark ; 1, Cell lysate precipitation ; 2, Cell lysate supernatant ; 3, Ammonium sulfate precipitation ; 4, Sample for CM chromatography ; 5, Interest fraction of CM chromatography ; 6, Interest fraction of Butyl chromatography.

4 1530 Chunyan Yang et al. ΠActa Microbiologica Sinica (2009) 49 (11) 212 HPV11 VLPs HPV11 L1 100 %, ( 2),, HPV11 HPV11 VLPs, 3, 100 %,, 50 nm, 30 nm, 1717 % HPV, 2 HPV11 Fig. 2 Dynamic light scattering analysis of HPV11L1 VLPs1 1 HPV11 VLPs ( ED 50 ) Table 1 Half2Effective Dose ( ED 50 ) of HPV11 VPLs in mice Dose Π g Positive Total Rate of SeroconversionΠ% ED 50 Π g HPV112L1 VLP ( ) Fig. 3 Transmission Electron Micrograph of HPV11L1 VLPs (25000 ). 213 HPV11 VLPs HPV11 VLPs : 1,01100 g 80 %, g,01011 g g 6 % 60 %,Reed2Muench ED g, HPV11 VLPs HPV11 VLPs 4, 4,,,, 7, HPV11 VLP Fig. 4 Neutralizing antibody titers of antiserum after vaccination1 HPV16Π18Π6Π11, 5,HPV11 HPV6, HPV18, HPV16 8 HPV( )L1

5 : 11.Π (2009) 49 (11) , HPV11 HPV6, HPV18, HPV16, HPV11 VLPs 5 HPV11VLP HPV6, HPV16, HPV18 VLP Fig. 5 Cross2neutralization titer of anti2hpv11vlp serum to HPV 6Π16Π 18 VLP1 3 HPV VLP, VLP HPV Merck Gardasil [6-7 ],GSK Cervarix [8 ] HPVL1, VLP, [9-10 ], HPV,, HPV, HPV HPV VLP, HPV11 HPV VLP L1,,,,, HPV2L1 HPV pto2 T7 (25 ) pto2t7 T7,, [4 ],, 6 GCG HPV L1 Fig. 6 Phylogenetic tree of L1 sequences of eight HPV types produced by GCG software. The GenBank accession number of L1 sequences of HPV types in GenBank was shown in parentheses1 The length of each branch indicates the evolutionary distances between different L1 sequences1 Bar, 10 substitutions per 100 residues1

6 1532 Chunyan Yang et al. ΠActa Microbiologica Sinica (2009) 49 (11),,, [ 5 ]. ( Chinese Journal of Biotechnology), 2000, 16 : ,,,. 16. ( Chinese Journal of Biotechnology), 2006, 22 (6) : 990 -,,SDS, 995., [ 6 ] Ruiz W, Mcclements WL Jansen KU, et al. Kinetics and, isotype profile of antibody responses in rhesus macaques, 95 %, ( ),, HPV112L1 VLPs,,, [ 7 ] induced following vaccination with HPV 6, 11, 16 and 18 L12virus2like particles formulated with or without Merck aluminum adjuvant. Journal of Immune Based Therapies and Vaccines, 2005, 3 (1) : 2. Villa LL, Costa RL Petta CA, et al. High sustained efficacy of a prophylactic quadrivalent human papillomavirus types 6Π 11Π16Π18 L1 virus2like particle vaccine through 5 years of follow2up. British Journal of Cancer, 2006, 95 (11) : 1459 HPV,HPV VLP [ 8 ] Harper DM, Franco EL, Wheeler C, et al. Efficacy of a [11-12 ], VLP [13 ], HPV11 VLPs, bivalent L1 virus2like particle vaccine in prevention of infection with human papillomavirus types 16 and 18 in young women : a randomised controlled trial. Lancet, 2004, 364 (9447) : HPV11 VLPs HPV6 HPV18 [ 9 ] Rose RC, Reichman RC, Bonnez W. Human, HPV6 papillomavirus ( HPV ) type 11 recombinant virus2like, particles induce the formation of neutralizing antibodies and detect HPV2specific antibodies in human sera. Journal of HPV11 HPV6 90 %, VLPs General Virology, 1994, 75 (8) : , HPV11 [ 10 ] Cook JC, Joyce J G, George HA, et al. Purification of VLPs, HPV virus2like particles of recombinant human papillomavirus type 11 major capsid protein L1 from Saccharomyces [ 1 ] Insinga RP, Dasbach EJ, Elbasha EH, et al. Incidence and duration of cervical human papillomavirus 6, 11, 16, and 18 infections in young women : an evaluation from multiple analytic perspectives1 Cancer Epidemiol Biomarkers Prevention, 2007, 16 (4) : [ 2 ] Roden RB, Greenstone HL, Kirnbauer R, et al. In vitro generation and type2specific neutralization of a human papillomavirus type 16 virion pseudotype. Journal of Virology, 1996, 70 (9) : [ 3 ] Zhou J, Sun XY, Stenzel Dj, et al. Expression of vaccinia recombinant HPV 16 L1 and L2 ORF proteins in epithelial cells is sufficient for assembly of HPV virion2like particles. Virology, 1991, 185 (1) : [ 4 ],,,. cerevisiae. Protein Expression and Purification, 1999, 17 (3) : [11 ] Orozco JJ, Carter JJ, Koutsky LA, et al. Humoral immune response recognizes a complex set of epitopes on human papillomavirus type 6 11 capsomers. Journal of Virology, 2005, 79 (15) : [12 ] Carter JJ, Wipf GC, Madeleine MM, et al. Identification of human papillomavirus type 16 L1 surface loops required for neutralization by human sera. Journal of Virology, 2006, 80 (10) : [13 ] Da Silva DM, Pastrana DV, Schiller JT, et al. Effect of preexisting neutralizing antibodies on the anti2tumor immune response induced by chimeric human papillomavirus virus2 like particle vaccines. Virology, 2001, 290 ( 2) :

7 : 11.Π (2009) 49 (11) 1533 Expression, purification and immunogenicity of human papillomavirus type 11 virus2like particles from Escherichia coli Chunyan Yan, Shaowei Li, Jin Wang, Minxi Wei, Bo Huang, Yudi Zhuang, Zhongyi Li, Huirong Pan, J un Zhang 3, Ningshao Xia (National Institute of Diagnostics and Vaccine Development in infectious diseases, Life Science School, Key Laboratory of the Ministry of Education for Cell Biology and Tumor Cell Engineering, Xiamen University, Xiamen , China) Abstract :[ Objective] To produce human papillomavirus type 11 virus2like particles ( HPV11 VLPs) from Escherichia coli and to investigate its immunogenicity and type cross neutralization nature. [ Methods ] We expressed the major capsid protein of HPV11 ( HPV112L1) in Escherichia coli ER2566 in non fusion fashion and purified by amino sulfate precipitation, ion2exchange chromatography and hydrophobic interaction chromatography, sequentially. Then we removed the reductant DTT to have the purified HPV112L1 self2assemble into VLPs in vitro. We investigated the morphology of these VLPs with dynamic light scattering and transmission electron microscopy. We assayed the immunogenicity of the resultant HPV11 VLPs by vaccinations on mice and evaluated by HPV6Π11Π16Π18 pseudovirion neutralization cell models. [ Results] We expressed HPV11 L1 in Escherichia coli with two forms, soluble and inclusion body. The soluble HPV11 L1 with over 95 % purity can self assemble to VLPs in high efficiency. Morphologically, these VLPs were globular, homogeneous and with a diameter of 50 nm, which is quite similar with native HPV11 virions. The half effective dosage ( ED 50 ) of HPV11 VLPs is g, and the maximum titer of neutralizing antibody elicited is averaged to The cross neutralization activity (against HPV6Π16Π18) of the anti2hpv11 serum was found to have exact correlation to the inter2type homology in amino acid alignment. [ Conclusion] We can provide HPV11 VLPs with highly immunogenicity from prokaryote expression system, which may pave a new way for research and development of prophylactic vaccine for HPV11. Keywords : human papillomavirus type 11 ; Escherichia coli ; virus2like particle ; immunogenicity ; cross neutralization ( : ) Supported by the National Programs for High Technology Research and Development of China (2006AA020905), the National Natural Science Foundation of China ( ), the Project in National Engineering Research Center (2005DC105006) and the Program for New Century Excellent Talents in University (NCET ) 3 Corresponding author. Tel : ; Fax : ; E2mail : edu. cn Received :13 April 2009ΠRevised : 11 June 2009