http / /cjbmb. bjmu. edu. cn Chinese Journal of Biochemistry and Molecular Biology GLC-82 GRP78 CHOP

Transcript

1 ISSN CN / Q http / /cjbmb. bjmu. edu. cn Chinese Journal of Biochemistry and Molecular Biology ~ 593 DOI /j. cnki. cjbmb Brefeldin A GLC * endoplasmic reticulum stress ERS unfolded protein response UPR ERS ERS A brefeldin A BFA cis-dichlorodiamine platinum CDDP MTT BFA GLC-82 IC ng /ml 4 μg /ml BFA CDDP GLC h PCR GRP78 CHOP BFA CDDP GLC-82 ERS A GLC-82 R73-34 The Synergistic Anti-cancer Effect of BFA and CDDP on Human Lung Cancer GLC-82 Cells WU Ming-Song 1 2 ZHENG Xiang 1 GENG Na-Na 1 ZHANG Zhi-Min 1 ZHAO Yan-Yu 1 WANG Zhe 1 LI Xue-Ying 1 * 1 Medical Genetic Department of Zunyi Medical University Zunyi Guizhou China 2 Special Key Laboratory of Oral Diseases Research Higher Education Institutions of Guizhou Province Research Centre of Medicine and Biology Zunyi Medical University Zunyi Guizhou China Abstract Endoplasmic reticulum stress ERS which triggers unfolded protein response UPR to J LH F * Tel /Fax leexueying4722@ 163. com Received December Accepted March Supported by Natural Science Foundation of Guizhou Province No. J LH Creative Team of Special Drug in Education Office of Guizhou Province Doctoral Scientific Fund of Zunyi Medical University F-655 Supporting Subject Funding of Medical Genetics in Zunyi Medical University * Corresponding author Tel /Fax leexueying4722@ 163. com

2 support cell survival is indicated as a new target for the development of cancer therapy despite longterm ERS initiates apoptosis. Combination of anti-cancer drugs can reduce side effects and synergistically enhance drug effects. In this study we investigated the synergistic anti-cancer effect of brefeldin A BFA and cis-dichlorodiamine platinum CDDP in human lung cancer cells. MTT assays revealed that BFA or CDDP alone inhibited the proliferation of GLC-82 human lung cancer cells with an IC50 of 100 ng /ml or 4 μg /ml respectively. At half doses of BFA and CDDP in combination showed more inhibitory effect at 24 hours with an observed synergism shown in the isobologram of cell proliferation index. With combined exposure of drugs more shrunk cells or abnormal cells with chromatin condensation were observed together with increased numbers of apoptotic bodies with nucleus and cytoplasm fragmentation. Real-time quantitative PCR RT-qPCR and Western blotting results showed that the levels of GRP78 and CHOP the endoplasmic reticulum stress markers were markedly increased as compared to single drug exposures. These data suggested that combination of BFA and CDDP could enhance the inhibitory effect on human lung cancer cells where the ERS pathway might be involved. Key words brefeldin A cis-dichlorodiamine platinum human lung cancer cell GLC-82 endoplasmic reticulum stress synergistic effect apoptosis WHO BFA % 22. 5% GLC-82 cis-dichlorodiamine platinum CDDP brefeldin A EP IMP Cell Signaling Technology MTT BBI RPMI-1640 Life GRP78 CHOP β-actin ProteinTech Group MMLV Promega RNAiso TM Plus SsoFast EvaGreen supermix PCR Bio-Rad endoplasmic reticulum stress ERS GOLD-SIM IX73 PCR CFX Connect Bio-Rad ERS ERS SpectraMax M2e MD 2 ERS 3 Nanodrop 2000 Thermo Scientific A brefeldin A BFA ERS ERS BFA 1. 2 GLC-82 RPMI % 100 U /ml 100 μg /ml % CO 2 4 BFA 3 ~ 4 d 1. 3 BFA GLC /

3 5 Brefeldin A GLC ml ml 5 actin 58 CHOP 30 s h β-actin ng /ml BFA μg / ml 24 h 10 μl MTT 5 mg /ml 4 h 2 - CT 0. 1 ml DMSO 10 min BCA 570 nm PAGE PVDF 5% A 1 h % = / A - A A - A combination index CI CI x 珋 ± s SPSS 19 CI = D 1 / DX 1 + D 2 / DX 2 CI < 1 CI = 1 P < CI > 1 2 dose reduction index DRI 2. 1 BFA CDDP GLC-82 MTT 24 h DRI DRI 1 = DX 1 / D 1 DRI 2 = DX 2 / D GLC h BFA 50 ng /ml BFA CDDP 2 μg /ml CDDP BFA + CDDP 50 ng /ml BFA 2 μg /ml CDDP 24 h Fig. 1 C 1. 5 DAPI 24 h BFA CDDP 100 DAPI 5 min % 358 nm 1. 6 PCR RNA cdna 1 Fig. 1 D EBFA CDDP GRP78 R TCAAGTTCTTGCCGTTCAAGG F AAATAAGCCTCAGCGGTTTCTT CHOP F CAAGA GGTCCTGTCTTCAGATGA R TCTGTTTCCGTTTCC TGGTTC β-actin F CGGGAAATCGTGCGTGAC R CAGGAAGGAAGGCTGGAAG IC57 BFA CDDP DRI 1. 8 ~ 4. 8 PCR cdna 1. 0 μl SsoFast EvaGreen supermix 5. 0 μl 1 μl ddh 2 O 10 μl s s 56 GRP78 β- 2 - CT h Image-Pro Plus t GLC-82 BFA CDDP GLC-82 IC ng /ml Fig. 1 A 4 μg /ml Fig. 1 B IC 50 GLC-82 BFA CDDP 24 h ± 4. 4 % ± 4. 9 % ± 4. 4 % BFA CDDP P < BFA CDDP 6 CI DRI 6 BFA CDDP 17 % IC17 57 % 1. 7 ~ 6. 0 Table 1BFA CDDP

4 Fig. 1 Inhibitory effect of BFA and CDDP on the growth of GLC-82 cells in vitro GLC-82 cells were treated with BFA ng /ml A CDDP μg /ml B as well as BFA and CDDP C for 24 hours. MTT method was used to test cell proliferation. The absorbance at 570 nm was measured using a microtiter plate reader SpectraMax 2e. Isobologram was used to analyze the cytotoxicity of BFA and CDDP treatments alone or in combination. The diagonal line represented the isoeffect line of additive. Points above this line indicated antagonism between drugs and points below this line indicated synergy D. Isobologram analysis and combination index analysis of the induction of differentiation in GLC-82 cells treated with the combination of BFA and CDDP a combination index of 1. 0 solid line reflected additive effects whereas values greater than or less than 1. 0 indicated antagonism or synergy respectively E. The data were presented as means ± SD of three independent experiments. * P < or ** P < compared with the control group without BFA and CDDP # P < or ## P < compared with the group of BFA + CDDP Table 1 Combination index CI and dose reduction index DRI for drug combination by BFA and CDDP Percentage BFA CDDP Combination of inhibition Concentration Dose reduction Concentration Dose reduction index % ng /ml index μg /ml index Drug combinations Alone Mix Alone Mix BFA CDDP GLC-82 Fig. 2 B CDDP Fig. 2 C BFA + CDDP Fig. 2 Fig. 2 D BFA A BFA CDDP GLC-82

5 5 Brefeldin A GLC Fig BFA GRP78 24 h CDDP GRP78 Fig. 4 A C mrna Fig. 5 A BFA BFA + CDDP GRP78 BFA + CDDP GRP78 BFA P < CDDP P < BFA CDDP GLC-82 GRP BFA CDDP CHOP 24 h BFA CDDP GLC-82 CHOP Fig. 4 A B mrna Fig. 5 B BFA + CDDP CHOP P < BFA CDDP CHOP Fig. 5 Fig. 2 Morphology change of GLC-82 cell was BFA induced by combination of BFA and CDDP The cells were treated with BFA or / and CDDP for 24 h and CDDP IC50 IC50 taken photo by contrast phase microscope. Amplification GLC-82 BFA CDDP ratio of cells 100 GLC-82 BFA CDDP 2. 3 BFA CDDP GLC-82 BFA CDDP DAPI DNA BFA Fig. 3 CDDP A BFA CDDP CDDP Fig. 3 B C BFA + Fig. 3 D 3 CDDP 8 BFA CDDP Fig. 3 Combination of BFA and CDDP induced GLC-82 cell nucleus change The cells were treated with BFA or /and CDDP for 24 h then dyed by DAPI and taken photo by inverted fluorescence microscope. The arrow indicated apoptotic body or nuclear fragment. Amplification ratio of cell nucleus 200

6 Fig. 4 protein Effect of combination of BFA 50 ng /ml and CDDP 2 μg /ml on expression of GRP78 and CHOP After GLC-82 cells were treated with BFA combined CDDP for 24 hours cell lysates were prepared. The proteins were separated by 10% SDS-PAGE. After transferring onto the PVDF membrane the blots were probed with anti- GRP78 anti-chop antibodies. β-actin was used as normalization. The amount of every protein was quantified by the integrated density Image-Pro Plus of each band. The data were presented as means ± SD of three independent experiments. * P < or ** P < compared with the control group without BFA and CDDP # P < or ## P < compared with the group of BFA + CDDP Fig. 5 Effect of combination of BFA 50 ng /ml and CDDP 2 μg /ml on expression of GRP78 and CHOP mrna Total RNA was isolated using TRIzol reagent and treated with DNaseI to remove genomic DNA. GRP78 CHOP and β-actin were quantified by real-time PCR with a CFX Connect using a commercial kit. The data were presented as means ± SD of three independent experiments. * P < or ** P < compared with the group of BFA + CDDP ERS 10 GRP78 CHOP ERS 11 BFA CDDP ERS 3 PERK IRE1 ATF6 9 CHOP BFA ERS 78 glucose regulated protein 78kD GRP78 ERS GRP78 3 IRE1-XBP1 PERK-eIF2α GLC h GLC-82 GRP78 BFA 3 3 ERS CHOP CHOP 1 ATF6 1 C bzip CCAAT / CCAAT / N GADD34 ERO1 enhancer-binding protein homologous protein CHOP DR5 12

7 5 Brefeldin A GLC ERS IRE1α-XBP1 13 PERK-eIF2α 14 DNA 15 DNA caspases ERS 3 BFA GLC-82 BFA References 1 WHO 2014 EB /OL http / / www. who. int /cancer /country-profiles /chn_ zh. pdf ua = 1 BP1 dephosphorylation J. Oncogene A J. Xue F Wang YJ Zheng YG. Advance in the antitumor drug development of brefeldin A J. Bull Sci Technol Wlodkowic D Skommer J McGuinness D et al. ER-Golgi network a future target for anti-cancer therapy J. Leuk Res Tameire F Verginadis II Koumenis C. Cell intrinsic and extrinsic activators of the unfolded protein response in cancer Mechanisms and targets for therapy J. Semin Cancer Biol Ye Y Xu X Zhang M et al. Low-dose arsenic trioxide combined with aclacinomycin A synergistically enhances the cytotoxic effect on human acute myelogenous leukemia cell lines by induction of apoptosis J. Leuk Lymphoma Li CJ Chu CY Huang LH et al. Synergistic anticancer activity of triptolide combined with cisplatin enhances apoptosis in gastric cancer in vitro and in vivo J. Cancer Lett Rakitina TV Vasilevskaya IA O Dwyer PJ. Inhibition of G1 /S transition potentiates oxaliplatin-induced cell death in colon cancer cell lines J. Biochem Pharmacol M. Li D K Zhang S G Zhang J C. Pharmacy Comprehensive Knowledge and Skill M. Beijing China Medical Science and Technology Publishing House Ozcan L Tabas I. Role of endoplasmic reticulum stress in metabolic disease and other disorders J. Annu Rev Med Tabas I Ron D. Integrating the mechanisms of apoptosis induced by endoplasmic reticulum stress J. Nat Cell Biol He K Zheng X Li M et al. mtor inhibitors induce apoptosis in colon cancer cells via CHOP-dependent DR5 induction on 4E- 12 Nishitoh H. CHOP is a multifunctional transcription factor in the ER stress response J. J Biochem Strome ED Wu X Kimmel M et al. Heterozygous screen in Saccharomyces cerevisiae identifies dosage-sensitive genes that affect chromosome stability J. Genetics Nagelkerke A Bussink J van der Kogel AJ et al. The PERK / ATF4 / LAMP3-arm of the unfolded protein response affects radioresistance by interfering with the DNA damage response J. Radiother Oncol Dufey E Urra H Hetz C. ER proteostasis addiction in cancer biology Novel concepts J. Semin Cancer Biol J. Huang HP Wu MS. Endoplasmic reticulum stress a novel target for cancer therapy J. J Mod Med Health