Sar1B-mediated Regulation of Triglyceride and Cholesterol

Transcript

1 FIGURE S1. Comparing Sar1A- and Sar1B-flag Over-expression on RNA Profiles of McArdle RH7777 cells. RNA was prepared from two Sar1B:H79G-flag cell lines and two control cell lines plus two Sar1B-flag and one Sar1A-flag cell lines (a minimum of three replicates from each line). Biotinlabelled crnas were hybridized to Affymetrix Rat Expression Arrays containing 31,0099 probe-sets. Data were analyzed as described in the Methods Sections. (A) At a false discovery rate (FDR) of and a delta (Δ) of 6.8, SAM identified 89 probe-sets that returned significantly different expression values following hybridization to Sar1A-flag cell line crna. Expression values of three probe-sets were unaltered by Sar1B-flag (n=11,118; FDR 0.015, Δ 2.0) and Sar1B:H79G-flag expression (n=10,384; FDR 0.003, Δ 2.8). (B) At a FDR of and a Δ of 6.9, 916 probe-sets were altered by Sar1B-flag expression, including 70 that were unaltered by Sar1A-flag (n=5148; FDR 0.009, delta 1.9) and Sar1B:H79G -flag expression (n=10,384; FDR 0.003, delta 2.8). FIGURE S2. ApoB and Mttp knock-down does not decrease representative cholesterol biosynthesis gene expression. McArdle-Rh7777 cells were transfected with the specified sirnas. Levels of representative mrnas were assayed by RT-qPCR. Data (mean±sem) are from three independent experiments. FIGURE S3. Constitutively Active Sar1B and Sar1B-Deficiency do not Alter precursor (P), but or mature (M) ATF6 Levels in McArdle-RH7777 cells (A-B) Precursor (P) and mature (M) ATF6 protein in stably over-expressing Sar1B:H79G and empty vector control cells, insert panels show Western blot data from the same gel.. (C-D) Precursor (P) and mature (M) ATF6 protein in Sar1a and Sar1a+Sar1b knock-down and control McArdle-RH7777 cells. (E-F) Sar1b knock-down has no significant effect on ATF6 protein. (A-F) Data (mean±sem) are from a minimum of three independent experiments. 1

2 Table S1. Custom Primers used for RT-qPCR Gene Forward Primer Reverse Primer Cells assayed Hmgcr * AAGTGGTCCCACGAATGAAG CGTGCATTTTCTCCAGGATT CHO Hmgcs1 * GTCACACAAGATGCCACACC GTGTGTCCTCCCTGAGCTTC CHO Lec35 * GGCCAGCTTTCAGCTATCAC CACAAAGACTCCAGCCATGA CHO Rps13 * CTGACGACGTGAAGGAACAA ACCAGTCACAAAACGGACCT CHO Idi1 * GCGCTTAAAAGCTGAATTGG CCGGATTCAAGGTTACGTTC CHO Dhcr7 GCCGAAGACTGCAAATTCAC AGAACAGCTTGAAGTCAAACCA CHO Mvd GACCAGCGTGGAGACCAG CCTGGAGGTGTCATTGAGGT CHO Fdft1 AATCAGACCAGTCGCAGCTT CGGGCTCATAGAGGAAAGTG CHO Sar1a AATGGCTTCAGCAGTGTGC AGCATGTGAAGAAGAGTGGTTTT CHO SAR1A TTGGGCTTTATGGACAGACC CTTGCCTCTTGAGCACACTG Intestinal Biopsies Sar1b TGCTGGCATGACGTTTACA CCCTTTCCTGTTGTCTGACC CHO SAR1B AAGGGGCTGATGCGAACT GGCGACAAGAGGGAAACTCT Intestinal Biopsies Sec23A TCAAGGGAAATAAAGATTTCAGGA AGTTTGAGCATCTGCCCAGT CHO SEC23A GATCGTGGCATGACATTGAC GCTCGATTAGCCAATGCTTC Intestinal Biopsies Sec23B CTTGTGCCCTTGACCAAACT CTTCAGTTCCCGAGAGGTCTT CHO SEC23B ACCTGTATGCTTGGGGACAG GCCAGCTTCTTCAAATGGTC Intestinal Biopsies Sec24D CAACAGGTGCAAAGCCTACA TGTGGTCCAGATGTTGGAAA CHO SEC31A GCCTCCTGGAACAACAGGTA GGGTCATTCCAACCATTCTG Intestinal Biopsies SEC31B GGACCCTTCTCTGGACTTGA CCCAGACCAGCTTGTGAAAC Intestinal Biopsies Srebf1a CTTGACCGACATCGAAGACA CCCAGAGAAGCAGGAGAAGA McArdle RH7777 Srebf1c GAGCCATGGATTGCACATTT CTGTCTCACCCCCAGCATAG McArdle RH7777 * Sequences from Cricetulus griseus were available for Hmgcr (Chin et al., 1984); Hmgcs1 (Gil et al., 1986); Idi1 (AF ), Lec35 (SL15; U ) and Rps13 (NM_ ). In cases where Cricetulus griseus cdna sequences were unavailable, primer sequences were derived from known mammalian sequences using the most conserved regions. References: Chin DJ, Gil G, Russell DW, Liscum L, Luskey KL, Basu SK, Okayama H, Berg P, Goldstein JL, Brown MS. Nucleotide sequence of 3-hydroxy-3-methyl-glutaryl coenzyme A reductase, a glycoprotein of endoplasmic reticulum. Nature. 1984; 308(5960): Gil G, Goldstein JL, Slaughter CA, Brown MS. Cytoplasmic 3-hydroxy-3-methylglutaryl coenzyme A synthase from the hamster. I. Isolation and sequencing of a full-length cdna. J Biol Chem. 1986; 261(8):

3 Table S2. Fold-Changes in Sec mrna levels in McArdle RH7777 cells over-expressing Sar1 Gene Symbol Microarray RT-qPCR* Probe Affy_ID Sar1B:H79G FDR Sar1B FDR Sar1A FDR Sar1B:H79G # Sar1B # Sar1A # Sec23A _at ± ± ± Sec23B _at ± ± ± Sec24A _at ± ± ± Sec24B _at ± ± ± Sec24B _at Sec24C _at ± ± ± Sec24C _at Sec24D _at ± ± ± Sec31A _at ± ± ± Sec31B _at > ± ± ± Sec _at > ± ± ± *RT-qPCRs were performed on RNA prepared from a separate experiment involving three biological observations. Results represent mean fold-changes (±SEM) of two independent cell-lines compared to control cell lines. Fold-change FDR=false detection rate Data from one cell line. 3

4 Table S3. Enrichment/Under-representation of Gene Ontology (GO) Biological Processes Terms in the Sar1A Differentially Expressed Probe-Set*: Results of DAVID (Database for Annotation, Visualization and Integrated Discovery) Cluster Description GO terms in Cluster Differentially expressed genes (n) Enrichment score P value range Biosynthetic processes ; x x10-2 Cellular component organisation, biogenesis and intracellular transport ; ; ; x x10-2 Organic acid metabolic processes ; ; x x10-2 Metabolic processes ; x x10-2 Macromolecular complex assembly x10-2 Response to metal ion and inorganic substances ; x x10-2 Response to organic substance x10-2 Regulation of cell proliferation ; x x10-2 Positive regulation of cell proliferation & response to organic substances ; ; x x10-2 *Probe-sets (n=89) identified by SAM (FDR , Δ 6.8) to be differentially expressed compared to control cell lines. 50/82 differentially expressed genes (89 probe-sets) were returned in one or more of an 'Enriched Biological Processes Ontology' category. Bold and underlining denote respectively GO terms returned in Sar1B:H79G-flag and Sar1B-flag differentially expressed gene lists. Grey highlights GO terms enriched/under-represented (i.e. in the opposite direction) in Sar1B:H79G-flag and Sar1B-flag gene lists. Italics indicate GO terms under-represented in Sar1B-flag gene list. 4

5 Table S4: Enrichment/Under-representation of Gene Ontology (GO) Terms in Sar1B Differentially Expressed Gene List*: Results of DAVID (Database for Annotation, Visualization and Integrated Discovery). Cluster Description (BP) Cellular component organisation, biogenesis and intracellular transport GO terms in Cluster ; ; ; ; ; ; ; ; ; ; ; Differentially expressed genes (n) Enrichment Score P value range x x10-5 Macromolecular complex assembly ; ; x x10-6 Vesicle-mediated transport and secretion Macromolecular metabolic process Regulation of cellular, biological and metabolic processes ; ; ; ; ; x x ; ; ; ; ; ; ; ; ; ; ; ; ; ; ; ; ; ; ; : ; ; ; ; ; ; x x x x10-2 Cellular developmental processes and apoptosis ; ; ; ; ; ; ; ; x x10-2 Positive Regulation of transcription and metabolic processes Cell Cycle Negative regulation of cellular, biological and metabolic processes ; ; ; ; ; ; ; ; ; ; ; ; ; ; ; ; ; x x x x ; ; ; ; ; x x10-2 Protein modification ; ; ; x x10-2 TGF-b receptor, transmembrane receptor and protein, threonine kinase pathways Membrane invagination and endocytosis ; x x ; ; x x10-2 Protein and macromolecular catabolic processes ; ; ; ; ; ; ; ; x x10-2 5

6 Regulation of apoptosis and antiapoptosis Establishment of vesicle and organelle localisation Cytoskeleton and microtubule intracellular transport ; ; x x ; ; ; x x ; ; x x10-2 Regulation of cellular component organization and biogenesis ; ; ; ; ; ; ; ; ; ; x x10-2 Ubiquitin cycle x10-2 Protein targeting and import into nucleus ; x x10-2 RNA processing ; ; x x10-2 Regulation of protein metabolic processes ; ; ; ; x x10-2 Regulation of cell proliferation X10-2 Protein amino acid acylation x10-2 Developmental process x10-4 Regulation of growth ; x x10-2 Regulation of apoptosis ; x x10-2 Negative regulation of cell migration x10-2 Photoreceptor cell differentiation x10-2 JAK-STAT cascade x10-2 Nitrogen compound biosynthetic process NADP metabolism and water-soluble vitamin process Mitotic metaphase/anaphase transition Regulation of cyclin-dependent protein kinase activity x ; ; ; x x x x10-2 6

7 Regulation of biological quality x10-2 *Probe-sets (n=916) returned by SAM as differentially expressed at a FDR and Δ /858 differentially expressed genes (n=916 probe-sets) were returned in one or more of an 'Enriched/Under-represented Gene Ontology' category. BP=biological process Bold and underlining denote respectively GO terms returned in Sar1B:H79G-flag and Sar1A-flag differentially expressed gene lists. Grey and Italic highlight GO terms under-represented in Sar1B:H79G-flag and Sar1A-flag gene lists. 7

8 Table S5. Collation of RNA Expression Data from Probe-sets Representing (A) Cholesterol Synthesis Genes, Ldlr and Pcsk9, (B) Fatty Acid Metabolism Genes and (C) Triglyceride Biosynthesis, Degradation and Secretion Genes, and RT-qPCR validation for Representative Genes in McArdle RH-7777 Cells Microarray RT-qPCR Sar1B:H79G-flag* Sar1B-flag* Sar1A-flag*, Sar1B:H79G-flag Sar1B-flag Sar1A-flag Affy_ID Gene Name Symbol d.value R.fold FDR d.value R.fold FDR d.value R.fold FDR A _at Acetoacetyl-CoA synthase Aacs A _at Acetyl-coenzyme A acetyltransferase 1 (m) Acat > A _at Acetyl-coenzyme A acetyltransferase 2 (c) Acat A _at Acetyl-coenzyme A acetyltransferase 2 (c) Acat A _at HMG CoA synthase 1 (c) Hmgcs ± ± ± A _at HMG CoA synthase 2 (m) Hmgcs A _at HMG CoA Reductase Hmgcr ± ± ± A _at Mevalonate Kinase Mvk ± ± ± A _at Mevalonate Kinase Mvk A _at Mevalonate Kinase Mvk A _at Phosphomevalonate Kinase Pmvk A _at Mevalonate-5-pyrophosphate decarboxylase Mvd ± ± ± A _at Isopentenyl-diphosphate delta isomerase Idi ± ± ± A _at Isopentenyl-diphosphate delta isomerase Idi A _at Methylcrotonoyl-Coenzyme A carboxylase 1 (alpha) Mccc A _at Methylcrotonoyl-Coenzyme A carboxylase 1 (beta) Mccc A _at 3-hydroxymethyl-3-methylglutaryl-Coenzyme A lyase Hmgcl > A _at Methylglutaconyl-CoA hydratase Auh A _at Farnesyl diphosphate Synthase Fdps A _a_atGeranylgeranyl diphosphate synthetase Ggps A _a_atGeranylgeranyl diphosphate synthetase Ggps A _at Farnesyl diphosphate farnesyl transferase 1 Fdft ± ± ± A _at Farnesyl diphosphate farnesyl transferase 1 Fdft A _at Squalene Epoxidase Sqle A _at Lanosterol Synthase Lss ± ± ± A _a_atLanosterol Synthase Lss A _at 24-dehydrocholesterol reductase (predicted) Dhcr A _at Cytochrome p450 subfamily 51 Cyp A _s_atCytochrome p450 subfamily 51 Cyp A _at Transmembrane 7 superfamily member 2 Tm7sf A _at Sterol-C4-methyl oxidase-like Sc4mol ± ± ± A _at NAD(P)-dependent steroid dehydrogeanse-like Nsdhl A _at Hydroxysteroid (17-beta) dehydrogenase 7 Hsd17b A _at Phenylalkylamine Calcium antagonist (emopamil) Binding Protein Ebp A _at Sterol-c5-desaturase Sc5d ± ± ± A _at Sterol-c5-desaturase Sc5d A _at 7-Dehydrocholesterol Reductase Dhcr A _at Low density lipoprotein receptor Ldlr ± ± ± A _at Low density lipoprotein receptor Ldlr A _at Proprotein convertase subtilisin/kexin type 9 Pcsk >1.040 > B _at Acetoacetyl-CoA synthetase Aacs B _at Atp_citrate lyase Acyl B _at Acetyl-coenzyme A carboxylase alpha Acaca B _at Acetyl-Coenzyme A carboxylase beta Acacb B _at Fatty acid synthase Fasn

9 B _a_atFatty acid synthase Fasn B _at Stearoyl-Coenzyme A desaturase 1 Scd ± ± ± B _a_a Stearoyl-Coenzyme A desaturase 2 Scd ± ± ± B _at Stearoyl-Coenzyme A desaturase 2 Scd B _at ELOVL family member 6, elongation of long chain fatty acids Elovl B _at ELOVL family member 5, elongation of long chain fatty acids Elovl B _at ELOVL family member 5, elongation of long chain fatty acids Elovl B _at Similar to elongation of very long chain fattyacids protein 1 LOC B _at Elongation of very long chain fatty acids-like 2 Elovl B _at Elongation of very long chain fatty acids-like 3 Elovl B _at Elongation of very long chain fatty acids-like 4 Elovl B _at Fatty acid desaturase 1 Fads ± ± ± B _at Fatty acid desaturase 2 Fads ± ± ± B _at Cytochrome P450, family 2, subfamily c, polypeptide 23 Cyp2c B _at Acyl-CoA synthetase medium-chain family member 1 Acsm B _at Acyl-CoA synthetase long-chain family member 1 Acsl B _at Acyl-CoA synthetase long-chain family member 1 Acsl B _at Acyl-CoA synthetase long-chain family member 3 Acsl ± ± ± B _at Acyl-CoA synthetase long-chain family member 4 Acsl B _at Acyl-CoA synthetase long-chain family member 5 Acsl B _at Acyl-CoA synthetase long-chain family member 6 Acsl > B _at Acyl-CoA synthetase bubblegum family member 1 Acsbg B _at Solute carrier family 27 (fatty acid transporter), member 1 (Acsvl4) Slc27a B _at Solute carrier family 27 (fatty acid transporter), member 2 (Acsvl2) Slc27a B _at Solute carrier family 27 (fatty acid transporter), member 3 (Acsvl3) Slc27a B _at Solute carrier family 27 (fatty acid transporter), member 3 (Acsvl3) Slc27a > B _at Solute carrier family 27 (fatty acid transporter), member 3 (Acsvl5) Slc27a B _at Solute carrier family 27 (fatty acid transporter), member 3 (Acsvl6) Slc27a B _at Carnitine O-octanoyltransferase Crot B _at Carnitine O-octanoyltransferase Crot B _at Carnitine palmitoyltransferase 1, liver Cpt1a B _at Carnitine palmitoyltransferase 1, liver Cpt1a B _at Carnitine palmitoyltransferase 1b, muscle Cpt1b B _at Carnitine palmitoyltransferase 1c (predicted), brain Cpt1c_ B _at Carnitine palmitoyltransferase 1b, muscle Cpt1b B _at Carnitine palmitoyltransferase 2 Cpt B Dodecenoyl-Coenzyme A delta isomerase 3,2 trans-enoyl _s_at Coenzyme A isomerase (mitochondria) Dci B _at 2,4-dienoyl CoA reductase 2, peroxisomal (unsaturated) Decr B _at 2,4-dienoyl CoA reductase 1, mitochondrial (unsaturated) Decr B _at delta(3,5)-delta(2,4)-dienoyl-coa isomerase, mitochondrial Ech B _at Acyl-Coenzyme A dehydrogenase, very long chain Acadvl B _at Acyl-Coenzyme A dehydrogenase, long-chain Acadl B _at Acyl-Coenzyme A dehydrogenase family, member 9 (unsaturated) Acad B _at Acyl-Coenzyme A dehydrogenase, medium chain Acadm B _at Acyl-coenzyme A dehydrogenase, short chain Acads B _at Acyl-Coenzyme A dehydrogenase, short/branched chain Acadsb

10 B _at Acyl-Coenzyme A dehydrogenase, short/branched chain Acadsb B _at Glutaryl-Coenzyme A dehydrogenase (lysine metabolism) Gcdh B _at Glutaryl-Coenzyme A dehydrogenase (lysine metabolism) Gcdh B _at Enoyl-Coenzyme A, hydratase/3-hydroxyacyl Coenzyme A dehydrogenase (unsaturated) Ehhadh B _at Peroxisomal multifunctional enzyme type 2 Hsd17b B _at Hydroxyacyl-Coenzyme A dehydrogenase/3-ketoacyl- Coenzyme A thiolase/enoyl-coenzyme A hydratase Hadha (trifunctional protein), alpha subunit B _at Hydroxyacyl-Coenzyme A dehydrogenase/3-ketoacyl- Coenzyme A thiolase/enoyl-coenzyme A hydratase Hadhb (trifunctional protein), beta subunit B _at Phytanoyl-CoA hydroxylase (peroxisomal) Phyh B _at Peroxisomal trans-2-enoyl-coa reductase (phytol degradation) Pecr B _at Enoyl Coenzyme A hydratase, short chain, 1, mitochondrial Echs B _at Hydroxysteroid (17-beta) dehydrogenase 10 Hadh B _at Hydroxyacyl-Coenzyme A dehydrogenase Hadhsc B _s_atAcyl-CoA thioesterase 2/1 Acot2/ B _at Acyl-CoA thioesterase 2/1 Acot2/ B _at Acyl-CoA thioesterase 2 (mitochondria) Acot B _at Acyl-CoA thioesterase 2 Acot B _at Acyl-CoA thioesterase 3 (peroxisomal) Acot B _at Acyl-CoA thioesterase 4 (peroxisomal) Acot B _at Acyl-CoA thioesterase 8 (peroxisomal) acot B _at Acyl-CoA thioesterase 7 (long chain) acot B _at Acyl-CoA thioesterase 9 (long chain) Acot B _at Acyl-CoA thioesterase 12 () Acot B Acetyl-Coenzyme A acyltransferase 1 (peroxisomal 3-oxoacyl _a_at Coenzyme A thiolase) Acaa B _at Acetyl-Coenzyme A acyltransferase 2 (mitochondrial 3-oxoacyl- Acaa2 Coenzyme A thiolase) B _at Epoxide hydrolase 2, cytoplasmic Ephx B _at Carnitine acetyltransferase crat B _at Fatty acid binding protein 1, liver Fabp B _at Fatty acid binding protein 3 Fabp B _at Fatty acid binding protein 3 Fabp B _at Fatty acid binding protein 7, brain Fabp B _at Fatty acid binding protein 7, brain Fabp B _at Trimethyllysine hydroxylase, epsilon Tmlhe B _at Solute carrier family 25 (carnitine/acylcarnitine translocase), member 20 Slc25a B _at Cd36 antigen Cd > B _a_atCd36 antigen Cd C _at Glycerol kinase Gyk C _at Glycerol kinase Gyk C _at Glycerol-3-phosphate acyltransferase, mitochondrial Gpam C _at Glycerol-3-phosphate acyltransferase (microsomal) Agpat C _at Glycerol-3-phosphate acyltransferase (microsomal) Agpat C _at 1-acylglycerol-3-phosphate O-acyltransferase 1 Agpat C _at 1-acylglycerol-3-phosphate O-acyltransferase 1 Agpat C _at 1-acylglycerol-3-phosphate O-acyltransferase 2 Agpat C _at 1-acylglycerol-3-phosphate O-acyltransferase 3 Agpat C _at 1-acylglycerol-3-phosphate O-acyltransferase 3 Agpat

11 C _at 1-acylglycerol-3-phosphate O-acyltransferase 3 Agpat > > C _at 1-acylglycerol-3-phosphate O-acyltransferase 4 Agpat C _at 1-acylglycerol-3-phosphate O-acyltransferase 5 Agpat C _at 1-acylglycerol-3-phosphate O-acyltransferase 5 Agpat > C _at Lipin 2 Lpin C _at Lipin 3 Lpin C _at Diacylglycerol O-acyltransferase 1 Dgat C _at Diacylglycerol O-acyltransferase homolog 2 Dgat ± ± ± C _at Diacylglycerol O-acyltransferase homolog 2 Dgat > C _at Monoglyceride lipase Mgll C _at Apolipoprotein B100 Apob > ± ± ± C _at Apolipoprotein B48 Apob C _at Apolipoprotein C-III Apoc C _at Microsomal triglyceride transfer protein Mttp ± ± ± * Compared to control cells. Significance of Microarray Analysis performed via Comprehensive R-based Microarray Analysis web service (CARMAweb; CARMAweb.genome.tugraz.at /CARMA/ ) Data from one cell line RT-qPCRs were performed on RNA prepared from a separate experiment involving three biological observations. Results represent mean fold-changes (±SEM) of two independent cell-lines compared to control cell lines Affy_ID, affymetrix identification number: FDR, false detection rate; m: mitochondrial; c: cytosolic Italics indicate expression validated by RT-qPCR 11

12 Table S6. Correlation of SAR1A, SAR1B, APOB and MTTP mrnas with those of Genes Encoding Enzymes in the Cholesterol Biosynthesis and Scavenger* Pathways Liver Dataset 1 (n=427) SAR1A SAR1B APOB MTTP Liver Dataset 2 (n=75) Liver Dataset 1 (n=427) Liver Dataset 2 (n=75) Liver Dataset 1 (n=427) Liver Dataset 2 (n=75) Liver Dataset 1 (n=427) Liver Dataset 2 (n=75) R p-value R p-value R p-value R p-value R p-value R p-value R p-value R p-value HMGCS E E E HMGCR E E E E MVK E E E E-04 PMVK E E E E E MVD FDPS E E E E E E-04 GGPS E E E E-05 IDI E E E E E-04 MCCC1* E E E E-04 MCCC2* E E E E E E E E-04 AUH* E E E E HMGCL* E E E E E E E-07 AACS E E E E E E-05 ACSS E E E E ACAT E E FDFT E E E SQLE E E E E E-05 LSS E E E E CYP E E TM7SF E E SC4MOL E E E E E E-03 NSDHL E E E E E E-03 12

13 HSD17B E E DHCR E E E E EBP E E SC5DL E E E E E E-05 DHCR E E E-05 Correlations performed using the R2: microarray analysis and visualization platform ( probes giving the highest signal and two liver datasets (61,62). P-values were corrected for multiple testing using the formula: t=r/sqrt((1-r^2)/(n-2)), where R corresponds to the correlation value and n denotes the number of samples, as described ( Bold values highlight positive correlation with mrna encoding enzymes on the cholesterol biosynthesis pathway observed in both liver datasets with SAR1B, APOB and MTTP. 13

14 Table S7. RT-qPCR and Microarray Results for Gene-Products Regulating Cholesterol Biosynthesis in McArdle-RH7777 cells. Over-expressing stable cell lines 1 sirna-mediated knockdown cells 2 Gene Symbol Empty Vector Control Sar1B:H79G (R.fold, FDR)* Sar1A (R.fold, FDR)* Sar1B (R.fold, FDR)* Scrambled Control Sar1a Knockdown Sar1b Knockdown Sar1a & Sar1b Knockdown Srebf ± ± ± ± ± ± ± ± (0.680, ) (0.876, ) (0.827, ) Srebf ± ± ± ± ± ± ac ± ± (0.641, ) (1.407, ) (1.392, ) Srebf1a ± ± ± ± ± ± c ± ± Srebf1c ± ± ± ± ± ± ± ± Scap ± ± ± ± ± ± ± b ± (0.877, ) (1.047, ns) (1.068, ns) Insig ± ± ± ± ± ± ± ± (0.352, ) (1.901, ) (1.912, ) Insig ± ± ± ± ± ± a ± ± (1.148, ns) (1.000, ns) (0.776, ) 1. Analyses were performed on RNA prepared from specified McArdle RH7777 cell lines, involving three biological observations. RT-qPCR results (top values) represent mean fold-changes (±SEM) of two independent cell-lines compared to control cell lines, performed in triplicate. Microarray results, on RNA prepared from a separate experiment, as described in the methods, are shown below in brackets. *Indicates differential expression and false detection rates (FDR) <0.05, or ns. 2. RT-qPCR results are expressed as mean ± SEM, are from a minimum of three independent experiments, performed in triplicate for each condition. a p < 0.05 vs. scrambled control, b p < vs. scrambled control, c p < 0.05 Sar1a vs. Sar1b. 14

15 Figure S1 Sar1B-mediated Regulation of Triglyceride and Cholesterol 15

16 Figure S2 Sar1B-mediated Regulation of Triglyceride and Cholesterol Relative mrna levels 1.5 Hmgcs1 Hmgcr Idi1 Lss 1.0 Dhcr Scrambled Apob Mttp Apob & Mttp 16

17 Figure S3 Sar1B-mediated Regulation of Triglyceride and Cholesterol 17