Supplemental Table 1. Oligonucleotides used to identify H-RAS, K-RAS and N-RAS mutations and PTEN gene expression.

Supplemental Table 1. Oligonucleotides used to identify H-RAS, K-RAS and N-RAS mutations and PTEN gene expression. Gene Exon Forward primer Reverse primer Temp ( C) HRAS 2-3 ATGACGGAATATAAGCTGGT ATGGCAAACACACACAGGAA 56 NRAS 2-3 GGTTTCCAACAGGTTCTTGC GTAGAGGTTAATATCCGCAA 56 KRAS 2-3 GGCCTGCTGAAAATGACTGAA TGGCAAATACACAAAGAAAGC 58 PTEN Forward: 5 -GGCGTATACAGGAACAATATTGATGA-3 Reverse: 5 -AAAGGATATTGTGCAACTCTGCAA-3 Probe: 5 -TGCTGAAAGACATTATGACACCGCCAAA-3

Supplemental Table 2. Antibodies and conditions for immunohistochemistry. Antybody Type/Catalogue No. Source Pretreatment PPARγ Rabbit Abcam, citrate buffer (ph 6.1) polyclonal/ab19481 Cambridge, UK at 97 C for 20 min SFRP1 Rabbit polyclonal/ab4193 Abcam citrate buffer (ph 6.1) Cambridge, UK at 97 C for 20 min SDPR Rabbit Abcam citrate buffer (ph 6.1) polyclonal/ab103230 Cambridge, UK at 97 C for 20 min Eph receptor A5 Rabbit polyclonal/ab5397 Abcam citrate buffer (ph 6.1) Cambridge, UK at 97 C for 20 min DPEP1 Rabbit SIGMA, St. citrate buffer (ph 6.1) polyclonal/hpa012783 Louis, MO, USA at 97 C for 20 min Fibulin-1 Mouse monoclonal Santa Cruz citrate buffer (ph 6.1) (clone B5)/sc-25281 Biotech, S. Cruz, at 97 C for 20 min CA, USA OGN Rabbit SIGMA St. Louis, citrate buffer (ph 6.1) polyclonal/hpa013132 MO, USA at 97 C for 20 min ON, overnight; RT, room temperature Primary Ab incubation condition 1:250/ON, +4 C 1:400/ON, +4 C 1:25/1 h, RT 1:50/1 h, RT 1:100/1 h, RT 1:50/1 h, RT 1:50/1 h, RT

Supplemental Table 3. List of selected genes for investigation in human thyroid tissues # Entrez Gene Symbol Gene Name 1 Mia1 melanoma inhibitory activity 1 2 Lcn2 lipocalin 2 3 Chi3l1 chitinase 3-like 1 (cartilage glycoprotein-39) 4 Bcas1 breast carcinoma amplified sequence 1 5 Ddah1 dimethylarginine dimethylaminohydrolase 1 6 Dcx doublecortin 7 St6gal1 beta galactoside alpha 2,6 sialyltransferase 1 8 Timp1 tissue inhibitor of metalloproteinase 1 9 Srd5a1 steroid 5 alpha-reductase 1 10 Nkx2-2 NK2 transcription factor related, locus 2 (Drosophila) 11 Agr2 anterior gradient 2 (Xenopus laevis) 12 Kif20a kinesin family member 20A 13 Atp6v0a4 ATPase, H+ transporting, lysosomal V0 subunit A4 14 Anln anillin, actin binding protein 15 Sphk1 sphingosine kinase 1 16 Etv5 ets variant gene 5 17 Epha5 Eph receptor A5 18 Ccnd1 cyclin D1 19 Fabp5 fatty acid binding protein 5, epidermal 20 Prc1 protein regulator of cytokinesis 1 21 Ereg epiregulin 22 Sfrp1 secreted frizzled-related protein 1 23 Fbln1 fibulin 1 24 Ogn osteoglycin 25 Gata3 GATA binding protein 3 26 Ptprd protein tyrosine phosphatase, receptor type, D 27 Aoc3 amine oxidase, copper containing 3 28 Dpep1 dipeptidase 1 (renal) 29 Ascl1 achaete-scute complex homolog 1 (Drosophila) 30 Gpx3 glutathione peroxidase 3 31 Rhcg Rhesus blood group-associated C glycoprotein

32 Pparg peroxisome proliferator activated receptor gamma 33 Fabp3 fatty acid binding protein 3, muscle and heart 34 Cxcl11 chemokine (C-X-C motif) ligand 11 35 Scg3 secretogranin III 36 Satb1 special AT-rich sequence binding protein 1 37 Rbp4 retinol binding protein 4, plasma 38 Cxcl10 chemokine (C-X-C motif) ligand 10 39 Pcsk2 proprotein convertase subtilisin/kexin type 2 40 Sdpr serum deprivation response 41 Cdca5 cell division cycle associated 5 42 Cep55 centrosomal protein 55 43 Cks2 CDC28 protein kinase regulatory subunit 2 44 Tpx2 TPX2, microtubule-associated protein homolog (Xenopus laevis) 45 Hey2 hairy/enhancer-of-split related with YRPW motif 2

Supplemental Table 4. Analysis of discovery group: gene expression of selected genes in NT, FA and FTC. NT FA FTC p ID Gene Mean ± SD Mean ± SD Mean ± SD FA vs N FTC vs N FTC vs FA AGR2 1 ±.645 6.210 ± 4.449 4.727 ± 3.891 0,0676 0,096 0.5186 ANLN 1 ±.854 1.316 ± 2.389 2.530 ± 4.852 9524 0,563 0.3938 AOC3 1 ±.372 1.231 ± 1.259.343 ±.229 0,5729 0,0008 < 0.0001 ASCL1 --- --- --- --- --- --- ATP6V0A4 --- --- --- --- --- --- BCAS1 --- --- --- --- --- --- CCND1 1 ±.328 1.641 ± 1.392 1.408 ± 1.823 0,1308 0,246 0.049 CDCA5 1 ± 1.216 1.042 ± 2.112 1.576 ± 1.820 0,905 0,101 0.0201 CEP55 1 ±.747.888 ± 1.595 1.416 ± 2.440 0,3532 > 0.999 0.4768 CHI3L1 1 ±.985 1.613 ± 2.211 5.475 ± 11.799 0,7382 0,453 0.3364 CKS2 1 ±.396 1.613 ± 2.413 2.602 ± 1.753 0,8265 0,056 0.0092 CXCL10 1 ± 1.258.643 ± 1.065.689 ± 1.305 0,7771 0,385 0.4115 CXCL11 1 ± 1.279.651 ± 1.136.388 ±.638 0,57 0,247 0.2157 DCX --- --- --- --- --- --- DDAH1 1 ±.197 1.064 ±.721.889 ±.324 0,652 0,453 0.7038 DPEP1 1 ±.307 1.581 ± 2.268.168 ±.010 0,3958 0,083 0.0087 EPHA5 1 ±.276.938 ±.725 3.193 ± 8.242 0,5218 0,021 0.008 EREG --- --- --- --- --- --- ETV5 1 ±.374 1.920 ± 1.774 2.285 ± 2.032 0,1308 0,219 0.7285 FABP3 1 ±.524 15.120 ± 53.202 17.996 ± 41.056 0,0981 0,942 0.3691 FABP5 1 ±.488.640 ±.536.298 ±.101 0,0179 0,0002 0.0024 FBLN1 1 ±.622.522 ±.638.060±.100 0,0102 0,0002 < 0.0001 GATA3 1 ±.209 1.732 ± 2.389.615 ±.810 0,8568 0,008 0.0064 GPX3 1 ±.597.804 ±.618.607 ±.486 0,2892 0,101 0.2609 HEY2 1 ±.439.645 ±.497.611 ±.491 0,0171 0,07 0.9304 KIF20A 1 ± 1.007 1.867 ± 3.477 2.770 ± 4.461 0,2997 0,349 0.5226 LCN2 1 ±.825 10.410 ± 37.029 9.367 ± 13.795 0,0917 0,03 0.1674 MIA 1 ±.633 1.068 ± 1.087.467 ±.309 0,6148 0,0492 0.0223 NKX2-2 --- --- --- --- --- --- OGN 1 ±.743.539 ±.619.036 ±.041 0,0372 0,0003 < 0.0001 PCSK2 1 ±.838 5.797 ± 8.291 29.535 ± 55.486 0,348 0,643 0.8545 PPARG 1 ±.378.866 ±.680 1.674 ± 5.321 0,1681 0,0014 0.0004 PRC1 1 ±.680.999 ± 1.190 1.381 ± 1.236 0,6734 0,539 0.0962 PTPRD 1 ±.498.410±.437.436 ±.845 0,003 0,0082 0.1484 RBP4 1 ±.700.784 ±.494.198 ± 0.087 0,4047 0,014 0.0174 RHCG 1 3.423 ± 4.582 1.656 ± 1.931 0,7697 0,617 0.361 SATB1 1 ±.247.819 ±.432.410 ±.215 0,0866 0,0004 0.0004 SCG3 1 ±.826.720 ±.518.683 ±.212 0,4649 0,698 0.5582 SDPR 1 ±.321 0.896 ±.594.182 ±.124 0,3671 0,0001 < 0.0001 SFRP1 1 ±.637 5.036 ± 10.891.365 ±.791 0,3671 0,005 0.0012 SPHK1 1 ±.493 1.234 ± 1.375.986 ±.410 >.999 0,838 0.8137 SRD5A1 1 ±.516.563 ±.508.434 ±.268 0,0078 0,009 0.3640 ST6GAL1 1 ±.429 2.507 ± 3.760 2.224 ± 3.368 0,4845 0,633 0.3632 TIMP1 1 ±.519 1.376 ± 1.085 1.409 ± 2.461 0,4706 0,088 0.0125 TPX2 1 ± 1.124 1.475 ± 3.558 3.095 ± 5.666 0,5428 0,169 0.0911 ---: signal is too low to be quantified

Supplemental Table 5. Gene expression differences between minimally and widely invasive FTC ID Gene Minimally Invasive FTC Widely Invasive FTC p Average ± SD Average ± SD Widely vs minimally Invasive FTC AGR2 1 ±.77 1.37 ± 1.25 0.724 ANLN 1 ±.85 5.67 ± 8.47 0.093 AOC3 1 ±.40.33 ±.23 0.04 ASCL1 --- --- --- ATP6V0A4 --- --- --- BCAS1 --- --- --- CCND1 1 ± 1.29 0.47 ±.28 0.698 CDCA5 1 ±.47 2.62 ± 2.80 0.366 CEP55 1 ±.67 4.88 ± 7.1 0.166 CHI3L1 1 ± 2.01 9.13 ± 13.85 0.366 CKS2 1 ±.79 1.44 ±.81 0.366 CXCL10 1 ± 1.05 11.81 ± 15.51 0.051 CXCL11 1 ±.97 6.06 ± 7.82 0.198 DCX --- --- --- DDAH1 1 ±.45.98 ±.22 0.796 DPEP1 1 ±.00.72 ±.06 0.157 EPHA5 1 ±.22 32.71 ± 72.10 0.438 EREG --- --- --- ETV5 1 ±.85 1.04 ± 1.06 >.999 FABP3 1 ± 2.65 1.18 ± 2.74 0.439 FABP5 1 ±.22 1.37 ±.48 0.051 FBLN1 1 ± 1.20 3.23± 4.77 0.093 GATA3 1 ±.54.99 ± 1.09 0.519 GPX3 1 ±.61.36 ±.25 0.039 HEY2 1 ±.86 1.35 ± 1.20 0.605 KIF20A 1 ±.58 5.65 ± 6.87 0.032 LCN2 1 ± 1.19 9.367 ± 13.795 0.093 MIA 1 ±.56.22 ±.31 0.317 NKX2-2 --- --- --- OGN 1 ± 1.70 1.20 ± 1.01 0.273 PCSK2 1 ± 1.71.28 ±.55 0.567 PPARG 1 ±.8.69 ±.68 0.568 PRC1 1 ±.41 2.13 ± 1.86 0.366 PTPRD 1 ± 1.18 1.83 ± 3.80 0.715 RBP4 1 ±.86.91 ±.57 0.806 RHCG 1 ±.63 1.88 ± 3.03 0.624 SATB1 1 ±.54 1.08 ±.59 0.698 SCG3 1 ± 1.18.45 ±.63 0.248 SDPR 1 ±.62 1.07 ±.76 0.897 SFRP1 1 ± 1.25 6.96 ± 12.93 0.093 SPHK1 1 ±.36.91 ±.48 0.519 SRD5A1 1 ±.62 1.07 ±.86 0.897 ST6GAL1 1 ± 1.24 2.60 ± 3.61 0.302 TIMP1 1 ±.68 9.81 ± 11.27 0.010 TPX2 1 ±.62 7.37 ± 10.11 0.039

Supplemental Table 6. Modification of expression of the 45 selected gene for human study in double mutant mice (DM) versus wild-type (wt) and Pten thyr -/- (Pten). DM vs wt DM vs Pten Cxcl10 3,5173726 2,41918622 Rbp4 3,36599475 1,46966381 Satb1 3,2731891 1,12374931 Scg3 3,20056769 1,6962598 Cxcl11 3,10461498 2,29525754 Pcsk2 3,06317462 1,39558611 Pparg 2,63617222 1,18293447 Rhcg 2,61578344 0,80362503 Gpx3 2,60489345 1,8082734 Fabp3 2,57704642 0,92142179 Ascl1 2,57704284 1,14392466 Dpep1 2,42737077 1,22884865 Aoc3 2,40327432 1,13433231 Ptprd 2,380985 0,86983164 Gata3 2,30921081 0,88743173 Ogn 2,01174783 1,66842857 Fbln1 2,00601511 1,26905905 Sfrp1 2,00074184 1,64944433 Sdpr 1,2781198 0,5982105 Hey2-1,2962798-1,3116609 Cdca5-1,2997968-1,1673507 Tpx2-1,3315816-1,1941015 Cks2-1,4052533-1,1045557 Cep55-1,4057868-1,1708933 Ereg -1,5967297-1,3310958 Prc1-1,6440664-1,1794245 Fabp5-1,6828654-1,6785549 Ccnd1-1,7176005-1,6670015 Epha5-1,7328932-0,7565545 Etv5-1,7391427-0,6940601 Sphk1-1,8308731-1,0276797 Anln -1,8350524-1,1042277 Atp6v0a4-1,8724481-0,6955491 Kif20a -1,9900762-1,4298384 Agr2-2,0560164 0,03757824 Nkx2-2 -2,0642831-2,3075372 Srd5a1-2,0859649-0,652594

Timp1-2,2152721-1,00292 St6gal1-2,3606357-1,8115443 Dcx -2,4897774-2,6356087 Ddah1-2,5436451-0,0201196 Bcas1-2,7710565-1,564267 Chi3l1-2,8221869-2,6665969 LCN2-3,3533508-2,0588263 Mia1-3,4912681-2,2098612