CORRECTION NOTICE Nat. Med. 3, 63 637 (7) The cold-induced lipokine,3-dihome promotes fatty acid transport into brown adipose tissue Ronald J Hause, Colin C Pritchard, Jay Shendure & Stephen J Salipante Matthew D Lynes, Luiz O Leiria, Morten Lundh, Alexander Bartelt, Farnaz Shamsi, Tian Lian Huang, Hirokazu Takahashi, Michael F Hirshman, Christian Schlein, Alexandra Lee, Lisa A Baer, Francis J May, Fei Gao, Niven R Narain, Emily Y Chen, Michael A Kiebish, Aaron M Cypess, Matthias Blüher, Laurie J Goodyear, Gökhan S Hotamisligil, Kristin I Stanford & Yu-Hua Tseng The incorrect raw western blot was used in Supplementary Figure 7 to reflect the blot for FATP in Figure 4e. Rather than simply replacing the Supplementary Information with the correct raw western blot, the authors provided all three replicates.
a Cyclooxygenase Lipoxygenase Cyp45 oxidase Non-enzymatic EPA (:5 ω-3) AA (:4 ω-6) ETA (:3 ω-6) ETA (:3 ω-6) AA (:4 ω-6) ETA (:3 ω-6) DHA (:6 ω-3) AA (:4 ω-6) EPA (:5 ω-3) b Inflammatory effect 5 An)- inflammatory 39 Pro- inflammatory Unknown 4 Supplementary Figure Annota)on of lipid species profiled by LC- /MS in human and mouse serum and mouse adipose )ssues. (a) Dendrogram of all lipids included in the ini)al screen according to their original fapy acid and enzyma)c pathway. (b) For all lipid species measured by LC- MS/MS annota)on of, whether the lipid was pro- or an)- inflammatory. Nature Medicine doi:.38/nm.497
Serum,3- Concentra)on (A.U.) Saline Cold Saline Cold Saline Cold 9-HOTrE,3-diHOME 4(5)-EET Supplementary Figure Lipid species increased by a one- hour cold challenge. The increase in abundance of three lipid species reached a nominal P value of.5 aver cold exposure. The two species with lower significance were only detectable aver cold exposure. Data are means +/- s.e.m.; n = 9 individual subjects; P <.5 by paired Student s t- test. Nature Medicine doi:.38/nm.497
.5 a b c,3-dihome (pmol/ml) FPI (pmol/l) Lean Overweight Obese d e f,3-dihome (pmol/ml) HbAc (%) CrP (mg/l) g h i,3-dihome (pmol/ml).5 j k l,3-dihome (pmol/ml).5.5.5.5.5.5.5.5.5.5.5 R=-.63 p=.58 4 5 6 7 8 R=-.8 p=.38 R=.96 p=.4833 4 6 8 Age (years). ASAT (µkat/l),3-dihome (pmol/ml),3-dihome (pmol/ml),3-dihome (pmol/ml),3-dihome (pmol/ml).5.5.5.5.5.5.5.5.5.5.5 R=-.37 p=.48 3 4 5 R=-.4 p=.774 3 3 4 R=-.76 p=.44 ggt (µkat/l),3-dihome (pmol/ml),3-dihome (pmol/ml),3-dihome (pmol/ml),3-dihome (pmol/ml).5.5.5.5.5.5.5.5.5.5.5.5 R=-.4 p=.753 4 9 4 R=-.4 p=.3 FPG (mmol/l) 5 R=-.35 p=.354 Leptin (ng/ml) 5 Total Cholesterol (mmol/l) NGT TD NGT TD NGT TD Lean Overweight Obese Lean Overweight Obese Nature Medicine doi:.38/nm.497
Supplementary Figure 3 Anthropometric correlates of,3- dihome. (a) Circula)ng,3- dihome in each body mass index (BMI) category. Data are presented as normalized means ± s.e.m.; n = 5 lean, 3 overweight and 7 obese subjects. (b- j), Circula)ng,3- dihome concentra)on ploped against fas)ng plasma insulin (FPI) (b), fas)ng plasma glucose (FPG) (c), hemoglobin Ac (HbAc) (d), C- reac)ve protein (CrP) (e), circula)ng lep)n (f), circula)ng aspartate transaminase (ASAT) (g), and circula)ng gamma- glutamyl transpep)dase (ggt) (h), circula)ng total cholesterol (i) and age (j). In each panel, R is the Spearman correla)on coefficient and males are shown in blue while females are shown in pink; n = 55 individual subjects (3 M/4 F). (k) Circula)ng,3- dihome in each BMI category of males and females. Data are presented as normalized means ± s.e.m.; n = 5 lean (4 M/ F), 3 overweight (4 M/9 F) and 7 obese subjects (5 M/ F); P <.5 by Student s t- test. (l) Circula)ng,3- dihome in each BMI category of subjects with normal glucose tolerance (NGT) or Type diabetes (TD). Data are presented as normalized means ± s.e.m.; n = 5 lean, 3 overweight ( NGT/3 TD) and 7 obese subjects ( NGT/7 TD). Nature Medicine doi:.38/nm.497
a,3-dihome (pmol/ml) b Relative mrna expression 84 63 4 4 Serum,3-diHOME (pmol/ml) 8 6 4 8 6 4 days days days days WT Thermoneutral WT Cold cre f/f Myf5 BMPra Thermoneutral cre f/f Myf5 BMPra Cold Thermoneutral 7 day cold c Log FC(Cold vs. ) d f 5 4 3 - -,3-diHOME (nm/mg protein) Rela)ve Ephx expression Ephx Ephx Ephx3 Ephx4 Ephx Ephx Ephx3 Ephx4 Ephx Ephx Ephx3 Ephx4 Ephx Ephx Ephx3 Ephx4 Ephx 45. 4. 3 3.... 5 4 3 Ephx BAT BAT swat swat Kidney Kidney Liver Liver Cypb Cypu Cypr CL CL 36,43 36,43 Cypa Cyp5 e g Cypb,3-diHOME (nm/mg protein) swat,3-dihome Concentration (nm/mg protein) Rela)ve Ephx expression Cyp4b 79 68 7 5 6 45 34 3 3 Cypd Cypb3 days Cyp4f6 Cypa days CL CL 36,43 36,43 Cyp4f7 Cyp39a Cypj6 Cyp7a Cyp4f3 Cyp4v3 Cypf WT Thermoneutral WT Cold cre f/f Myf5 BMPra Thermoneutral cre f/f Myf5 BMPra Cold Hao d Marcher 3d Hao 4d Rosell d Cypj9 Cyp6b Cype BAT swat BAT swat Nature Medicine doi:.38/nm.497
Supplementary Figure 4,3- biosynthesis in cold ac)vated adipose )ssue. (a),3- dihome concentra)ons measured by LC- MS/MS in serum from wild type and Myf5 cre BMPra f/f mice housed at cold or thermoneutral for or days. Data are ploped as the normalized means ± s.e.m.; n = 5 WT thermoneutral males, 3 WT cold males, 4 Myf5 cre BMPra f/f thermoneutral males, 5 Myf5 cre BMPra f/f cold males, 3 WT thermoneutral females, 5 WT cold females, 3 Myf5 cre BMPra f/f thermoneutral females, 4 Myf5 cre BMPra f/f cold female; P <.5 by Student s t- test. (b) Ephx family gene expression measured by qpcr in different )ssues from mice housed at cold or thermoneutrality for 7 days. Data are ploped as the means normalized to thermoneutrality ± s.e.m.; n = 8 per group; P <.5 by Student s t- test. (c) Meta- analysis of 4 publically available BAT gene expression datasets from mice exposed to cold for different lengths of )me for genes in the,3- dihome biosynthe)c pathway. The induc)on by cold of each gene aver cold exposure is shown by increased fold change on the y axis. (d),3- dihome concentra)ons measured in different mouse )ssues. Data are means +/- s.e.m.; n = 8 mice; P <.5, P <.5, P <.5 by Student s t- test. (e),3- dihome concentra)ons measured by LC- MS/MS in swat from wild type and Myf5 cre BMPra f/f mice housed at cold or thermoneutral for or days. Data are ploped as the normalized means ± s.e.m.; n = 5 WT thermoneutral males, 5 WT cold males, 4 Myf5 cre BMPra f/f thermoneutral males, 5 Myf5 cre BMPra f/f cold males, 3 WT thermoneutral females, WT cold females, 4 Myf5 cre BMPra f/f thermoneutral females, Myf5 cre BMPra f/f cold female; P <.5 by Student s t- test. (f) Ephx gene expression measured by qpcr in BAT and swat from mice treated daily with mg/kg body weight CL36,43 intraperitoneally for days. Data are presented as normalized means ± s.e.m.; n = 6 per group; P <.5 by Student s t- test. (g) Ephx gene expression measured by qpcr in BAT and swat from mice treated daily with mg/kg body weight CL 36,43 intraperitoneally for days. Data are presented as normalized means ± s.e.m.; n = 6 per group; P <.5 by Student s t- test. Nature Medicine doi:.38/nm.497
Vehicle a 6 Vehicle b 4 6 c Pulse (BPM) 5 4 3 3,3-diHOME Systolic pressure (mmhg) 4 8 8 6 6 4 4,3-diHOME Diastolic pressure (mmhg) 9 8 9 7 8 6 7 5 6 4 5 3 4 3 Vehicle,3-diHOME Supplementary Figure 5 Physiologic effects of acute,3- dihome treatment in mice. (a) Pulse measured in the tail aver pretreatment with,3- dihome or vehicle. Data are means ± s.e.m.; n = 6 per group. (b) Systolic pressure measured in the tail vein aver pretreatment with,3- dihome or vehicle. Data are means ± s.e.m.; n = 6 per group. (c) Diastolic pressure measured in the tail aver pretreatment with,3- dihome or vehicle. Data are means ± s.e.m.; n = 6 per group. Nature Medicine doi:.38/nm.497
a d f Body weight (g) 6 5 4 3 Relative mrna expression 4C-radioactivity (c.p.m. per mg tissue) 5, 4, 3,, 3 4 5 6 7.5 3.5.5 Vehicle (+3.%),3-diHOME (+3.7%) Days of treatment UCP LPL UCP LPL BAT swat Vehicle b Blood glucose (mg/dl),3-dihome 6 5 4 3 5 3 45 6 75 9 5 e Serum Triglycerides (mg/dl) 5 5 5 Vehicle,3-diHOME Time (min) 6 8 4 Time (min) Vehicle NE,3-diHOME c Serum FFA (meq/l) 4.53 4.5 3.5 3.5.5.5.5.5 Vehicle,3-diHOME.E+5.5E+5.E+5 5.E+4.E+ Liver Gastr Soleu Heart swat BAT ewat oc. s Vehicle,3-diHOME, Liver Gastroc Soleus Heart BAT swat ewat Nature Medicine doi:.38/nm.497
Supplementary Figure 6 Physiologic effects of daily,3- dihome injec)ons. (a) Body weights over 7 day course of daily injec)on treatment. Data are means +/- s.e.m.; n = 6 treated vs. 5 controls. (b) Glucose tolerance test of a separate cohort of diet- induced obesity mice treated every other day for weeks with either,3- dihome or vehicle. Data are means +/- s.e.m.; n = 5 per group. (c) Serum non- esterified free fapy acids (FFA) of mice treated daily for one week with either,3- dihome or vehicle. Data are means +/- s.e.m.; n = 6 treated vs. 5 controls. (d) mrna expression measured by qpcr of UCP and LPL in )ssue from mice treated every other day for two weeks with either,3- dihome or vehicle. Data are means +/- s.e.m.; n = 6 treated per group; P <.5 by Student s t- test. (e) Oral lipid tolerance test showing serum triglyceride concentra)on from mice treated with vehicle or,3- dihome and then given an oral bolus of triglyceride. Data are means ± s.e.m.; n = 6 per group; P <.5 by ANOVA with post- hoc Bonferroni test. (f) Radioac)vity per mg of )ssues from mice treated with vehicle, Norepinephrine (NE) or,3- dihome and then given a bolus of radiolabeled glucose. Tissues were measured by scin)lla)on coun)ng in liver, gastrocnemius muscle (Gastroc), soleus muscle, heart, BAT, swat, and epididymal white adipose )ssue (ewat). Data are means ± s.e.m.; n = 8 per group; P <.5,3- dihome vs. Vehicle by ANOVA with post- hoc Bonferroni test. Nature Medicine doi:.38/nm.497
Nature Medicine doi:.38/nm.497 CD36 Tubulin Cadherin c,3-dihome Insulin a,3-dihome Insulin Insulin,3-diHOME FATP Cytosol,3-diHOME Insulin b Cytosol Membrane Insulin,3-diHOME,3-diHOME Insulin a Cytosol Membrane Membrane a
Supplementary Figure 7 Un- cropped immunoblots shown in this manuscript. (a) Experiments shown in Figure 4 (b) An independent experimental replicate of the FATP immunoblot shown in a. (c) A third independent experimental replicate of the FATP immunoblot shown in a. The experimental replicates in b and c were used to quanffy FATP translocafon as described in the online methods. Nature Medicine doi:.38/nm.497
Supplementary Table Lipid profiling by LC- MS/MS in human plasma aver saline or cold challenge. > Subject 34+ 34+ 34+3 34+4 34+5 34+6 34+7 34+8 34+9 34+ 34+ 34+3 34+4 34+5 34+6 34+7 34+8 34+9 Treatment Cold Cold Cold Cold Cold Cold Cold Cold Cold Saline Saline Saline Saline Saline Saline Saline Saline Saline Code 34++C 34++C 34+3+C 34+4+C 34+5+C 34+6+C 34+7+C 34+8+C 34+9+C 34++S 34++S 34+3+S 34+4+S 34+5+S 34+6+S 34+7+S 34+8+S 34+9+S Species IS+d4+9+HODE 9+oxoODE.8875.377466.3357.4883.4695.3857856.534363.43954.663684.7346.3464997.6784337.3396343.8769.699.644676.36655777.677 3+oxoODE.84687575.38595.83963.3773567.44379.37386546.38553.35767.3434785.493878.639864.4448.9849.8736.489799.3553.83766.47868483 9+HOTrE.7697993.3389.949.59884.37685.33476.45684.3687.966469.5444.3339.35638.568638.993.39693.553466.49939.5675979 3+HOTrE/3+HOTrE(r).58.84443.5446.33576.3659.8367766.8876.4558.7389398.36796.36657.938568.67887.854387.35567.4387.575 9+HODE 3.994354.34546.67334838.3689.86795.83.9665953.94789946 5.64493.59699636.453538 3.86978.369673.5849.547668.56493647.95499 4.6993797 3+HODE 5.97498.833588.8558584.7568796.6368368.3457854.4553399.65899 8.84373.66974.478437 3.37966.394875.5478738.665744.678668.38535.73558 9()+EpOME.548.74595.3476495.7484368.536437.37948.74337.4994677.978556.4949975.8455.83934.83776.895.96.576339.568675.473393 (3)+EpOME.87375.7937947.43753.43694.574343.4796666.847963.5435.4983796.4873635.463654.67584874.93939.5699.46.865.64746.58567437 9,+diHOME 3.37534.97689.9994.575489.8779847.563895.988693.98788.856889.497958.639.59797.88577.4988789.459567.3578634.49586.7773535,3+diHOME.4687576.76583.736389.779647.767959.447778.879888.37686.8474557.45757.5359459.363736.6766.897866.9869644.379389.4866595.683885 8+HEPE.34879.66.393433.8854.4534.489755.87777.6996.63375.349.437.74983.59958 5+HEPE.3995867.788.83993.64984.78576.863.37837.554.6486.754849.55.33637.78939.487373.3779358.55589.465769 +HEPE.379756.6693.3369.649.5969.48579.97.3.34776.464 5+HEPE.443379.8958.593.8336.3956.33896.857.6935.779496.43579.4375.9397.84698.3335 +HEPE.4536.393.49639.475933.397.437334.89596.794.477 8+HEPE.57757.78498.84537.9493.78564.8654.869.887.84697 5+oxoETE.796359.46954.6754.53798.57874.34686.43344.54854.458438.3898 9+HEPE.465.354795 4(5)+EET.8569.58393.98.99777.4636.34776.45879.64887.43557.786.9967 ()+EET.578896.3467.446644.8.64353.57568.557679.8864.46346.536.68.7899.447.897.969 8(9)+EET.58695.9948.5843.4858976.459868.4649.34539.46385.3739.95797.373.53879.693959.44997 5(6)+EET.6435.6645.8458.78646.33985.3556599.963.4836.539347.945.43579.5486.3869.38695 5+HETE.79695.496739.548977.465.833.35578.685853.34757.47675.87385.67988.35895.475897.5985.8637.347345.46535.366484 +HETE.665798.87757.4798.35899.447.484933.75378.7446.4348.476668.469694.65843.899559.9897.4837.94573.875.56458 5+HETE.4379.566764.459.49466.794356.7758.46579.387839.933.97658.386.834789.43536.57749.59467.87555.765647.949788 +HETE.5374696.37559.3985.937.68.9794.598946.4649.87544.658748.78438.9468.9653.53596.76855.3747 +HETE.5478346.4546.8948.45689.96875.39355.6475798.866549.589888.68.949788.36.9877.7736.7773.764998.8587.49868 6+HETE.45854.849749.34858.9474.85598.6769.7579.77593.6397.787.963.39736.34484.86333.7744 7+HETE.58954.8347.9338.4768.46.74636.46697.6577.638974.37884.45737.476968.77634.474.78897 8+HETE.976464.368365.948.97963.767836.3566.77787.7537659.97745.343663.3755.498.53.7336 9+HETE.64383.43967.55.93759.368737.874.53599.43558.3937.3985586.993 8+HETE.33694.4786.5363.8994.85767.9979.387.53954.54868.865.757357.6338788.3376.37 all>trans+ltb4.37579.3598697.576.77595.896.369955.36466.87393.8435.38656 LTB4.37579.538.576.77595.8576.49753.788 5,6+diHETE.443474.7588.477.9686.576784.89.58684.886.87869.3954.943 5,5+diHETE.495.757.57484 Hepoxilin>A3.6534.795.363.4563.386563.76648 7+HDHA.3865.394994.633934.438365.9478.87558.48545.8345 4+HDHA.469.396379.939.3369.3335.9578.489.485484.59688.39745.35348.787485.7398.43563 7+HDHA.58.37737.339933.35464.535.43564.43558 4+HDHA.4.956.7855.6683.9488.5648.958.69365.395.5465.79.838.54735.46748 8+HDHA.6643.9484.387639.73964.45554.8956.4655 +HDHA.5779.5848.354368.9459.3769.48466.49797.43579.8764.45676.5369 +HDHA.84695.88858.57875.789.8885.43465 3+HDHA.699.9394.3368.687.87.43.59638.469383.68633.993.88465.3973 6+HDHA.4686.9379.588.4535.78755.94675.355635.556.66953.847.9349.8648.7678.8469.6437 +HDHA.59654.35438.9993.354359.4769.793754.93.6898.5934.888749.4457.44436.478.345364 9()+EpDPE.59654.4776.8667.675689.9344.946 6(7)+EpDPE.6969.4443.48579.45986.4995.49333.9.47839 PGE/PGD.337649.3364.676.6348.5456.96636.6335.859.4358.695.436398.8443.48337.44763.934356.8375 PGD.5797.997.369.78637.53438.53998.9556.38797.889.7677.389.384.3589 LXA4.3969985.5369.335969.3398.564954.8664.76644.3369.4566 LXB4.4888.83358.38569.6449.57.58695.679.94575.88837.663.335869..8 5+keto+PGFa.36883.35399.39.66838.8.8776.6639.8666.4573.4585.337.684 3,4+dihydro+5+keto>PGE.47687.8574.697658.8584.78.66699.853768.55344.4559.3836.84.647 3,4+dihydro+5+keto>PGD.483474.99838.673.546839.89556.537476.59945.78966.666484.785.5589.798.4445.589.754 PGFa.39478.84836.38834.8947.5699.34366.858.546.399.5697.73767.86768.9684.346.7746.44459 PGE/D.4778.79474.685.58683.599794.8993.95678.846.9943.6588.96785.68589.39674.54888.763858 8+iso>PGFa.3973.84836.38834.89439.56964.47984.873.43.78757.5697.6947.74647.76945.36795.74637.6534 5+iPFa+VI.498.36698.844.97778.35334.883.64537.69865.676.43566.44497.7536 Maresin PD.58433.388.367.94.66635.56975.3633.9688.474.6565.4397 TxB.557849.984.43694.537447.4849.58658.7335966.958853.569.535797.664.97996.96675.455733.836876.85388 6+keto+PGFa.848333.946.36439.84.6946.3766.97389.54866.4938 9/+OH>PGFa.676.464.64.3643.855.677.3486 RvD.6374.379.744.86939.84485 RvD.69399.7584.7475.67553.3766.4457.76 LTE4 LTD4.635.96.39376 LTC4.374594.364.5544.48337.637 PGFa.865.596986.379564.747386.8668.57547.6967 5+keto+PGE.635.58699 PGD3.695.4836.46.5588.56756.4775.4464.37344.94648.5379 PGA/PGJ.48766.8563.388.73436.53868.33649.5435.8337.746.6494.654.89767.9688.6949 PGB.477386.55664.3857.6997.5477.47749.37646.48663.499 5+deoxy+delta,4+PGD.8885.84.55394.46.59987.5788.465665.76347.97873.96673.5756.3573.37453 5,6+DiHETrE.3456.66656.7895.484.6458497.775866.459799.5659.363538.6684.93558.4654.635985.64469.9449 8,9+DiHETrE.89449.4693.86.9367.679.574.377357.76487.735.6933.98876.3365783.879593.584746.9653.7683,+DiHETrE.38354.535.96696.3656.6796.46678.8449487.3568834.338657.696684.46387.45938.39338.955.785.979974.59834.7499 4,5+DiHETrE.53444.858.8476.66737.886564.89383.4653.87899.7444377.8865.746569.587538.47578.5667.977.485597.865.783636 5+HETrE.937.87587.48.9495.35484.34838.55983.5369.47793.853 8+HETrE.77945.77774.46773.6673.56377.3868969.36.6935.3359437.3587.7847393.8469.47684 5+HETrE.83663.33864.387448.77968.787877.456.494566.4635866.3535658.38795.945788.576736.3374994.44536.668.368573.6539.33367 9,+DiHDPA.965759.4886.953383.93886.94668.5669.9465.566653.466447.54674.6974.33646.493989.7368477.87377.6569.638536.456.3+dinor+beta+PGFa.676 5+deoxy+delta,4+PGJ.3397.693.35956.354647.34445.834.57863.779.63368.48389.499458.4.37763.67354.773433.43489.53698 TxB3.35668.366.63493.35334.6559.8773.654388.57938.58488.453966 Tetranor++HETE.867.8545.9379.38684.3959.7868379.63388.468.9748.95388.5349.646.987375.69834.43849.59983 Precursors Docosanoids.44457.57843.457397.684994.5384.984486.399493.397695.98976.38873.4663495.958794.694995.335469.3647.4677348.499596.644754 Eicosanoids 3.6438.65358.3599576.53573.4483445.68986643.345846.4698.3786793.94569993 3.3896.95737846.5644377.996746.445385.5496794.35439.53383 Octadecanoids 9.3854.846484.965398.75885.9578437.65 3.587654.585858 8.6558649.85455.3875 5.68586 3.46348.58539.999595.6668.9333553 3.763758 Inflammatory Anti+inflammatory 7.77557 3.4.5665.99486 3.499683.87539 4.3666 3.445576 8.893373 3.4588487 3.9394784 4.5897 3.7484.66558.7758688.943589.359966 6.8488 Pro+inflammatory 3.95386 4.9798 3.483579 3.6384 5.657 3.675 6.77985 4.4949 6.58439 3.7776977 3.37876 8.578867 5.383456.77785.536555.459349 4.355 6.675966 Enzymatic COX.3984.4483448.8443.69847.75444.5878489.7445.9454.345346.84988.85493.779488.4737.96865.9438.59547977.69696.99857 CYP45 4.339 4.3453685 3.647466 3.6667 5.3879 3.977755 6.6394498 4.6399 6.366467 4.4364 3.4695795 8.49864 5.33498.56637.35.583757 4.756773 6.767438 LOX 8.45646.98967.393 3.5539 3.865389.94698 4.6998886 3.444836.7976 3.3697 3.689946 5.78589 3.55839.367638.3787357.88783.59977874 6.838767 Nature Medicine doi:.38/nm.497
Supplementary Table P values for linear model of rela)onship between each phenotype with BMI as covariate. Covariate p Age.9 FPG.57 FPI.747 HOMA:IR.643 HbAc.48 CrP.73 Leptin.54 Total.Cholesterol.674 HDL.Cholesterol.39 LDL.Cholesterol.788 Triglycerides.463 ALAT.494 ASAT.74 ggt.38 Nature Medicine doi:.38/nm.497
Supplementary Table 3 Primer Sequences. Primer Sequence Gene ARBPfor Ephxfor Ephxfor Ephx3for Ephx4for UCPfor LPLfor TTTGGGCATCACCACGAAAA GGAGACCTTACCACTTGAAGATG ACCACTCATGGATGAAAGCTACA CAGTGGACTCCGATAGCACG TCCCTGGTGTACGGCTACTG AGGCTTCCAGTACCATTAGGT GCCCAGCAACATTATCCAGT ARBPrev Ephxrev Ephxrev Ephx3rev Ephx4rev UCPrev LPLrev GGACACCCTCCAGAAAGCGA GCCCGGAACCTATCTATCCTCT TCAGGTAGATTGGCTCCACAG TGGGACGACTACAGAGCCG ATCTTAACCCGGAGTCCTTGA CTGAGTGAGGCAAAGCTGATTT GGTCAGACTTCCTGCTACGC ARBP Ephx Ephx Ephx3 Ephx4 UCP LPL Nature Medicine doi:.38/nm.497
Supplementary Table 4 An)bodies. Antibody)List Vendor Catalog)# FATP(ALSVL5,)m=) Santa)Cruz)Biotechnology sc=554 Pan=Cadherin(H=3) Santa)Cruz)Biotechnology sc=733 β=tubulin Cell)Signaling)Technology 46 HRP)conjugated)anti)Rabbit)IgG Cell)Signaling)Technology 774 Anti=CD36 Santa)Cruz)Biotechnology sc=954 Nature Medicine doi:.38/nm.497
Supplementary Video Representa)ve imaging of FFA- SS- Luc uptake in UCPcre +/- Rosa(stop)Luc +/- injected intravenously with luciferin- conjugated fapy acid and,3- dihome or vehicle. Data from individual images using sequen)al one- minute exposures over approximately 5 minutes was stacked into a movie. The animal on the lev is the vehicle treated and the mouse on the right is treated with,3- dihome. Supplementary Video Representa)ve imaging of FFA- SS- Luc uptake in CAG- Luc +/+ brown adipocyte cells treated with,3- dihome or vehicle and then incubate with luciferin- conjugated fapy acid. Data from individual images using sequen)al 3 second exposures over approximately 5 minutes was stacked into a movie. The well on the lev is vehicle treated and the well on the right is treated with,3- dihome. Nature Medicine doi:.38/nm.497