ISSN 1007-7626 CN 11-3870 / Q http / /cjbmb bjmu edu cn Chinese Journal of Biochemistry and Molecular Biology 2015 2 31 2 168 ~ 174 DOI 10 13865 /j cnki cjbmb 2015 02 09 PTC NMD * 030006 mrna nonsense-mediated mrna decay NMD mrna premature translation termination codon PTC mrna PTC mrna NMD 1 retinoblastoma gene 1 RB1 NMD mini-rb1 1 ~ 14 cdna 14-15- 16 ~ 27 cdna pcdna 3 1-3 W99X G310X R467X mini-rb1 HeLa qrt- PCR W99X mrna mini- RB1 W99X NMD NMD D mini-rb1 mini-rb1 W99X mrna W99X mini-rb1 mrna NMD Western mini-rb1 W99X PTC mrna NMD mrna NMD Q789 Translation Re-initiation of PTC Downstream Induced the Escape of Nonsense mrna from NMD LIU Jing ZHANG Zhi-Bo CHAI Bao-Feng * Key Laboratory of Chemical Biology and Molecular Engineering of Ministry of Education Institute of Biotechnology of Shanxi University Taiyuan 030006 China Abstract Nonsense-mediated mrna decay NMD acts as an important supervision and quality control mechanism regulating the elimination of mrna containing premature translation termination codon PTC PTC is produced by nonsense miss-splicing frame-shift mutations NMD pathway-mediated mrna degradation will prevent the deleterious damage caused by improperly truncated proteins Many 2014-09-15 2014-10-07 No 31172078 30770294 No 20111401110008 No 201311124 2014-1 * Tel 0351-7019083 E-mail bfchai@ sxu edu cn Received September 15 2014 Accepted October 7 2014 supported by National Natural Science Foundation of China No 31172078 30770294 Research Fund for Doctoral Program of Higher Education of China No 20111401110008 Research Project Supported by Shanxi University of China No 201311124 and Research Project Supported by Shanxi Scholarship Council of China 2014-Major Project 1 * Corresponding author Tel + 86-351-7019083 E-mail bfchai@ sxu edu cn
2 PTC NMD 169 aberrant mrnas containing PTC could escape from the NMD pathway but the mechanism remains unclear In this study we constructed a mini-rb1 retinoblastoma gene 1 RB1 fragment which included cdna of exon 1 ~ 14 DNA of intron 14-exon 15-intron 15 and cdna of exon 16 ~ 27 and inserted it into mammalian expression vector pcdna3 1 - Three nonsense mutants of mini-rb1 were generated by introducing W99X G310X and R467X into mini-rb1 gene individually based on Human Genome Mutation Database HGMD The real-time qpcr was used to analyze the mrna level of the mini-rb1 before and after treatment with actinomycin D an inhibitor of transcription or cycloheximide an inhibitor of NMD pathway No significant difference of mrna levels of mini-rb1 W99X mutants was observed with treatment of the either of the two drugs Also comparable mrna levels were observed between the wild-type mini-rb1 and mini-rb1 mutants All these facts suggest that the RB1 W99X might be capable of escaping from the NMD pathway Furthermore Western blotting indicated that the translation of mini-rb1 W99X was re-initiated downstream of W99X and the resultant N-terminus truncated proteins of RB1 might lead to the escape of the nonsense mrna from NMD Our results highlighted the possibility that translation re-initiation of the nonsense W99X mutation down-stream might be the major mechanism responsible for the NMD escape of RB1 mutants Key words retinoblastoma gene 1 RB1 nonsense-mediated mrna decay NMD NMD-escape translation re-initiation mrna nonsense-mediated 26 cdna 4 772 mrna decay NMD bp 2 787 bp 928 NMD RB G 1 /S mrna 6 8-10 1 2 mini-rb1 mrna PTC NMD 1 3 4 1 PTC NMD NMD NMD NMD- mini-rb1 irrelevant 5' 1 NMD NMD PTC NMD RB1 NMD NMD-escape 5 retinoblastoma RB 1 1 000 1 1 20% 6 1971 Knudson HeLa HEK-293T 7 E coli DH5α RB Plasmid Miniprep Kit BioMIGA Gel Extraction Kit Transgen suppressor gene antioncogene Biotech DMEM Theromo RBGMdb http / /rb1-lsdb d-lohmann CellAmp Direct Prep Kit for RT-PCR Real Time de / RB1 &Protein Analysis RNAiso Plus PrimeScript RT 42 4% reagent Kit with gdna Eraser TaKaRa 8 7% Taq DNA polymerase FastPfu DNA polymerase 20 8% mrna PCR mini-rb1 mrna 50 ~ 55 bp 11 NMD 12 PTC mini-rb1 mrna RB1 13q14 178 kb27 13 14 TransGene FBS Trypsin
170 31 cycloheximide CHX D actinomycin D Solarbio 1 2 mini-rb1 PCR mini-rb1 1 ~ 14 cdna 14-15- 16 ~ 27 cdna 1 3 HEK-293T RNA cdna BF436 /BF437 BF440 / BF441 2 RB1 HEK- 293T BF438 / BF439 Table 1 List of sequences of primers used in this study 3 pcdna3 1 - mini-rb1 pcmv-mh-rb1-wt Table 1 BF451 / 452 BF453 /454 BF455 /456 PCR Dpn I DH5ɑ Primer Sequence of primers 5' 3' Product /bp BF436 TAGGATCCATGCCGCCCAAAACCCCC BF437 GCGGTCGACAACTCCAAGTTTGTATCGCTGT 1 367 BF438 GTTGTCGACCGCTTGTATTACCGAGTAATGG BF439 CTGGCATGCGACATATGAAAAATGTTGTCAT 604 BF440 ATCGCATGCTTTATTGGCGTGCGC BF441 CGCAAGCTTTTTCTCTTCCTTGTTTGAGGT 1 348 BF451 AAAAGAAAAAGGAACTGTGAGGAATCTGTATCT BF452 TCACAGTTCCTTTTTCTTTTGAATATAACCTCC 9 003 BF453 GGACTTGTAACATCTAATTGACTTCCAGAG BF454 AATTAGATGTTACAAGTCCAAGAGAATTCAT 9 003 BF455 TCTGTTTCAGGAAGAAGAATGATTATCCATTC BF456 ATTCTTCTTCCTGAAACAGATAATTTAAAAAAAA 9 003 BF442 ATTAGCGAGGAAGACCTCGGA BF443 AAACTCAAGCCTGACGAGAGG 170 BF325 ATTCGACCACCAAGCGAAACA BF326 CCTTGAGCCTGGCGAACAGTT 131 1 3 37 5% CO 2 1 5 10% FBS DMEM 3 ~ 4 Western prb mini-rb1 pcmv-mh-rb1-wt ml /25cm 2 80% ~ 100% HEK-293T 48 h HeLa HEK-293T 0 5% BCA 5 ~ 7 min 1 2 ~ 1 3 60μg 8% SDS-PAGE QIAGEN Attractene Transfection 90 V 2 h 5% 2 h Reagents 24 h anti-c-myc anti-ha 4 PBST 3 4 μg /ml D 200 μg /ml 10 ~ 15 min TransGene 3 h RNA 1 4 qrt-pcr RB1 mrna HeLa 24 h 3 h 1 6 RNA RNA RNA cdna Real-time PCR SYBR Premix EX Taq TM II TAKARA cdna BF442 /443 BF325 /326 qrt-pcr RB1 mrna 1 5 h PBST ECL EnGreen 3 mini-rb1 / Table 1 PCR Sigma Plot
2 PTC NMD 171 10 0 T-test * P < 0 05 ** P < 0 01 2 2 1 mini-rb1 1 2 RB1 3 RB1-WT HEK-293T 48 h Fig 1A 1 ~ 14 14-15- pcdna3 1 - PCR Fig 1B mini-rb1 pcmv-mh-rb1-wt mini-rb1 pcmv-mh- N c-myc 15 16 ~ 27 Western Fig 1C Bam HI Sal I Sph I Hind III prb 113 kd Fig 1 Construction and expression of recombinant plasmid pcmv-mh-rb1 A Schematic illustration of pcmv-mh- RB1-WT construction B Identification of recombinant plasmid pcmv-mh-rb1 by using PCR and double digestion Lane 1 pcdna3 1 - vector Lane 2 Recombinant plasmid pcmv-mh-rb1-wt Lane 3 Product of PCR reaction Lane 4 Product of double digest reaction M DNA marker C Western blotting analyses the expression of mini-rb1 gene in mammalian cells confirming correct splicing and translation of mini-rb1 gene in HEK-293T cells Proteins lysate of untransfected HEK-293T cells was used as control no band appeared upper panel lane 1 prb protein was detected by using c-myc antibody from lysate of HEK-293T cells transfected with recombinant plasmid pcmv-mh-rb1-wt upper panel lane 2 β-actin was used as loading control and detected by anti β-actin antibody lower panel M1 p W99X M2 p G310X M3 p R467X NMD RB1 pcmv-mh-rb1-wt M1 p BF451 /452 BF453 /454 BF455 /456 W99X mini-rb1 1 PCR PCR NMD M2 p G310X M3 2 2 mini-rb1 3' 55 bp 3 NMD NMDirrelevant 5 mini-rb1 Fig 2 p R467X mini-rb1 2 3 Fig 2 Sequencing confirmation of three nonsense mutants of mini-rb1 resulted from site- directed mutagenesis Each mutation site has been marked by the solid line box A Mutant M1 p W99X changing the code TGG into nonsense codon TGA B Mutant M2 p G310X changing the code GGA into nonsense codon TGA C Mutant M3 p R467X changing the code CGA into nonsense codon TGA ps The direction of Mutant M2 sequence is reverse and the two others are forward
172 31 2 3 mini-rb1 mrna mini-rb1 HeLa 24 h RNAiso Plus RNA cdna BF442 /443 PCR realtime qpcr RB1 mrna Fig 3 RB1 3 mrna 105 1% P = 0 5522 99 6% P = 0 9664 91 2% P = 0 0647 MEN1 NMD mrna 15 and mutant mini-rb1 in HeLa cells No significant RB1 M1 p W99X mrna differences of mrna levels were observed between wild NMD-irrelevent M2 p G310X M3 p R467X RB1-M2 and RB1-M3 suggesting the mutants might RB1 W99X mrna escape from control of NMD Each mrna expression level NMD NMD is relative to wild type Mean values and SD are shown for G310X R467X NMDirrelevent NMD triplicate samples from three independent experiments * < 0 05 and ** P < 0 01 vs control P 2 4 mini-rb1 W99X NMD Fig 3 qrt-pcr analysis of mrna levels of wild type type mini-rb1 RB1-WT gene and mutants RB1-M1 mrna 1 0023 P = W99X 0 5994 1 0784 P = 0 2820 1 1378 ** P = NMD mini-rb1 0 0098 Fig 4B 2 24 h HeLa mini-rb1 mrna D actinomycin D NMD cycloheximide CHX 3 ~ 5 h NMD MEN1 RNA qrt-pcr t XPC mrna mrna mini-rb1 3 NMD mrna 1 369 * mini-rb1 P W99X = 0 0346 1 477 * M2 M3 mrna P = 0 0237 1 170 P = W99X NMD 0 0530 Fig 4A NMD Fig 4 qrt-pcr analysis of mrna levels of wild type and mutant mini-rb1 in HeLa cells after treatment with actinomycin D or cycloheximide The changes of the mrna levels of mini-rb1 gene and nonsense mutants when mrna synthesis transcription was repressed by actinomycin D A and protein synthesis translation was repressed by cycloheximide B Each mrna expression level is relative to wild type Mean values and SD are shown for triplicate samples from three independent experiments * P < 0 05 and ** P < 0 01 vs control
2 PTC NMD 173 CFTR p53 18 Kuschal 16 XPC mrna NMD MEN1 15 mrna W99X mrna 3 NMD NMD 1 2 5 W99X PTC NMD NMD-escape NMD mini-rb1 N W99X NMD NMD prb C HA NMD Western Fig 5 mini-rb1 PTC 17 19 Lane 2 prb 1 3 NMD Lane 3 ~ 5 mini-rb1 20 RB1 M1 N prb exon-exon junction complex EJC EJC W99X NMD mrna NMD β-globin NMD-escape NMD 17 mini-rb1 W99X NMD NMD Fig 5 Analysis of expression of prb proteins from the wild-type and mutants of mini-rb1 in HEK-293T cells No protein band was detected from untransfected HEK-293T cells lysate Lane 1 Full-length and truncated prb proteins were detected from lysate of HEK- 293T cells transfected with recombinant plasmid pcmv- MH-RB1-WT or three mutants W99X G310X or R467X 3 21-23 NMD mrna PTC mrna 11 2011 mrna cystic References fibrosis CF NMD CF cystic fibrosis transmembrane regulator CFTR CFTR mrna Neu-Yilik 17 PTC mrna mrna NMD PTC mrna NMD NMD mini-rb1 W99X NMD NMD NMD NMD 1 Nicholson P Yepiskoposyan H Metze S et al Nonsensemediated mrna decay in human cells mechanistic insights functions beyond quality control and the double-life of NMD factors J Cell Mol Life Sci 2010 67 5 677-700 2 mrna NMD J
174 31 Jia X B Hu J Nonsense-meditated mrna decay J Chin J Biochem Mol Biol 2012 28 2 115-120 3 mrna J Lin M Xie H L Nonsense mediated mrna decay and tumor J Int J Pathol Clin Med 2006 26 4 291-294 4 mrna L Liu J Wang G et al Tumor suppress gene MEN1 with J Shen Q Chai B F Mechinisam and diesases of nonsense-mediated mrna decay J J Pract Med Tech 2008 15 35 120-122 5 You K T Li L S Kim N G et al Selective translational repression of truncated proteins from frame shift mutation-derived mrnas in tumors J PLoS Biol 2007 5 5 e109 6 1 RB1 Proc Natl Acad Sci U S A 2013 110 48 19483-19488 J Liu S H Wang S Z Zhang H et al Research advances on RB1 gene J Hereditas 2010 32 11 1097-1104 17 Neu-Yilik G Amthor B Gehring N H et al Mechanism of escape from nonsense-mediated mrna decay of human betaglobin transcripts with nonsense mutations in the first exon J 7 Knudson A G Jr Mutation and cancer statistical study of RNA 2011 17 5 843-854 retinoblastoma J Proc Natl Acad Sci U S A 1971 68 4 820-823 8 Kennedy B K Pennypacker J K RB and lamins in cell cycle regulation and aging J Adv Exp Med Biol 2014 773 127-142 9 Zhao J Zhang Z Liao Y et al Mutation of the retinoblastoma tumor suppressor gene sensitizes cancers to mitotic inhibitor induced cell death J Am J Cancer Res 2014 4 1 42-52 10 Rb J Trends Biochem Sci 2006 31 11 639-646 J Huang Z Y Wang 21 Nudelman I Rebibo-Sabbah A Shallom-Shezifi D et al X J Peng X D et al Deletion of Rb gene in human stomach Redesign of aminoglycosides for treatment of human genetic cancer J Chin J Biochem Mol Biol 1993 9 4 448-453 11 D HepG2 G2 J Xiao J Y Liu X F Yun J P Low dose actinomycin treatment induces HepG2 cell cycle G2 arrest J New Med 2012 43 2 93-96 12 Bellais S Le Goff C Dagoneau N et al In vitro readthrough of termination codons by gentamycin in the Stuve-Wiedemann Syndrome J Eur J Hum Genet 2010 18 1 130-132 13 Malik V Rodino-Klapac L R Viollet L et al Gentamicininduced readthrough of stop codons in Duchenne muscular dystrophy J Ann Neurol 2010 67 6 771-780 14 J Chen Z Z Progress on genetic disease caused by nonsense mutation and its new therapeutic drug J Food Drug 2008 10 1 55-57 15 MEN1 NMD J Jia C nonsense mutation subjected to NMD pathway J J Shanxi Univ Nat Sci Ed J Shanxi Univ Nat Sci Ed 2013 36 S1 132-137 16 Kuschal C DiGiovanna J J Khan S G et al Repair of UV photolesions in xeroderma pigmentosum group C cells induced by translational readthrough of premature termination codons J 18 Floquet C Deforges J Rousset J P et al Rescue of non-sense mutated p53 tumor suppressor gene by aminoglycosides J Nucleic Acids Res 2011 39 8 3350-3362 19 Kozak M Effects of intercistronic length on the efficiency of reinitiation by eucaryotic ribosomes J Mol Cell Biol 1987 7 10 3438-3445 20 Rehwinkel J Raes J Izaurralde E Nonsense-mediated mrna decay Target genes and functional diversification of effectors diseases caused by premature stop mutations J Bioorg Med Chem Lett 2006 16 24 6310-6315 22 Nudelman I Rebibo-Sabbah A Cherniavsky M et al Development of novel aminoglycoside NB54 with reduced toxicity and enhanced suppression of disease-causing premature stop mutations J J Med Chem 2009 52 9 2836-2845 23 Goldmann T Overlack N Moller F et al A comparative evaluation of NB30 NB54 and PTC124 in translational readthrough efficacy for treatment of an USH1C nonsense mutation J EMBO Mol Med 2012 4 11 1186-1199