2009, 36 (5) : 743-748 Acta Horticulturae Sinica DNA2ITS 1, 2, 2, 2, 13 ( 1, 510360; 2, 210095) : DNA2ITS, :, : ; ; ; DNA2ITS : S 68211 + 4 : A : 05132353X (2009) 0520743206 Iden tif ica tion of C o lle to trichum sp. from A n thu rium and raeanum and Its Sequenc ing of R ibosoma l D NA2ITS X ING Hong2mei 1, 2, D ING Ping 2, WANG Ke2rong 2, and ZHOU Xiao2yun 13 ( 1 Guangzhou Flow er Research Center, Guangzhou 510360, China; 2 College of Plant Protection, N anjing A gricultural U niversity, N anjing 210095, China) Abstract: Among the Colletotrichum strains isolated from A n thu rium and raeanum jing, Yangzhou, there were two group s exhibited different morphology on the culture. in Guangzhou, Nan2 Two strains of each group were chose for species identification w ith the morphological character, pathogencity on p lants, range and the sequence of ribosomal DNA 2ITS. Colletotrichum g loeosporioides and C. and raeanum. Both species could infect solely, crossly and latently. host The results indicated that these strains belong to two species, destructivum, and the latter was first reported as a pathogen in A n thu rium Key words: A n thu rium and raeanum ; Colletotrichum ; pathogen identification; ribosom al DNA 2ITS, (Anthu rium andraeanum ) (Colletotrichum sp. ), :,,,, ;,,,, 1 111 2004 2006,, 136 : 2008-12 - 09; : 2009-03 - 24 : (2004Z32E0411) 3 Author for correspondence ( E2mail: xyzh28@1261com; Tel: 020281551937)
744 36, C01, HZ21, 112 YZ21 Kochp s ( ) ( 10 5 10 6 ml - 1 ) 25, RH 90% 100%, 5 #,,, 8, 3, 2 d, 1 2 d,,, 113 PDA 7 d,, 25, 12 h 114 11 : (Spathiphyllum kochii Engler & Krause. ) ( ), (D ieffenbachia picta) ( ), ( Spa thiphyllum floribundum L ind. et. Andre NE. B r. cv. M ) ( ), (Guzm ania continental) ( ), (Calathea m akoyana) ( ), (D racaena cam bodiana) ( ), (D endrobium sp. ) ( ), ( Phalaenopsis am abilis) ( ), (Cym bidium sp. ) (), (D racaena arborea) ( ), (M alus pum ila M ill. ) ( ), 25, RH 90% 100%, 6, ( ) 115 rd NA ( in terna l tran scr ibed space, 11511 3 2 d, 1 2 d ITS) PCR PDA PDA ( 30 ml ), 3, 2 22 25 4 6 d,, 5 ml, 24 48 h,, - 20 11512DNA 012 g115 ml Eppendorf, 900 L CTAB, 90 L 10% SDS,, 55 1 h, 12 000 r m in - 1 15 m in, (25 24 1),, 12 000 r m in - 1 10 m in, 12 000 r m in - 1 10 m in, 1 /10 NaAc 2, - 20 1 h, 12 000 r m in - 1 10 m in, 70% 1, 30 L 11513 ITS DNA ITS1 ITS4 PCR, ITS1: 5 2TCCGTAG2 GTGAACCTGCGG23, ITS4: 5 2TCCTCCGCTTATTGATATGC23
5 : DNA2ITS 745 11514 PCR PCR 25 L: DNA, 015 mol, 4 dntp 50 mol, 215 L 10 PCR, 2 mmolmg 2 +, 1125 Taq ( Promega), 1, PE2400 PCR: 94 5 m in;, 94 1 m in, 55 30 s, 72 1 m in, 31 ; 72 7 m in UN IQ210 PCR, PMD182T, E1coli JM109, Amp LBPCR, 11515 ITS DNA2ITS GenBank ( http: 2 211 //www1ncbi1nlm1gov1blast) 136, PDA 2 (C038 C049; C08 C014) : ; ; C08 ( 6215% ) 212 C038 C049 PDA :, ;,,,,,, 011 014 cm,,, 1315 1710 m 410 510 m,, ( 1),,, Colletotrichum gloeosporioides ( Penz. ) Penz. & Sacc. F ig. 1 C038 A: ; B: ; C: 1 M oda lity of stra in C038 in Colletotrichum sp. A: Colony; B: Conidia; C: App ressoria. C08 C014 PDA,,,,,,, ( ),, 18 22 m 315 415 m, C038
746 36 C049,,,,, ( 2), Colletotrichum destructivum OπGara F ig. 2 C014 A: ; B: ; C: 2 M oda lity of stra in C014 in Colletotrichum sp. A: Colony; B: Conidia; C: App ressoria. 213 C038 C049, 3 d,,,,, 4 d 012 cm,,, 30 d, ( 3) C08 C014 5 d, C038, C038 ( 3) :,, F ig. 3 30 d 3 Sym ptom on A n thu rium andraeanum leaves caused by Colletotrichum sp. 30 days after inoculation 214,,, C038 C049 :,,,,
5 : DNA2ITS 747 C08 C014 ; C038, 215 ITS : C038 C049 (C. g loeosprioides), C08 C014 HZ215 (C. destructivum ), DNA2ITS : C038 C049 ITS C08 C014 HZ215 85% 87% C038, C049DNA2ITS, :, DNA2ITS532 bp 534 bp B last GenBank (NCB I), 100, 98 C. gloeosporioides Glom erella cingulata, 97% 98%, 98% C. gloeosporioides ITS, 3 C08 C014 HZ215, :, 3 DNA2ITS 538 bp B last GenBank, 100, 98C. destructivum, 3 99%, C. destructivum ITS 3 ITS,,, ITS, DNA ITS ( internal transcribed space), ( Cooke et al., 1996; A ltomare et al., 1997; Johnson & Jones, 1997; Leclerc2Potvin et al., 1999;, 2000;, 2004;, 2007) (2006) ITS, (M ycosphaerella fijiensis) Yan (1995) ITS Phialophora am ericana P. verrucose, ITS, 97% ( Sreenivasp rasad et al., 1996 ), ITSC038 C049 C08 C014 HZ215,, ITS, ITS, B last GenBank AR3750 ( Colletotrihum sp. ) AR3749 ( Glom erella sp. ) ITS 99%,, C. destructivum,, ITS, (, 2008), ITS References A ltomare C, Petrini O, Logrieco A. 1997. Taxonom ic relationship s among the toxigenic species Fusarium sporotrichioides and Fusarium tricinctum by isozyme analysis and RAPD assay. Can J Bot, 75 (4) : 1674-1684.
748 36 Cooke D E L, Kennedy D M, Guy D C. 1996. Relatedness of group species of Phytophthora as assessed by RAPD and sequences of ribosomal DNA. Mycological Research, 100 (9) : 297-303. Johnson P R, Jones D. 1997. Relationships among colletotrichum isolates from fruit2rots assessed using rdna sequences. Mycologia, 89 ( 3) : 420-430. Leclerc2Potvin C, BalmasV, Charest P, Jabaji2Hare S. 1999. Development of reliable molecularmarkers to detect non2pathogenic binucleate Rhi2 zoctonia isolates (AG2G) using PCR. Mycological Research, 103: 1165-1172. L iw an, L i Lu, L i Jing2peng, Xu Xiu2hong. 2007. 16S rdna gene identification and sequence comparison of three soybean Rhizobia from field. Journal of Northeast Agricultural University, 38 (6) : 725-728. ( in Chinese),,,. 2007. 16S rdna., 38 (6) : 725-728. Meng Jun. 2008. M ining new targets for Phytophthora molecular detection and development of high2throughput plant pathogen molecular detection technology [ Ph. D. D issertation ]. Nanjing: Nanjing Agricultural University: 72. ( in Chinese). 2008. []. : : 72. Peng Gui2xiang, Chen W en2xin, Tan Zhi2yuan. 2004. Identification and phylogenetic analysis of closely related rhizobium species by rrna gene intergenic spacer sequence. Journal of South China Agricultural Um iversity: Natural Science Edition, 25 (4) : 58-62. ( in Chinese),,. 2004. rrna. :, 25 (4) : 58-62. Sreenivasprasad S, Sharand K, B rown A E, M ilis P R. 1996. PCR2based detection of Colletotrichum acutatum on strawberry. Plant Pathology, 45 (7) : 650-655. W ang Guo2fen, Dai Peng, Peng Jun, Xie Yi2xian, Huang Jun2sheng. 2006. Identification and ITS sequence analysis of the pathogens of banana sigatoka disease. Chinese Journal of Tropical Crop s, 27 (4) : 46-50. ( in Chinese),,,,. 2006. ITS., 27 ( 4) : 46-50. W ang Yuan2chao, Zhang Zheng2guang, Zheng Xiao2bo. 2000. U se ITS regions of rrna gene as an additional characteristic in identification of Phytoththora boehm eriae and P. cactorum. Mycosystema, 19 (4) : 485-491. ( in Chinese),,. 2000. ITS., 19 (4) : 485-491. Yan Z H, Rogers S O, W ang C J K. 1995. A ssessment of Phialophora species based on ribosomaldna internal transcribed spacers and morpholo2 gy. Mycologia, 87 (1) : 72-83., 7, 33, 44, 552, ; ; 21,,, : 47 ( ) 12, 100081