50 (1) :48-54, 2004 A cta Zoologica S inica IL21 IFN2 3 133 1,2 2 1., 100080 2., 150030 21 ( IL21 ) 2 ( IFN2 ), Spre2 qne2dawley, - IL21 mrna IFN2 IL21 mrna,, IL21 mrna,, IL21 mrna,,, IL21 mrna IL21 mrna IFN2, IL21 mrna, IL21 mrna, IFN2 IL21 mrna [ 50 (1) : 48-54, 2004 ] IL21 IFN2 RT2PCR The expression of IL21 in the uterus and placenta of pregnant rat and its regulation by human recombinant interferon gamma ( hrifn2 ) 3 XIA Hong2Fei 1,2, HAO Yan2Hong 2, PEN G Jing2Pian 133 1. Key Laboratory of Reproductive Biology, Institute of Zoology, Chinese Academy of Sciences, Beijing 100080, China 2. Department of Physiology, North East Agricultural University, Harbin 150030, China Abstract To investigate interleukin21 beta ( IL21 ) expressing change and the effects of human recombinant interferon gamma (hrifn2 ) to the expression of IL21 in the course of pregnancy, the Sprague2Dawley rat was chosen as in vivo model to examine IL21 mrna expression in uterus and placenta in the different phases of pregnant rat and the effects of human recombinant interferon gamma ( hrifn2 ) to the expression of IL21 mrna. Experiment result indicated that uterus IL21 mrna expression in the peri2implantation period is relative high, in implantation period is significantly de2 creased. With fetus development and trophoblast inbreak, uterus IL21 mrna expression keeps increasing. Placenta IL2 1 mrna expression is not significantly different during the course of pregnancy. The influence of exceeding normal con2 centration hrifn2 to uterus IL21 mrna expression is not significantly different in the implantation period and is signifi2 cantly reduced in other period, including peri2implantation, after implantation, mid and late gestation period. Placenta IL21 mrna expression in late gestation is significantly decreased after injecting IFN2. These indicate hrifn2 can sup2 press the expression of IL21 mrna of uterus and placenta in certain phases of pregnancy [ Acta Zoologica Sinica 50 (1) : 48-54, 2004 ]. Key words Pregnant rat, Uterus, Placenta, IL21, IFN2, RT2PCR 21 ( IL21),,, IL21 2003207217, 2003209224 3 (30370165) ( KSCX32IOZ207) [ This research was fund2 ed by grants from the National Natural Science Foundation of China (No. 30370165) and the Leading Innovation Research Programs of Chi2 nese Academy of Sciences ( KSCX32IOZ207) ] 33 (Corresponding author). ν 2004 Acta Zoologica Sinica E2mail : pengjp @panda1ioz1ac1cn
1 : IL21 IFN2, IFN2 IL21,, (Bischof et, al., 2000 ; Kniss and Iams, 1998) 50 000 IU IFN2 100 000 IL21, IU IFN2 D2, D4 IL21,,, - 80 IL21, D2 D6 D12 D16, D6 D9 D15 ( TGF ) D19,, IL21, IL21 IL26, - 80 ( Turner et al., 2002) IFN2 (, 2002 ; Liu et IL21 al., 2002) IFN2 Th1 ( Fievet et al., 2001 ; Knackstedt et al., 2001 ; Zenclussen et al., 2002), IFN2 IL21 Promega, IL21 2actin IL21 IFN2 IL21 1 111, 220-260 g Spreqne2Dawley Promega Accesss RT2PCR System Kit, 54, (1 1), RT, 1 (D1), 1 g RNA IL21 2actin ( 515 ) 1 : (D1 - D9) IL21 Jacobs et al. (1997) IL2 (D10 - D15) (, D16-1 48 45 min, 94 3 min, D19), (D1 - D4) PCR 94 30 s, 52 30 s, 68 1 (D5 - D6) (D6 - D9) 112 IL21 94 30 s, 58 30 s, 68 1 min, 30,, 68 10 min,, D4 D6 D9 D15 D19, RNA RT2PCR, 2 (1 g/ kg ),,, RT2PCR, 3 RNA, - 80 PCR 1 RT2PCR Table 1 Primers and expanding product size of RT2PCR 113 IFN2, RNA TRI2 zol reagent Invitrogen, RT2PCR 114 RNA RT2PCR TRIzol RNA, RNA, DNA, DNase RNA RT2PCR min, 35, 68 7 min 2actin 48 45 min, 94 3 min, PCR, 1 Nuclease2Free Water 49 IL21 2actin Primers Sequence Product size Up2primers CTCCATGAGCTTTGTACAAGG 245 bp Down2primers TGCTGATGTACCAGTTGGGG Up2primers GTGGGGCGCCCCAGGCACCA 548 bp Down2primers CTCCTTAATGTCACGCACGATTTC
0 5 50 1 IL21. IL21 mrna. A B IL21 mrna M : 2 kb DNA 1 2 3 4 5 (D4) (D6) (D9) (D15) (D19) IL21 mrna, 6 7 8 IL21 mrna 3 P < 0105, 33 P < 0101 Fig11 Determination of IL21 mrna expression in uterus and placenta in different phase of pregnancy. Uterus and placenta IL21 mrna expression in different phase of pregnancy.. Statistical analysis of optical density value. A and B indicate uterus and placenta IL21 mrna expression in different phase of pregnancy respectively. M : 2 kb DNA ladder marker. 1, 2, 3, 4 and 5 indicate uterus IL21 mrna expression in peri2implantation period (D4), implantation period (D6), after2implantation period (D9), mid2gestation period and pre2parturition period (D19), respectively. 6, 7 and 8 indicate placenta IL21 mrna expression in early ges2 tation period (D9), mid2gestation period (D15) and pre2parturition period (D19), respectively. 3 P < 0105, 33 P < 0101. 115 RT2PCR 0105 0101 PCR 115 % ( 015 g/ ml ), Personal Den2 sitometer SI ( molecular Dynamics ) 211 IL21, FragmeN T Analysis, ( D4), IL21 2actin, mrna (012031 01101), 116 ( gx S D) 01034), ( D9),, Kolmogorov2Simirnov 2 (D6), IL21 mrna (01077 (D15) (D19) IL21 mrna, ( 01236 01062 01271 01065 01328,, 01139) D6 IL21 mrna Studentπs t, D4 ( P < 0101) D9 ( P < 0101)
1 : IL21 IFN2 51 2 IFN2 IL21 I. hrifn2 IL21 mrna. A B C D E hrifn2 (D4) (D6) (D9) (D15) (D19) IL21 mrna M : 2 kb DNA 1 4 7 10 13 D4 D6 D9 D15 D19 IL21, 2 5 8 11 14 50 000 IU IFN2 D4 D6 D9 D15 D19 IL21, 3 6 9 12 15 100 000 IU IFN2 D4 D6 D9 D15 D19 IL21 3 P < 0105, 33 P < 0101 Fig12 The influence of hrifn2 on rat uterus IL21 expression in different phase of pregnancy I. Uterus IL21 mrna expression in different phase of pregnancy after hrifn2 treatment.. Statistical analysis of optical den2 sity value. A, B, C, D and E respectively indicate uterus IL21 mrna expression in peri2implantation period, implantation period (D6), af2 ter implantation period (D9), mid2 gestation period (D15) and pre2parturition period (D19) after injecting hrifn2. M : 2kb DNA ladder marker. 1, 4, 7, 10 and 13 indicate rat uterus IL21 mrna expression in D4, D6, D9, D15 and D19 after injecting 019 % saline respectively, 2, 5, 8, 11 and 14 indicate rat uterus IL21 mrna expression in D4, D6, D9, D15 andd 19 after in2 jecting 50 000 IU IFN2 respectively, 3, 6, 9, 12 and 15 indicate rat uterus IL21 mrna expression in D4, D6, D9, D15 and D19 after injecting 100 000 IU IFN2 respectively. 3 P < 0105, 33 P < 0101 D15 ( P < 0101) D19 ( P < 0101) D19 D9 ( P < 0105) IL21 mrna D4 ( P < 0105) ( 1 : A) (D9) (D15) (D19) IL21 mrna (
2 5 50 01206 011 01193 0109 01263 01058) ( 1 : B) 212 IFN2 IL21 ( P > 0105) ( 3 : B) 21211 IFN2 IL21 2121111 IFN2 IL21 50 000 IU IFN2 ( P < 0105) 100 000 IU, IFN2 ( P < 0101), 100 000 IU IFN2 IFN2 IL21 50 000 IU IFN2 ( 3 : C) 50 000 IU IFN2 IL21 mrna, 100 000 IU IFN2 IL21 mr2 NA, ( P 311 L21 mrna < 0105) ( 2 : A) 2121112 IFN2 IL21 IL21, IFN2 IL21, IL21 50 000 IU, IFN2 100 000 IU IFN2 IL21 mrna, ( P > (Coulam, 2000), 0105) ( 2 : B) 2121113 IFN2 IL21 NA IL21 mrna 100 000 IU IFN2 IL21 mrna 50 000 IU IFN2 IL21 mrna ( P < 0105),, 50 000 IU IFN2 IL21 mrna ( P >, IL21 mrna 0105) ( 2 : C) 21212 IFN2 IL21, (D6) IL21 IL21 mrna IL21 mrna 50 000 IU IFN2 ( P < 0101) 100 000 IU IFN2 ( P < 0101) ( 2 : D) 21213 IFN2 IL21, IL21 mrna IL21, 50 000 IU IFN2 ( P < 0105) 100 000 IU IFN2 ( P < 0105) ( 2 : E) 213 IFN2 IL21 Kniss and Iams (1998) IL21 21311 IFN2 IL21 IL21 mrna 50 000 IU IFN2 100 000 IU IFN2 IL21 mrna, 312 IFN2 L21 ( P > 0105) ( 3 : A) 21312 IFN2 IL21 50 000 IU IFN2 100 000 IU IFN2 IL21 mrna, 21313 IFN2 IL21 IL21 mrna 3 IL21 IL21 mr2, IL21 mrna (D4) IL21 mrna, De et al. (1993),, IL21 mrna 1, IL21 IL21 IL21 IL21,,, IL21 mrna IFN2 IL21 Th1, IFN2
1 : IL21 IFN2 53 3 IFN2 IL21 I. hrifn2 IL21 mrna. A B C hrifn2 (D9) (D15) (D19) IL21 mrna M : 600 bp DNA 1 4 7 D9 D15 D19 IL21, 2 5 8 50 000 IU IFN2 IL21, 3 6 9 100 000 IU IFN2 IL21 3 P < 0105, 33 P < 0101 Fig13 The influence of hrifn2 on rat placenta IL21 expression in different phase of pregnancy I. Placenta IL21 mrna expression in different phase of pregnancy after hrifn2 treatment.. Statistical analysis of optical density value. A, B and C indicate placenta IL21 mrna expression in early gestation period ( D9), mid2gestation period (D15) and pre2parturition period (D19) after injecting hrifn2, respectively. M : 600 bp DNA ladder marker. 1, 4 and 7 in2 dicate rat placenta IL21 mrna expression in D9, D15 and D19 after injecting 019 % saline, respectively, 2, 5 and 8 indicate rat placenta IL21 mrna expression in D9, D15, D19 after injecting 50 000 IU IFN2 respectively, 3, 6 and 9 indicate rat placenta IL21 mrna expression in D9, D15 and D19 after injecting 100 000 IU IFN2, respectively. 3 P < 0105, 33 P < 0101. (Ashkar and Croy, 2001) 50 000 IU hr IFN2 ( N K) IFN2 100 000 IU hr IFN2 IL21 mr2, NA IFN2 IL21 mrna, 100 000 IU IFN2 ( Chen et al., 1994) IL21 50 000 IU (Bischof et al., hr IFN2 IL21 mrna 2000),,, IL2 Th1 1 (Wolff, 2000) hr IFN2,, IL21 IL21,, 100 000 IU hr IFN2 IL21 mrna, 50 000 IU hr IFN2, IL21
4 5 50 rhifn2 (MHC) (Liu et al., 2002) MHC, C TA, IL21 C TA IFN2 MHC (Reith and Mach, 2001) : IFN2 IL2 1 IFN2 IFN2 IL21, 25 (4) : 819-836. ( References) Ashkar AA, Croy BA, 2001. Functions of uterine natural killer cells are mediated by interferon gamma production during murine preg2 nancy. Semin. Immunol. 13 : 235-241. Bischof P, Meisser A, Campana A, 2000. Paracrine and autocrine reg2 ulators of trophoblast invation. Placenta 21 ( Suppl. A) : S55-60. Chen HL, Kamath R, Pace JL, Russell SW, Hunt J S, 1994. Expres2 sion of the interferon2gamma receptor gene in mouse placentas is re2 lated to stage of gestation and is restricted to specific subpopulations of trophoblast cells. Placenta 15 : 109-121. Coulam CB, 2000. Understanding the immunobiology of pregnancy and applying it to treatment of recurrent pregnancy loss. nancy 4 (1) : 19-29. Early Preg2 De M, Sanford TR, Wood GW, 1993. Expression of IL21, IL26 and tumor necrosis factor a in mouse uterus during the peri2implantation period of pregnancy. J. Reprod. Fertil. 97 (1) : 83-89. Fievet N, Moussa M, Tami G, Maubert B, Cot M, Deloron P, Chaouat G, 2001. Plasmodium falciparum induces a Th1/ Th2 Dis2 equilibrium, favoring the Th1/ Th2 pathway, in the human pla2 centa. J. Infect. Dis. 183 (10) : 1 530-1 534. Jacobs RA, Satta MA, Dahia PL, Chew SL, Grossman AB, 1997. In2 duction of nitric oxide synthase and interleukin21, but not heme oxygenase, messenger RNA in rat brain following peripheral ad2 ministration of endotoxin. Brain. Res. Mol. 49 ( 1/ 2) : 238-246. Knackstedt M, Ding J W, Arck PC, Hertwig K, Coulam CB, August C, Lea R, Dudenhausen J W, Gorczynski RM, Levy GA, Clark DA, 2001. Activation of the novel prothrombinase, fg12, as a ba2 sis for the pregnancy complications spontaneous abortion and pre2 eclampsia. Am. J. Reprod. Immunol. 46 (3) : 196-210. Kniss DA, Iams JD, 1998. Regulation of parturtion update. Endocrine and paracrine effectors of term and preterm labor. Clin. Perinatol. Liu Z, Chen Y, Yang Y, Peng J P, 2002. Influence of human recombi2 net interferon gamma (hrifn2 ) on rabbit pregnancy. Acta. Zo2 ol. Sin. 48 (2) : 277-280 ( In Chinese). Liu Z, Yang Y, Peng J P, 2002. The effect on MHC class expres2 sion and apoptosis in placenta by IFN administration. Contracep2 tion 65 (2) : 177-184. Reith W, Mach B, 2001. The bare lymphocyte syndrome and the regu2 lation of MHC expression. Annu. Rev. Immunol. (19) : 331-373. Turner MA, Shaikh SA, Greenwood SL, 2002. Secretion of inter2 leukin21 and interleukin26 by fragments of term human placental villi : signaling pathways and effects of tumour necrosis factor and mode of delivery. Placenta 23 (6) : 467-474. von Wolff M, Thaler CJ, Strowitzki T, Broome J, Stolz W, Tabibzadeh S, 2000. Regulated expression of cytokines in human endometrium throughout the menstrual cycle : dysregulation in ha2 bitual abortion. Mol. Hum. Reprod. 6 (7) : 627-634. Zenclussen AC, Fest S, Busse P, Joachim R, Klapp BF, Arck PC, 2002. Questioning the Th1/ Th2 paradigm in reproduction : pe2 ripheral levels of IL212 are down2regulated in Miscarriage Patients. Am. J. Reprod. Immunol. 48 (4) : 245-251.,,, 2002. -. 48 (2) : 277-280.