Effect of Trx1 Overexpression on Expression Level of MMP9 under High Glucose Condition in HBZY21

Σχετικά έγγραφα
Chinese Journal of Biochemistry and Molecular Biology. p38mapk

ACTA CHINESE MEDICINE. diabetic nephropathies DN 24. urine protein quantitation in 24 hours 24hUTP serum creatinine Scr

IL - 13 /IL - 18 ELISA PCR RT - PCR. IL - 13 IL - 18 mrna. 13 IL - 18 mrna IL - 13 /IL Th1 /Th2

Electrolyzed-Reduced Water as Artificial Hot Spring Water

Science of Sericulture

CPT. Tsuchiya. beta. quantitative RT PCR QIAGEN IGFBP. Fect Transfection Reagent sirna. RT PCR RNA Affymetrix GeneChip Expression Array

Cinnamaldehyde Prevents Endothelial Dysfunction Induced by High Glucose by Activating Nrf2

Hepatic Stellate Cells: Multifunctional mesenchymal cells of the Liver

http / / cjbmb. bjmu. edu. cn Chinese Journal of Biochemistry and Molecular Biology H 2 O 2 AKT2 TUNEL DNA ladder AKT2 sirna PI3K / AKT

Gro wth Properties of Typical Water Bloom Algae in Reclaimed Water

Cellular Physiology and Biochemistry

Optimizing Microwave-assisted Extraction Process for Paprika Red Pigments Using Response Surface Methodology

Ινσουλίνη και καρδιά. Ηλιάδης Φώτης Λέκτορας Α.Π.Θ.

Η ΥΠΕΡΕΚΦΡΑΣΗ ΤΟΥ SMAD7 ΠΡΟΣΤΑΤΕΥΕΙ ΤΟ ΗΠΑΡ ΑΠΟ ΤΗΝ TGF-Β/SMAD ΜΕΣΟΛΑΒΟΥΜΕΝΗ ΙΝΟΓΕΝΕΣΗ

High mobility group 1 HMG1

Antimicrobial Ability of Limonene, a Natural and Active Monoterpene

Extract Isolation Purification and Identification of Polysaccharides from Exocarp of Unripe Fruits of Juglans mandshurica

Μελέτη της έκφρασης του ογκοκατασταλτικού γονιδίου Cyld στον καρκίνο του μαστού

ΜΟΡΙΑΚΕΣ ΜΕΘΟΔΟΙ ΚΡΙΤΗΡΙΑ ΕΠΙΛΟΓΗΣ ΑΞΙΟΛΟΓΗΣΗ

HIV HIV HIV HIV AIDS 3 :.1 /-,**1 +332

Inhibition of mushroom tyrosinase by flavonoid from Sorbus tianschanica Ruper in Xinjiang

T CD , 0199 gπkg BW soybean isoflavones groups. Another ten 22month2old female rats were used as a young

Comparison of carbon-sulfur and carbon-amine bond in therapeutic drug: -S-aromatic heterocyclic podophyllum derivatives display antitumor activity

A strategy for the identification of combinatorial bioactive compounds. contributing to the holistic effect of herbal medicines

ΠΡΟΓΡΑΜΜΑ ΜΕΤΑΠΤΥΧΙΑΚΩΝ ΣΠΟΥΔΩΝ ΣΤΙΣ «ΚΛΙΝΙΚΕΣ ΚΑΙ ΚΛΙΝΙΚΟΕΡΓΑΣΤΗΡΙΑΚΕΣ ΙΑΤΡΙΚΕΣ ΕΙΔΙΚΟΤΗΤΕΣ»

Mitomycin C application for the prevention of postoperative synechiae formation at the anterior commissure.

α 1 2- Cloning and Expression of alpha 1 2-fucosyltransferase in E. coli BIOTECHNOLOGY BULLETIN

[11].,, , 316 6, ,., 15.5%, 9.8%, 2006., IDF,, ,500, 2,830.,, ,200.,,, β, [12]. 90% 2,,,,, [13-15].,, [13,

, SLC26A4 HEK 293. The construction of wild-type SLC26A4 gene expression vector and the expression in HEK293 cells

ΑΜΦΙΚΟΙΛΙΑΚΗ ΒΗΜΑΤΟΔΟΤΗΣΗ

Studies on the Binding Mechanism of Several Antibiotics and Human Serum Albumin

H επίδραση της γονικής παρουσίας και του παιχνιδιού σε επώδυνες διαδικασίες στα παιδιά

BGP TRACP-5b BGP TRACP-5b P 0.05

GDNF 220YL) 2,52. (glial cell line2de2. 015d 15d rived neurotrophic factor GDNF) 1993 Lin B49 (L15) (FBS) (poly2l2lysin, pll) (laminin, LN) GDNF GDNF

The toxicity of three chitin synthesis inhibitors to Calliptamus italicus Othoptera Acridoidea

( ) , ) , ; kg 1) 80 % kg. Vol. 28,No. 1 Jan.,2006 RESOURCES SCIENCE : (2006) ,2 ,,,, ; ;

Journal of Ningxia Medical University. Annexin P19 mrna P < AnnexinA2 P19 mrna. AnnexinA2 P19 mrna. PCR 1.

TGFp FSH INH INH

Nucleotide Sequence of Cloned cd NA for alpha Subunit of Goat Follicle Stimulating Hormone

Chinese Journal of Biochemistry and Molecular Biology MMP

Supplementary Table 1. Primers used for RT-qPCR analysis of striatal and nigral tissue.

Emulsifying Properties of Egg Yolk as a Function of Diacylglycerol Oil

8Q5SAC) 8Q5SAC UV2Vis 8500 ( ) ; PHS23C ) ;721 ( ) :1 4. ;8Q5SAC : molπl ;Britton2Robinson Q5SAC BSA Britton2Robinson,

*,* + -+ on Bedrock Bath. Hideyuki O, Shoichi O, Takao O, Kumiko Y, Yoshinao K and Tsuneaki G

PE CVVH PE+HP HP+CVVH HP+CVVH+PE CVVH. ENLAV of HCO - 3 ENLAV-HCO ± μmol /L HP+PE HP+CVVH HP+CVVH+PE

Influence of Flow Rate on Nitrate Removal in Flow Process

Journal of Shanghai Normal University Natural Sciences Feb SNAT2. HEK293T Western blot SNAT2 - HA Q 31 A

Study on the Strengthen Method of Masonry Structure by Steel Truss for Collapse Prevention

Distribution of Mercury and Selenium in the Proteins of Porcine Liver and Kidney Under Different Mercury Exposure Level

ΓΕΩΠΟΝΙΚΟ ΠΑΝΕΠΙΣΤΗΜΙΟ ΑΘΗΝΩΝ ΤΜΗΜΑ ΕΠΙΣΤΗΜΗΣ ΤΡΟΦΙΜΩΝ ΚΑΙ ΔΙΑΤΡΟΦΗΣ ΤΟΥ ΑΝΘΡΩΠΟΥ

,,, (, ) , ;,,, ; -

Abstract... I. Zusammenfassung... II. 1 Aim of the work Introduction Short overview of Chinese hamster ovary cell lines...

Supporting Information

Chinese Journal of Biochemistry and Molecular Biology RNA.

ΙΔΡΥΜΑ. Θεσσαλονίκη, ύλα

College of Life Science, Dalian Nationalities University, Dalian , PR China.

2 PbO 2. Pb 3 O 4 Sn. Ti/SnO 2 -Sb 2 O 4 -CF/PbO x SnO 2 -Sb PbO 2. Sn-Sb 1:1. 1 h. Sn:Sb=10:1. PbO 2 - CeO 2 PbO 2. [8] SnO 2 +Sb 2 O 4 _

Accumulation of Soil Arsenic by Panax notoginseng and Its Associated Health Risk

Basic & Clinical Medicine PLGA MUC1 MUC1 IC 50 MUC1 +

Biapenem BIPM Lot No g mg

Physical and Chemical Properties of the Nest-site Beach of the Horseshoe Crab Rehabilitated by Sand Placement

Γεωπονικό Πανεπιςτήμιο Αθηνών Τμήμα Αξιοποίηςησ Φυςικών Πόρων και Γεωργικήσ Μηχανικήσ

,HLA2B2704,, The Technique of Producing HLA2B2704 Gene Transgenic Mice. Chinese Journal of Biochemistry and Molecular Biology HLA2 B2704 ,1,2 Q33,Q78

0. 35g kg ~ 2. 0cm 10min. Nar- 15μL 6mm

ΠΑΝΕΠΙΣΤΗΜΙΟ ΘΕΣΣΑΛΙΑΣ

Μέτρηση της Ρυθµικής Ικανότητας σε Μαθητές Γυµνασίου που Ασχολούνται µε Αθλητικές ραστηριότητες Συνοδευµένες ή Όχι από Μουσική

ER-Tree (Extended R*-Tree)

1 h, , CaCl 2. pelamis) 58.1%, (Headspace solid -phase microextraction and gas chromatography -mass spectrometry,hs -SPME - Vol. 15 No.

c Key words: cultivation of blood, two-sets blood culture, detection rate of germ Vol. 18 No

«Συντήρηση αχλαδιών σε νερό. υπό την παρουσία σπόρων σιναπιού (Sinapis arvensis).»

Resurvey of Possible Seismic Fissures in the Old-Edo River in Tokyo

Correction of chromatic aberration for human eyes with diffractive-refractive hybrid elements

HepG hotmail. com. HepG2 Bid Bcl-2. HepG2 G0 /G1 Bid Bcl-2. HepG2. HepG2

Analysis of The Relationship Bet ween Nm232H1 Gene and Human Chronic Myeloblastic Leukemia Using SiRNA

Copper-catalyzed formal O-H insertion reaction of α-diazo-1,3-dicarb- onyl compounds to carboxylic acids with the assistance of isocyanide

Chinese Journal of Biochemistry and Molecular Biology ERR . I2 (TNNI2) GST2TNNI2, 1. 1

VBA Microsoft Excel. J. Comput. Chem. Jpn., Vol. 5, No. 1, pp (2006)

Mouse Gene 2.0 ST Array Shn3. Runx2 Shn3. Runx2 Shn3 Runx2. adult. (Schnurri, Shn)3/Hivep3. Runx2 Shn/Hivep. ST2 BMP-2 Shn3

http / / cjbmb. bjmu. edu. cn Chinese Journal of Biochemistry and Molecular Biology HBx HBxΔ127

ΚΥΤΤΑΡΙΚΟΣ ΘΑΝΑΤΟΣ ΚΑΙ ΑΝΑΓΕΝΝΗΣΗ Β-ΚΥΤΤΑΡΟΥ ΝΕΟΤΕΡΑ ΔΕΔΟΜΕΝΑ ΓΙΑ ΤΗ ΘΕΡΑΠΕΙΑ ΤΟΥ ΣΑΚΧΑΡΩΔΗ ΔΙΑΒΗΤΗ

ΙΠΛΩΜΑΤΙΚΗ ΕΡΓΑΣΙΑ. ΘΕΜΑ: «ιερεύνηση της σχέσης µεταξύ φωνηµικής επίγνωσης και ορθογραφικής δεξιότητας σε παιδιά προσχολικής ηλικίας»

Journal of Jiangsu University Medicine Edition. sublytic C5b-9 glomerular mesangial cell GMC. sir- NA small hair RNA shrna. TSP-1 shrna shtsp-1 GMC

9-amino-(9-deoxy)cinchona alkaloids-derived novel chiral phase-transfer catalysts

http / / cjbmb. bjmu. edu. cn Chinese Journal of Biochemistry and Molecular Biology human telomerase reverse transcriptase htert

Electronic Supplementary Information (ESI)

Η ΑΝΑΖΗΤΗΣΗ ΤΟΥ ΌΡΟΥ "ΝΟΣΗΛΕΥΤΙΚΗ" ΣΤΑ ΠΡΑΚΤΙΚΑ ΤΩΝ ΣΥΝΕΔΡΙΑΣΕΩΝ ΤΟΥ ΔΙΟΙΚΗΤΙΚΟΥ ΣΥΜΒΟΥΛΙΟΥ ΤΟΥ ΘΕΡΑΠΕΥΤΗΡΙΟΥ ΕΥΑΓΓΕΛΙΣΜΟΣ

Survivin sirna. Inhibitory effect of small interference RNA targeting survivin nanospheres on human pancreatic carcinoma BXPC-3 cell growth

Διαβητική Νεφροπάθεια. Ηλιάδης Φώτης Επίκουρος Καθηγητής Παθολογίας Διαβητολογίας Α ΠΡΠ, Νοσοκομείο ΑΧΕΠΑ

ΕΦΑΡΜΟΓΗ ΕΥΤΕΡΟΒΑΘΜΙΑ ΕΠΕΞΕΡΓΑΣΜΕΝΩΝ ΥΓΡΩΝ ΑΠΟΒΛΗΤΩΝ ΣΕ ΦΥΣΙΚΑ ΣΥΣΤΗΜΑΤΑ ΚΛΙΝΗΣ ΚΑΛΑΜΙΩΝ

Effects of soothing liver and invigorating spleen recipes of TCM on hepatic inflammatory cytokines of rats with nonalcoholic steatosishepatitis

Free Radical Initiated Coupling Reaction of Alcohols and. Alkynes: not C-O but C-C Bond Formation. Context. General information 2. Typical procedure 2

ΤΕΧΝΟΛΟΓΙΚΟ ΠΑΝΕΠΙΣΤΗΜΙΟ ΚΥΠΡΟΥ ΣΧΟΛΗ ΕΠΙΣΤΗΜΩΝ ΥΓΕΙΑΣ. Πτυχιακή εργασία Η ΚΑΤΑΘΛΙΨΗ ΣΕ ΕΦΗΒΟΥΣ ΜΕ ΣΑΚΧΑΡΩΔΗ ΔΙΑΒΗΤΗ ΤΥΠΟΥ 1

ΙΩΑΝΝΗΣ ΚΛΑΓΚΑΣ. Χημικός, MSc ΔΙΔΑΚΤΟΡΙΚΗ ΔΙΑΤΡΙΒΗ ΥΠΟΒΛΗΘΗΚΕ ΣΤΗΝ ΙΑΤΡΙΚΗ ΣΧΟΛΗ ΤΟΥ ΑΡΙΣΤΟΤΕΛΕΙΟΥ ΠΑΝΕΠΙΣΤΗΜΙΟΥ ΘΕΣΣΑΛΟΝΙΚΗΣ

ATR12181 , , AT1 : R : A : (2007) ATR SHR ( 10 mg kg - 1 d - 1 ) , AT1R c2fos c2jun,

Το Βιολογικό Ρολόι: Θεµελιώδης Ρυθµιστής της Φυσιολογίας των Οργανισµών

MSM Men who have Sex with Men HIV -

Mean bond enthalpy Standard enthalpy of formation Bond N H N N N N H O O O

Longitudinal Changes in Component Processes of Working Memory

ΒΙΟΓΡΑΦΙΚΟ ΣΗΜΕΙΩΜΑ. Όνομα Τίτλος Ημερομηνία γέννησης (μήνας/ημέρα/έτο ς) Παρασκευή Κίτσιου. Ερευνήτρια Β βαθμίδας. B.Sc.

17 min R A (2009) To probe into the thermal property the mechanism of the thermal decomposition and the prospective

Transcript:

ISSN 100727626 CN 1123870ΠQ Chinese Journal of Biochemistry and Molecular Biology 2009 5 25 (5) :465 472 Trx1 HBZY21 MMP9 1),2), 1), 1), 1), 1), 1) 1),3) 3, ( 1), 150081 ; 2), 150086 ; 3), 150081) 1 (thioredoxin1,trx1) 2,. Trx1 (glomerular mesangial cells) HBZY21 9 (matrix metalloproteinase 9, MMP9), Trx1 ; RT2PCR HBZY21 MMP9 mrna ;.,, MMP9 mrna 12 h 24 h 48 h ( P < 0105) ;HBZY21 Trx1,MMP9 mrna MMP9, ( P > 0105), Trx1,, ( P < 0101) ;, 12 h 24 h 48 h ( P < 0101), Trx1 Trx1,, ( P < 0105).,,Trx1 MMP9. Trx1, Trx1. ; 1 ; 9 ; Q51 Effect of Trx1 Overexpression on Expression Level of MMP9 under High Glucose Condition in HBZY21 FANG Shao2Hong 1),2), LIU Xin2Ping 1), J IN Yu2Hong 1), J IA Hui2Jie 1), NA Li2Ying 1), ZHENG Hai2Xia 1) 1),3) 3, ZHOU Hong2Bo ( 1) Department of Biochemistry and Molecular Biology, Harbin Medical University, Harbin 150081, China ; 2) Department of Experimental Research Center, the Second Affiliated Hospital of Harbin Medical University, Harbin 150086, China ; 3) Biotechnology Experimental Center for Teaching, Harbin Medical University, Harbin 150081, China) Abstract Thioredoxin1 (Trx1) is an important thiol disulfide oxidoreductase in the cell,which plays a crucial role in the maintenance of cellular redox homeostasis against oxidative stress. To study the effects of Trx1 over2 expression on matrix metalloproteinase 9 ( MMP9) expression, HBZY21 cells were transfected with either PIRESpuro32sense2Trx1 and PIRESpuro32antisense2Trx1. The Trx1 expression was assayed by RT2PCR and Western blotting. The mrna level of MMP9 and its enzyme activity were determined by RT2PCR and gelatin zymography. The ROS level was detected by flow cytometry. The results showed that the MMP9 mrna and enzyme activity were significantly increased at 12, 24 and 48 hours under high glucose condition ( P < 0105). : 2008212210 ; : 2009203204 (No120062273), (No1060024) 3 Tel : 0451286671684 ; E2mail : hongbozhou67 @yahoo. com. cn Received : December 10,2008 ;Accepted : March 4,2009 Supported by Heilongjiang Health Bureau Foundation (No120062273) and Fund for Young Teachers of Harbin Medical University (No1060024) 3 Corresponding author Tel : 0451286671684 ; E2mail : hongbozhou67 @yahoo. com. cn

466 25 A similar response was showed in antisense2trx1 transfected cells ( P < 0101), but for sense2trx1 transfected cells, no such increase was observed ( P > 0105). The ROS level under high glucose was significantly higher than that under normal glucose at 12, 24, and 48 hours ( P < 0101). In sense2trx1 transfected cells, the ROS level was significantly lower than that in antisense2trx1 transfected cells ( P < 0105). Taken together, the inhibition of MMP9 expression and activity by Trx1 over2expression was regulated by the ROS level under high glucose conditions in HBZY21 cells. This suggests that Trx1 may be applied for the treatment of diabetic nephropathy. Key words diabetic nephropathy ; thioredoxin1 ; matrix metalloproteinase 9 ; reactive oxygen species 1 (thioredoxin1,trx1), 108, 12 kd. Cys2Gly2 Pro2Cys [1 ],.,Trx, [2 4 ]. (diabetic nephropathy,dn),. (extracellular matrix, ECM) DN. ECM. (matrix metalloproteinases,mmps) ECM, ECM [5,6 ], 9 (matrix metalloproteinase 9,MMP9) ECM., MMP9 [7 ]. Trx1,, Trx1 MMP9,., Trx1 MMP9. DN, DN. 1 111 Trizol RT2PCR Lipofectamine TM 2000 Invitrogen ; Trx1 Santa Cruz ; IgG ; ECL plus Amersham ; ROS ; DMEM, RPMI21640 Hyclone ; ; (gelatine) Sigma ;. 112 (HBZY21). :10 % DMEM, 37,5 % CO 2,2 3 d 01125 %,.. :, 60 %, 24 h, G 0, ( 516 mmolπl) ( 2515 mmolπl). 0,. Trx1 PIRESpuro32sense Trx1 PIRESpuro32antisense Trx1 thioredoxin21, David P. Carbone ; JM109. 113 HBZY21 4 10 5 Πml 6, 70 % 90 %, Lipofectamine2000, 250 l 4 g,, 250 l 10 l, 5 min,, 20 min,,,, 6 h,48 h. 114 RT2PCR Trizol mrna. 1 % mrna, mrna. 1 g mrna RT2PCR cdna. cdna PCR ( Table 1). 94 2 min,94 30 s,58 30 s,72 45 s,30 72

5 : Trx1 HBZY21 MMP9 467 Table 1 Primer sequences and annealing temperature in the different groups Gene 3 Primer sequences Amplified fragment lengthπbp Annealing temperatureπ rmmp29 5 2GGGAACGTATCTGGAAATTCG23 5 2CAGAACCGACCCTACAAAGTTG23 520 51 r2actb 5 2CCGTAAAGACCTCTATGCCAACA23 5 2CGGACTCATCGTACTCCTGCT23 94 58 htrx1 5 2GCGAATTCATGGTGAAGCAGATCGAGAG23 5 2GCGGATCCCACGCAGATGGCAACTGGT23 421 58 3 rmmp29 : rat MMl29 ; ractb :rat 2 actin ; htrx1 : human Trx1 10 min. 115 %,. 115 HBZY21, 30 min,12 000 rπmin 15 min,,. 70 g 15 % SDS2PAGE,,5 %, 37 115 h 37 1 h, ECL plus,. Trx1 1 1 000, 1 5 000 ; 1 500, 1 5 000, BIO2RAD GS2800, X, 3, [8 ]. 116 10 g (01125 molπl Tris2HCl, ph 618, 10 %,2 % SDS,0101 % ), 011 % 10 % SDS2PAGE. (215 % Triton X2100,5 mmolπl CaCl 2,1 molπl ZnCl 2, 50 mmolπl Tris2HCl,pH 714) 1 h, ( 1 % Triton X2100, 5 mmolπl CaCl 2, 1 molπl ZnCl 2,50 mmolπl Tris2HCl ph 714) 37, 0135 % ( 25 %, 10 %)., ( PDI Inc,Quantity One,Version 215), 3. 117 1 10 6 HBZY21,, DCFH2DA (DCFH2DA : 1 1 000), 37 30 min. PBS 3 5,, PBS,1 000 rπmin, 10 min., 500 l PBS. 488 nm,525 nm. 118 SPSS1010. P < 0105, t. ( x s ). 2 211 HBZY21 Trx1 HBZY21 Trx1, Trx1 Trx1. RNA, RT2PCR Western.,,RT2PCR, Trx1 Trx1, 421 bp, Trx1, (Fig11A). Western,, Trx1, Trx1 (Fig11B)., Trx1 HBZY21 Trx1. 212 HBZY21 Trx1 MMP9 mrna (NG) ( HG) MMP9 mrna,,12 h HG NG 14610 1113 %, ( P < 0105) ;24 h HG NG 16019 819 %, ( P < 0105) ;48 h HG NG 12718 1316 %, ( P < 0105) ( Fig12A)., MMP9 mrna. Trx1 :, Trx1 ( 1, 2 ),HG MMP9 mrna NG ( P < 0105) ; Trx1 (3,4 ),HG MMP9 mrna NG 16310 1217 %, ( P < 0101) ;

468 25 Fig.1 Transient overexpression of Trx1 gene in HBZY21 cells HBZY21 cells were transfected with PIRESpuro32sense Trx1, PIRESpuro32antisense Trx1 and control. After 24 hours, Trx1 mrna level and protein level were determined by RT2PCR and Western blotting. (A) RT2PCR. 1 : Marker ; 2 : PIRESpuro32sense Trx1 plasmid group ; 3 : PIRESpuro32antisense Trx1 plasmid group ; 4 : Control group. (B) Western blotting. 1 : PIRESpuro32sense Trx1 plasmid group ; 2 : PIRESpuro32antisense Trx1 plasmid group ; 3 : Control group (5,6 ),HG MMP9 mrna NG 13410 1317 %, ( P < 0101)., 1 3 5 MMP9 mrna ( P > 0105) (Fig12B)., Trx1 MMP9 mrna. Fig. 2 The effect of Trx1 overexpression on MMP29 mrna level in HBZY21 cells by RT2PCR (A) MMP9 mrna levels in HBZY21 under normal glucose (NG) and high glucose ( HG) condition for 12,24,48 hours were analyzed by RT2PCR. The data represented mean SD, derived from three independent experiments. 3 P < 0105 vs same time NG group. (B) HBZY21 cells transfected with sense Trx1 plasmid or antisense Trx1 plasmid were treated with normal glucose or high glucose for 48 hours. 1 : Sense Trx1 48 hours NG group ; 2 : Sense Trx1 48 hours HG group ; 3 : Antisense Trx1 48 hours NG group ; 4 : Antisense Trx1 48 hours HG group ; 5 : No transfection 48 hours NG group ; 6 : No transfection 48 hours HG group. The data represented mean SD, derived from three independent experiments. 3 P < 0101 vs transfection antisense Trx1 48 hours NG group, # P < 0101 vs no transfection 48 hours NG group 213 HBZY21 Trx1 MMP9, 12 h HG NG 16418 1817 %, ( P < 0101),24 h HG NG 16316 1214 %, ( P < 0101),48 h HG NG 13710 917 %, ( P < 0101) (Fig13A).,48 h MMP9. Trx1, HG MMP9 NG 10310 1315 %, ( P > 0105) ; Trx1, HG MMP9 NG 13711 1116 %,

5 : Trx1 HBZY21 MMP9 469 ( P < 0101) ;,HG MMP9 NG 12210 1412 %, ( P < 0101).,1 3 5 MMP29, ( P > 0105) (Fig13B)., Trx1 MMP9. Fig. 3 The effect of Trx1 overexpression on gelatinic activity of MMP9 in HBZY21 by gelatin zymography (A) Gelatinic activities of MMP9 in the supernatant in HBZY21 under high glucose ( HG) condition were analyzed by gelatin zymography. The data represented mean SD,derived from three independent experiments. 3 P < 0101 vs same time normal glucose (NG) group. (B) HBZY21 cells transfected with sense Trx1 plasmid or antisense Trx1 plasmid were treated with NG or HG condition for 48 hours. 1 : Sense Trx1 plasmid 48 hours NG group ; 2 : Sense Trx1 plasmid 48 hours HG group ; 3 : Antisense Trx1 plasmid 48 hours NG group ; 4 : Antisense Trx1 plasmid 48 hours HG group ; 5 : No transfection 48 hours NG group ; 6 : No transfection 48 hours HG group. The data represented mean SD, derived from three independent experiments. 3 P < 0101 vs transfection antisense Trx1 48 hours NG group, # P < 0101 vs no transfection 48 hours NG group 214 Trx1 HBZY21, 12 24 48 h, ROS ( P < 0101) (Fig14A). HBZY21 Trx1 ROS, NG, HG ROS, ( P < 0105) ; HBZY21 Trx1 Trx1 ROS, ( P < 0105). Trx1 ( P > 0105) (Fig14B). 3.., DN. MMPs, Gly2X(Leu Ile ), ECM,.,. MMP9, MMPs, [9 ].,, MMP9, MMP9 ECM [10 ]., MMP9.,HBZY21 12 48 h,mmp9, MMP2, [11 ]. [11 ], MMP9 ( B), MMP2 ( A), MMP9. Hirakawa [12 ],MMP9 CA DN. Trx1 MMP9

470 25 Fig. 4 The effect of Trx1 overexpression on intracellular ROS in HBZY21 cells by flow cytometry HBZY21 were treated with normal glucose (NG) or high glucose ( HG) condition for 48 hours, and intracellular ROS were detected by oxidation2sensitive fluorescent probe (DCFH2DA) with FACScan flow cytometer. (A) The effects of HG condition on intracellular ROS in HBZY21 by flow cytometry. The data represented mean SD, derived from three independent experiments. 3 P < 0101 vs NG group. (B) HBZY21 cells transfected with sense Trx1 plasmid or antisense Trx1 plasmid were treated with normal glucose or high glucose for 48 hours. The data represented mean SD,derived from three independent experiments. 3 P < 0105 vs NG group, # P < 0105 vs transfection sense Trx1 group

5 : Trx1 HBZY21 MMP9 471, Trx1,. : Trx1 Trx1 100 %, Trx1 Trx1 100 %, Western Trx1 Trx1, Trx1 Trx1,,.,, Trx1 HBZY21 MMP9 mrna, ; Trx1, MMP9mRNA.,Trx1 HBZY21 MMP9, Trx1. Trx1 MMP9?,.,, (H 2 O 2 ) (O - 2 ) (OH - ), Π,. C(protein kinase C,PKC) (mitogen activated protein kinase,mapk) 2 B ( nuclear factor kappab,nf2 B) 2l (activated protein l,ap21),,,, [13 15 ]. [16 ], 6 12, SOD CAT GSH2Px. Uemura [7 ], ( N2 ) MMP9,., HBZY21 MMP9., Trx1 MMP9? ROS, 12 h 48 h, ROS., ROS., HBZY21 Trx1 MMP9, ROS., Trx1 HBZY21 MMP9., Trx1.,,,, MMP9,.,,. ( References) [ 1 ] Tamura T, Stadtman T C. A new selenoprotein from human lung adenocarcinoma cells : purification, properties, and thioredoxin reductase activity[j ]. Proc Natl Acad Sci U S A,1996,93(3) :10062 1011 [ 2 ] Tomlinson D R. Mitogen2activated protein kinases as glucose transducers for diabetic complications [ J ]. Diabetologia, 1999, 42 (11) :127121281 [ 3 ] Arnold N B,Ketterer K,Kleeff J, et al. Thioredoxin is downstream of Smad7 in a pathway that promotes growth and suppresses cisplatin2 induced apoptosis in pancreatic cancer [ J ]. Cancer Res, 2004, 64 (10) :359923606 [ 4 ] Lovell M A, thioredoxin21 Xie C, Gabbita S P, et al. Decreased thioredoxin and increased thioredoxin reductase levels in Alzheimerπs disease brain[j ]. Free Radic Biol Med,2000,28(3) :4182427 [ 5 ] Murphy G, Docherty A J. The matrix metalloproteinases and their inhibitors[j ] Am J Respir Cell Mol Biol, 1992, 7 (2) :1202125 [ 6 ],,,. 29 2 1 [J ]. (Ding Zhi2Min,Wu Jian2Xin, Li Yuan2Yuan, et al. Clinical study of matrix metalloproteinase29 and transforming growth factor2 1 related with diabetic nephropathy[j ]. Chin J Diabetes),2003,11 (5) :3212323 [ 7 ] Uemura S,Matsushita H, Li W, et al. Diabetes mellitus enhances vascular matrix metalloproteinase activity : role of oxidative stress [J ]. Circ Res, 2001,88(12) :129121298 [ 8 ],,,. Grx1 HEK293T H 2 O 2 p38mapk [J ]. ( Zou Chao2Xia, Li Qiang, Liu Ying2Ying, et al. Grx1 overexpression inhibited activation of P38 MAPK signal transduction pathway induced by H2O2 in HEK293T cells[j ]. Chin J Biochem Mol Biol),2008,24 (6) :5372542 [ 9 ] Massova I, Kotra L P, Fridman R, et al. Matrix metalloproteinases structures, evolution, and diversification [ J ]. FASEB J, 1998, 12 (12) :107521095 [10 ] Bai Y,Wang L,Li Y, et al. High ambient glucose levels modulates the production of MMP29 and alpha5 ( ) collagen by cultured podocytes [J ]. Cell Physiol Biochem,2006,17 (122) : 57268 [11 ],,,. ERK1Π2 B [J ]. (Bai Ya2Ling, Huang Hai2

472 25 Chang,Li Jing2Zi,, et al. High glucose regulates the production of MMP9 in podocyte through ERK1Π2 signal pathway[j ]. Natl Med J China),2005,85 (21) :145121455 [12 ] Hirakawa S,Lange E M, Colicigno C J, et al. Evaluation of genetic variation and association in the matrix metalloproteinase 9 (MMP9) gene in ESRD patients[j ]. Am J Kidney Dis,2003,42(1) :1332142 [13 ] Ha H, Lee H B. Reactive oxygen species as glucose signaling molecules in mesangial cells cultured under high glucose [J ]. Kidney Int (Suppl), 2000, 77 : S19225 [14 ] Scivittaro V,Ganz M B,Weiss M F. AGEs induce oxidative stress and active protein kinase C2beta ( ) in neonatal mesangial cells[j ]. Am J Physiol Renal Physiol,2000,278(4) :6762683 [15 ] Suzuki S, Hinokio Y, Komatu K, et al. Oxidative damage to mitochondrial DNA and its relationship to diabetic complications[j ]. Diabetes Res Clin Pract,1999,45 (223) :1612168 [16 ],,,. 2 [J ]. (Chen Ling, Jia Ru2 Han, Ding Guo2Hua, et al. Renal protection of valerian oil and its mechanism in type 2 diabetic rats[j ]. Chin J Nephrol),2003,19(3) : 1682172 RNA, ( RNA ), 50. RNA.,,. :,. David M. Brown RNA,. RNA, RNA., OPKO Health Allergan RNA ; RNA (VEGF),. 5, Ambati VEGF RNA,.,Ambati TLR3.,,. 600 TLR3., TLR3,., TLR3,., RNA, TLR3.., RNA TLR3,,,. OPKO Sam Reich. OPKO 400, 200 2 ;, 600,., RNA,.,Brown TLR3, TLR3,.. ( Nature News,2008,doi :10. 1038Πnews. 2008. 1065, )