ISSN 1007-7626 CN 11-3870 / Q http / / cjbmb bjmu edu cn Chinese Journal of Biochemistry and Molecular Biology 2011 2 27 2 168 ~ 173-3- TNF-α IL-β * 453002 -α tumor necrosis factor-αtnf-α -1β interleukin-1βil-1β II RT-PCR ELISA Tnf-α mrna Il-1β mrna TNF-α IL-1β -3- EGCG TNF-α IL-1β 0 2 mg / g EGCG 12 h Tnf-α mrna TNF-α 24 h Il-1β mrna IL-1β 0 2 mg / g EGCG TNF-α IL-1β -3- -α -1β Q249Q786R318 Epigallocatechin-3-gallate Inhibits Expression of Tumor Necrosis Factor-α and Interleukin-1β During Skin Scald Repair in Mice ZHANG Jiang-JiangJIA Yong-FangLI Jia-WenZHANG Ya-Jie WANG Kun-YingLI Wei-Guo * School of Life SciencesHenan Normal UniversityXinxiang 453002HenanChina Abstract The cytokinestumor necrosis factor-α TNF-α and interleukin-1β IL-1β play a vital role in wound healing In the present studylevels of both Tnf-α mrna and Il-1β mrna were analyzed with reverse transcription polymerase chain reaction RT-PCR and both TNF-α and IL-1β were detected with enzyme-linked immunosorbent assay ELISA in the mice skin model with full-thickness second-degree scaldto understand the effect of epigallocatechin-3-gallate EGCG a main constituent of green tea polyphenolson the expression of TNF-α and IL-1β during skin scald repair The results showed thatafter the scald injury skin were treated with 0 2 mg / g EGCGthe levels of both Tnf-α mrna and TNF-α declines at post-scald for 12 hoursand both Il-1β mrna and IL-1β decrease at postscald for 24 hours The data suggested that 0 2 mg / g EGCG inhibits the expression of Tnf-α and Il-1β geneand attenuates inflammatory reaction at scald injury skin ThusEGCG contributes to the scald injury skin repair Key words epigallocatechin-3-gallate EGCG tumor necrosis factor-α TNF-α interleukin-1β IL- 1β scald 2010-10-29 2010-12-17 No 0624410029 No 2010A180011 No 08S044 * Tel 0373-3326878 E-mail liwg0618@ htu cn Received October 29 2010 Accepted December 17 2010 Supported by Program of Sciences and Technology of Henan Province No 0624410029 Natural Sciences Basic Research Plan of Educational Bureau in Henan Province No 2010A180011 Science and Technology Development Plan Project of Xinxiang City No 08S044 * Corresponding author Tel 0373-3326878 E-mail liwg0618@ htu cn
2-3- TNF-α IL-β 169 0 2 mg / g EGCG 4 MEBO cdna Promega RNA 2 Taq plus PCR MasterMix -α tumor necrosis factor-αtnf-α PCR -1β interleukin-1βil-1β 66 TNF-α IL-1β 25 ± 2 g 12 h 12 h 1 MEBO EGCG 1 ~ 6-3- epigallocatechin- 24 h 3-gallateEGCG 7-9 EGCG IL-1 TNF 1 cm 8 s 10 BALB /3T3 II Tnf-α TNF-α IL-1β IL-10 11 HT29 T84 TNF-α 12 MEBO 2 / d EGCG HMC-1 0 2 mg / g EGCG extracellular signal-regulated kinaseerk1 /2 16 2 / d -κb nuclear factor-κbnf-κb TNFα 13 EGCG 1 2 IL-1β 14 lipopolysaccharidelps IL-1β EGCG 15 EGCG 6 12 24 48 120 240 TNF-α IL-1β 336 h TNF-α IL-1β 1 5 cm 1 5 cm EGCG Il-1β 1 g IL-1β 16 TNF-α IL-1β 1 3 RT-PCR Tnf-α Il-1β reverse mrna transcription polymerase chain reactionrt-pcr TRIzol RNA A 260 A 28 0 enzyme-linked immunosorbent assayelisa EGCG RNA RNA TNF-α IL-1β EGCG 2 μg oligo dt 1 8 2 μl M-MLV 1 μl 200 U 5 5 μl 1 3 21 RNA 0 5 μl 25 U dntp 1 25 μldepc 25 μl cdna 1 1 Tnf-α Il-1β β-actin -3- EGCG Table 1 PCR 98% cdna 2 μl 20 μmol / L Sigma EGCG 0 2 μl 2 Taq plus PCR MasterMix 10 μl
170 27 20 μl 94 5 min Tnfα 8 min Il-1β 94 45 s 52 β-actin 56 45 s 72 60 s Tnf-α 45 s Il-1β 30 β-actin 28 72 5 min Tnf-α 8 min Il-1β PCR Tnf-α mrna TNF-α 1 5% ChampGel TM 12 h Tnf-α mrna Tnf-α mrna 8 ~ 10 TNF-α Il-1β mrna Genetools 3 57 ng / L Tnf-α mrna TNF-α β-actin mrna 240 h Tnf-α IL-1β Table 1 in mice Primer sequences of Tnf-αIl-1β and β-actin gene Gene Primer sequence 5-3 Tnf-α Il-1β Forward GGCAGGTCTACTTYGGAGTCATYGC Reverse ACATTCGAGGCTCCAGTGAATTCGG Forward ATTGTGGCTGTGGAGAAG Reverse TTGTGAGGTGCTGATGTA β-actin Forward Reverse TCATCACTATTGGCAACGAGC AACAGTCCGCCTAGAAGCAC PCR product length / bp 443 531 399 Tnf-α mrna were analyzed with RT-PCRand levels of 1 4 ELISA TNF-α IL-1β tissue TNF-α were detected with ELISA The black graph 400 mg 1 1 PBS ph7 4 their β-actin mrna controls The dotted graph represents 50% 4 the levels of TNF-α The data present the mean ± S D 3 000 r / min 20 min RD derived from three independent experiments P < 0 01 TNF-α IL-1β ELISA compared with before skin scald injury or 0 h 450 nm A A 2 2 IL-1β TNF-α IL-1β A 2 TNF-α Fig 1 14 d Tnf-α mrna TNF-α 6 12 24 48 120 h Tnf-α mrna TNF-α Fig 1 Levels of both tissue Tnf-α mrna and TNF-α during scalded skin repair in mice In the skin model with full-thickness second-degree scaldlevels of tissue represents the relative density ratios of Tnf-α mrna to RT-PCR ELISA 1 5 Il-1β mrna ± x 珋 ± s IL-1β Fig 2 SPSS 14 0 one-way 14 d Il-1β mrna ANOVA Excel P < 0 05 IL-1β 24 h 120 h P < 0 01 2 14 d Il-1β mrna IL-1β Il-1β mrna IL-1β 2 1 TNF-α 6 12 24 h 24 h Il-1β mrna RT-PCR ELISA 8 IL-1β 4 120 ng / L Tnf-α mrna Il-1β mrna IL-1β
2-3- TNF-α IL-β 171 48 h Il-1β mrna 2 ~ 3 IL-1β 50 ng / L Il-1β mrna IL- 1β 120 h Il-1β mrna 7 IL-1β 110 ng / L 14 d Il-1β mrna IL-1β Fig 2 Levels of both tissue Il-1β mrna and IL-1β during scalded skin repair in mice Ievels of tissue Il- 1β mrna were analyzed with RT-PCRand levels of tissue IL-1β were detected with ELISA The black graph represents the relative density ratios of tissue Il-1β mrna to their β-actin mrna controls The dotted graph represents the levels of tissue IL-1β The data present the mean ± S D derived from three independent experiments P < 0 01compared with before skin scald injury or 0 h Fig 3 Effect of 0 2 mg / g EGCG on levels of tissue Tnf-α mrna in scalded skin in mice In the scalded skin modelthe scald sites were treated with 0 2 mg / g EGCG Levels of tissue Tnf-α mrna were analyzed with RT-PCR A was electrophoresis bandand the numbers represent the time post skin scalded B was histogram of ratio of density value P < 0 01compared with control group 2 3 EGCG TNF-α RT-PCR 0 2 mg / g EGCG Tnfα mrna Fig 3 14 d 12 h 120 h EGCG Tnf-α mrna 240 h EGCG Tnf-α mrna Fig 4 Effect of 0 2 mg / g EGCG on level of tissue EGCG Tnf-α TNF-α in scald injury skin in mice In the scalded mrna skin modelthe scald sites were treated with 0 2 mg / g ELISA 0 2 mg / g EGCG Levels of tissue TNF-α were detected with ELISA EGCG TNF-α * P < 0 05and P < 0 01compared with control group Fig 4 14 2 4 EGCG IL-1β d 12 h EGCG RT-PCR TNF-α 0 2 mg / g EGCG Il-1β 240 h mrna Fig 5 TNF-α EGCG 14 d 6 h 12 h TNF-α EGCG Il-1β mrna EGCG TNF-α
172 27 12 h 24 h 240 h EGCG Il-1β mrna Fig 6 Effect of 0 2 mg / g EGCG on level of tissue IL-1β in scald injury skin in mice In the scalded skin model the scald sites were treated with 0 2 mg / g EGCG Levels of tissue IL-1β were detected with ELISA * P < 0 05and P < 0 01compared with control group Fig 5 Effect of 0 2 mg / g EGCG on level of tissue Il-1β compared with control group α IL-1β TNF-α IL-1β 217 ~ 20 TNF-α IL-1β TNF-α Tnf-α mrna TNF-α 12 h Tnf-α mrna TNF-α IL-1β Il-1β mrna IL-1β 24 h 120 h 24 h Il-1β mrna IL- 1β 8 4 120 h Il-1β mrna IL-1β 7 4 TNF-α IL-1β mrna in scald injury skin in mice In the scalded skin modelthe scald sites were treated with 0 2 mg / g EGCG Levels of tissue Il-1β mrna were analyzed with RT- PCR A was electrophoresis bandand the numbers represent the time post skin scalded B was histogram of ratio of density value * P < 0 05and P < 0 01 ELISA TNF-α 0 2 mg / g EGCG IL-1β 15 IL-1β Fig 6 14 d 6 h 12 h 2 ~ EGCG IL-1β 4 TNF-α 12 h 24 h IL-1β EGCG IL-1β 120 h 240 h EGCG IL-1β EGCG MEBO IL-1β EGCG 3 MEBO EGCG MEBO TNF- 0 2 mg / g EGCG 12 h
2-3- TNF-α IL-β 173 Tnf-α mrna 200857 10 472-478 MEBO EGCG Tnf-α EGCG MEBO Tnf-α MEBO EGCG 12 h Il-1β mrna 24 h Il-1β mrna MEBO EGCG Il-1β TNF-α IL-1β Tnf-α Il-1β TNF-α IL-1β References 1 Feiken ER mer JEriksen Jet al Neutrophils express tumor necrosis factor-alpha during mouse skin wound healing J J Invest Dermatol1995105 1 120-123 2 Grellner WGeorg TWilske J Quantitative analysis of proinflammatory cytokines IL-1βIL-6TNF-α in human skin wounds J Forensic Sci Int2000113 1-3 251-264 3 Gillitzer RGoebeler M Chemokines in cutaneous wound healingj J Leukoc Biol200169 4 513-521 4 Werner SGrose R Regulation of wound healing by growth factors and cytokinesj Physiol Rev200383 3 835-870 5 Noel GGuo XWang Qet al Postburn monocytes are the major producers of TNF-α in the heterogeneous splenic macrophage population J Shock200727 3 312-319 6 Weinstein D AKirsner R S Refractory ulcers the role of tumor necrosis factor-α J J Am Acad Dermatol201063 1 146-154 7 Tipoe G LLeung T MHung M Wet al Green tea polyphenols as an anti-oxidant and anti-inflammatory agent for cardiovascular protectionj Cardiovasc Hematol Disord Drug Targets20077 2 135-144 8 Navarro-Perán ECabezas-Herrera JSánchez-Del-Campo Let al The anti-inflammatory and anti-cancer properties of epigallocatechin-3-gallate are mediated by folate cycle disruption adenosine release and NF-kappaB suppressionj Inflamm Res 9 Singh RAkhtar NHaqqi T M Green tea polyphenol epigallocatechin-3-gallate inflammation and arthritisj Life Sci201086 25-26 907-918 10Sakagami HTakeda MSugaya Ket al Stimulation by epigallocatechin gallate of interleukin-1 production by human peripheral blood mononuclear cells J Anticancer Res1995 15 3 971-974 11Suganuma MSueoka ESueoka Net al Mechanisms of cancer prevention by tea polyphenols based on inhibition of TNF-α expressionj Biofactors200013 1-4 67-72 12Porath DRiegger CDrewe Jet al Epigallocatechin-3-gallate impairs chemokine production in human colon epithelial cell lines J J Pharmacol Exp Ther2005315 3 1172-1180 13Shin H YKim S HJeong H Jet al Epigallocatechin-3-gallate inhibits secretion of TNF-αIL-6 and IL-8 through the attenuation of ERK and NF-κB in HMC-1 cellsj Int Arch Allergy Immunol2007142 4 335-344 14Wheeler DSCatravas JDOdoms Ket al Epigallocatechin-3- gallatea green tea-derived polyphenolinhibits IL-1betadependent proinflammatory signal transduction in cultured respiratory epithelial cellsj J Nutr2004134 5 1039-1044 15Pajonk FRiedisser AHenke Met al The effects of tea extracts on proinflammatory signalingj BMC Med20064 28 16-1β J Shen YujiaLi WeiguoZhang Huiet al Effects of - epigallocatechin-3-gallate on interleukin-1β expression in mouse wound healingj J Mol Cell Biol 200942 3-4 179-185 17Bryan DWalker K BFerguson Met al Cytokine gene expression in a murine wound healing model J Cytokine 200531 6 429-438 18Agay DAndriollo-Sanchez MClaeyssen Ret al Interleukin- 6TNF-α and interleukin-1β levels in blood and tissue in severely burned ratsj Eur Cytokine Netw200819 1 1-7 19Finnerty C CPrzkora RHerndon D Net al Cytokine expression profile over time in burned micej Cytokine2009 45 1 20-25 20Schwacha M GThobe B MDaniel Tet al Impact of thermal injury on wound infiltration and the dermal inflammatory response J J Surg Res2010158 1 112-120