1226 CN 3421206ΠR, ISSN 100922501 E2mail :ccpt96 @21cn. com 2007 Nov ;12 (11) :1226-1230 ATR12181,,,,,, 430022, : I (AT1) ATR12181 (SHR) : AT1 ATR12181 SHR WISTAR, SHR ( 10 mg kg - 1 d - 1 ),,ELISA ( ESRD),RT2PCR AT1R [1 ], c2fos c2jun :ATR12181 SHR,20 (145 8) mm Hg (1 mm Hg = 0. 133 kpa), SHR I (AT1) (197 mm Hg 8 mm Hg, P < 0. 05), ATR12181 (139 mm Hg 17 mm Hg, P > 0. 05) ;WISTAR (SHR),, (116 mm Hg 6 mm Hg) ATR12181 SHR 1, AT1R c2fos c2jun, ( P > 0. 05), SHR ( P < 1. 1 (tetanus toxoid, 0. 05) WISTAR TT), ; ( : AT1 ATR12181 ) ;( ) ;0. 3 % SHR, ( ) ; PBS ( ) ;(, ) ;(SPI bio ) ;RT2PCR (Takara ) ;ATR12181 ; 1. 2 SSM28 ( shimadzu ;, ),RMS2 ( ),( Bio2tek ),721 ( 2007203210 2007210229 (30300133),,, : Tel : 027263757216 E2mail : Weifen2002 @hotmail. com,,,,, Tel : 027285726013 E2mail : liaoyh27 @163. com : R392. 11 : A : 100922501 (2007) 1121226205,,, ),8022 ( ),( Sigma ), PCR ( Biometra ),DYY2III8B (), GDS8000 HMIAS22000 ( UVP ), ZF290 ( )
2007 Nov ;12 (11) 1227 1. 3 Wistar,4,,, :192050 ;SHR,4,,, : SCXK 20022 0001,,, 26 5 ( n = 6) : WISTAR ( WISTAR2C ) 1,, ATR12181 WISTAR ( WISTAR2I ), ATR12181 SHR ( SHR2I ) SHR (SHR2C ) SHR (SHR2L ) 1. 4 AT1 ATR12181,PSSM28, > 95 %, [2 ] (10gΠ),0. 3 % TT, (, ) SHR (6 ) 0 2 4 8 12 16 20 AT1R12181,WISTAR2C ;SHR2L (10 mg kg - 1 d - 1 ), 1 1. 5 7 d, 0. 5 ml,1 000 rπmin ELISA ATR12181 : ATR12181 0. 1 mmolπl (ph 9. 6), 100gΠmL,4 1 %PBS, 37 2 h,pbs 3, 1 100,37 2 h,pbs 3, 1 2000 37 1 h,(tmb), 2 molπl, 1 PCR 450 nm ( OD ),OD, [ ( A - A )Π( A - A ) ] 2. 1 1. 6 4,, 3, 1. 7 12, 2 d, 24 h, 24 h 3 000 rπmin 15 min, 1 ml, ependooff, - 70 (SPI bio ), 1 000 500 250 125 62. 5 31. 25 15. 63 7. 81gΠL,,24 h,24 h 1. 8 RT2PCR AT1 c2fos c2jun [4 ] RNA, 100 mg Trizol 1 ml,a 280 A 260 A 280 RNA, RNA 1 gπl, 1. 80 PCR 20 L,, Oligo (dt), PCR 1, [36 ], 40 s, 40 s, 1 min,pcr 2 %,,,GAPDH,GAPDH mrna ( ) (bp) GAPDH 33 56. 8 516 :5AATGCATCCTGCACCACCAA3 :5GTAGCCATATTCATTGTCATA3 AT1R 33 60. 0 348 :52TCCACCCAATGAAGTCTCGCCT3 :52GCACAATCGCCATAATTATCC3 c2fos 40 54. 4 80 :5GGGACAGCCTTTCCTACTACCATT3 :5CGCAAAAGTCCTGTGTGTTGA3 c2jun 32 53. 2 290 :5TAGTCCCTCCCGTCTGGTTG 3 :5TCTAGGAGTCGTCAGAATCC 3
1228 Chin J Clin Pharmacol Ther 2007 Nov ;12 (11) 1. 9 ( x s),t, SPSS 10. 0, P < 0. 05 2 ( P < 0. 05) ;, ATR12181 SHR2C,SHR ATR12181,24 h (3) 2. 1 AT1 ATR12181 SHR 6,,50gΠ, 2 1, 4 1, 0 2 4 8 12 16 20 ATR12181 SHR,16 WISTAR 4 (1) 2 1 ATR12181 2. 2 AT1 ATR12181 SHR 6, 200 mm Hg (1 mm Hg = 0. 133 kpa) 4,SHR2C,SHR2I 4, 150 mm Hg,SHR2C ( P < 0. 05),( P > 0. 05) WISTAR, (2) 2. 3 AT1 24 h SHR2C 24 h WISTAR2C ;SHR2L SHR2I SHR2C,24 h, 3 ATR12181 24 h ( x s, n = 6) SHR2C b P < 0. 05 2. 4 AT1 ATR12181 AT1 R c2fos c2jun mrna SHR,AT1R c2fos c2jun mrna, WISTAR2C ( P < 0. 05) ; SHR2L SHR2I AT1R c2fos c2jun mrna SHR2C, ( P < 0. 05),SHR2L SHR2I, WISTAR2C ( P < 0. 05) WIST2 AR2I WISTAR2C (4)
2007 Nov ;12 (11) 1229 4 AT1R c2jun c2fos mrna WISTAR2C b P < 0. 05 ;SHR2C e P < 0. 05 3, [7 ] -,II(Ang II),, Π, (ACEI) Ang II (ARB) Ang II [8 ] Ang II,Ang II (ATR) AT1R AT2R AT4R, AT1R [9 ] AT1R G,, AT1R ATR12181, SHR,AT1R, AT1R, Ang II AT1R,,,: (1), Ang II,,, ; (2) AT1R, Ang II, (3) AT1R, c2fos c2jun,,, ATR12181 WISTAR, AT1,ATR12181, 1 Bauduceau B, Genes N, Chamontin B, et al. Ambulatory blood pressure and urinary albumin excretion in diabetic (non2insulin2 dependent and insulin2dependent) hypertensive patients : rela2 tionships at baseline and after treatment by the angiotensin con2 verting enzyme inhibitor trandolapril [ J ]. Am J Hypertens, 1998 ;11 :1065-1073. 2 Luo YS,Liao YH,Wang M, et al. Experiment study of AT12re2 ceptor peptide induced myocardial immune damage in rats[j ]. J Tongji Med university,2001 ;3 :202-204. 3,,,. II - 1 mrna [J ].,1998 ;650 :303-308.
1230 Chin J Clin Pharmacol Ther 2007 Nov ;12 (11) 4 Lu C, Schwartzbauer G, Sperling MA, et al. Demonstration of Direct effects of growth hormone on neonatal cardiomyocytes[j ]. J Biol Chem, 2001 ;276 :22892-22900. 5,,,. [J ]., 2003 ;38 :348-350. 6,,,. II mrna [J ].,2002 ;7 19 :311-313. 7 Lin Q, Ruan SW, Xu Sf, et al. Combined urinary microprotein and urinary enzyme for diagnosis of early renal disease[j ]. Chin J Med Lab Sci, 1999 ;22 :30-32. 8 Neumann J, Ligtenberg G, Klein IH, et al. Sympathetic hyper2 activity in hypertensive chronic kidney disease patients is re2 duced during standard treatment [J ]. Hypertension, 2007 ; 49 : 506-510. 9 Paul M, Poyan Mehr A, Kreutz R. Physiology of local renin2an2 giotensin systems[j ]. Physiol Rev, 2006 ;86 :747-803. ATR12181 vaccine in reducing microalbuminuria of spontaneously hyper2 tensive rat WEI Fen, LIAO Yu2hua, LI Liu2dong, ZHOU Zi2hua, WANG Bin, WANG Min Institute of Cardiology, Union Hospital, Tongji Medical College, Huazhong University of Science & Technology, Wuhan 430022, Hubei, China ABSTRACT AIM : To evaluate effect of active immu2 nization with peptide ATR12181 from the extracellular parts of AT1 receptor on reducing microalbuminuria of SHRs. METHODS : SHRs and Wistar rats were immu2 nized actively by ATR12181, the synthesized peptide from the extracellar part of AT1 receptor. Another SHR group was given Losartan (10 mg kg - 1 d - 1 ) orally by gastric gavage once a day in morning. The specific serum anti2 body titer and 24h urinary albumin excretion were detect2 ed by ELISA, the Systolic Blood Pressure (SBP) of SHR was measured consecutively, and the mrna of AT1R, c2 fos, c2jun in kidney were measured by RT2PCR. RE2 SULTS : The antibodies to ATR12181 were detected both in immulized SHRs ( SHR2I) and WISTAR rats ( WIST2 AR2I). At 20 weekends, SHR2I group got a lower SBP ( 145 mm Hg 8 mm Hg ) than SHR2C group (197 mm Hg 8 mm Hg), but no significant difference compared with the SHR2L group ( 139 mm Hg 17 mm Hg, P > 0. 05). The SBP of WISTAR2I group was normal (116 mm Hg 6 mm Hg). 24 h urinary al2 bumin excretion both in SHR2I group and SHR2L group were significantly lower than that of SHR2C group ( P < 0. 05) ; The mrna of the AT1R, c2fos, c2jun were signif2 icantly lower in SHR2I group and SHR2L group. CON2 CL USION: ATR12181 vaccine may produce high titer antibody, that reduce the blood pressure, and decrease urinary protein excretion in SHR. KEY WORDS spontaneously hypertensive rats ; ATR12181 vaccine ; kidney ; microalbuminuria :