(MACF1) Association of Microtubule Actin Crosslinking Factor 1 with Cytoskeleton in Osteoblast

Σχετικά έγγραφα
Correction of chromatic aberration for human eyes with diffractive-refractive hybrid elements

Resurvey of Possible Seismic Fissures in the Old-Edo River in Tokyo

High mobility group 1 HMG1

The toxicity of three chitin synthesis inhibitors to Calliptamus italicus Othoptera Acridoidea

Vol. 31,No JOURNAL OF CHINA UNIVERSITY OF SCIENCE AND TECHNOLOGY Feb

α 1 2- Cloning and Expression of alpha 1 2-fucosyltransferase in E. coli BIOTECHNOLOGY BULLETIN

Studies on the Binding Mechanism of Several Antibiotics and Human Serum Albumin

Antimicrobial Ability of Limonene, a Natural and Active Monoterpene

[11].,, , 316 6, ,., 15.5%, 9.8%, 2006., IDF,, ,500, 2,830.,, ,200.,,, β, [12]. 90% 2,,,,, [13-15].,, [13,

Μελέτη της έκφρασης του ογκοκατασταλτικού γονιδίου Cyld στον καρκίνο του μαστού

Quick algorithm f or computing core attribute

MSM Men who have Sex with Men HIV -

IL - 13 /IL - 18 ELISA PCR RT - PCR. IL - 13 IL - 18 mrna. 13 IL - 18 mrna IL - 13 /IL Th1 /Th2

0. 35g kg ~ 2. 0cm 10min. Nar- 15μL 6mm

TGFp FSH INH INH

Study on the Strengthen Method of Masonry Structure by Steel Truss for Collapse Prevention

Differences in Contents of Neutral Aroma Components and Sensory Evaluation in Air-cured Burley Leaves from Different Curing Barns

Apr Vol.26 No.2. Pure and Applied Mathematics O157.5 A (2010) (d(u)d(v)) α, 1, (1969-),,.

Optimizing Microwave-assisted Extraction Process for Paprika Red Pigments Using Response Surface Methodology

2 PbO 2. Pb 3 O 4 Sn. Ti/SnO 2 -Sb 2 O 4 -CF/PbO x SnO 2 -Sb PbO 2. Sn-Sb 1:1. 1 h. Sn:Sb=10:1. PbO 2 - CeO 2 PbO 2. [8] SnO 2 +Sb 2 O 4 _

Mouse Gene 2.0 ST Array Shn3. Runx2 Shn3. Runx2 Shn3 Runx2. adult. (Schnurri, Shn)3/Hivep3. Runx2 Shn/Hivep. ST2 BMP-2 Shn3

Inhibition of mushroom tyrosinase by flavonoid from Sorbus tianschanica Ruper in Xinjiang

Extract Isolation Purification and Identification of Polysaccharides from Exocarp of Unripe Fruits of Juglans mandshurica

Research Papers. TNF-α. L929 LPS Carswell [1] BCG. pet-41d TNF).TNF. NEB TNF-α cdna Invitrogen DNA. 75 ku TNF TransTaq High %

Wiki. Wiki. Analysis of user activity of closed Wiki used by small groups

c Key words: cultivation of blood, two-sets blood culture, detection rate of germ Vol. 18 No

Comparison of HPLC fingerprint between enzymatic Calculus bovis and natural Calculus bovis

Supporting information. An unusual bifunctional Tb-MOF for highly sensing of Ba 2+ ions and remarkable selectivities of CO 2 /N 2 and CO 2 /CH 4

A facile and general route to 3-((trifluoromethyl)thio)benzofurans and 3-((trifluoromethyl)thio)benzothiophenes

A summation formula ramified with hypergeometric function and involving recurrence relation

Φαινομενολογία και γενετική ταξινόμηση της πρωτοπαθούς δυστονίας - Νεώτερα δεδομένα

Electronic Supplementary Information

ΙΠΛΩΜΑΤΙΚΗ ΕΡΓΑΣΙΑ. ΘΕΜΑ: «ιερεύνηση της σχέσης µεταξύ φωνηµικής επίγνωσης και ορθογραφικής δεξιότητας σε παιδιά προσχολικής ηλικίας»

ΤΕΧΝΟΛΟΓΙΚΟ ΠΑΝΕΠΙΣΤΗΜΙΟ ΚΥΠΡΟΥ ΣΧΟΛΗ ΕΠΙΣΤΗΜΩΝ ΥΓΕΙΑΣ ΤΜΗΜΑ ΝΟΣΗΛΕΥΤΙΚΗΣ ΠΤΥΧΙΑΚΗ ΕΡΓΑΣΙΑ ΕΠΗΡΕΑΖΕΙ ΤΗΝ ΠΡΟΛΗΨΗ ΚΑΡΚΙΝΟΥ ΤΟΥ ΜΑΣΤΟΥ

Biapenem BIPM Lot No g mg

( ) , ) , ; kg 1) 80 % kg. Vol. 28,No. 1 Jan.,2006 RESOURCES SCIENCE : (2006) ,2 ,,,, ; ;

LUO, Hong2Qun LIU, Shao2Pu Ξ LI, Nian2Bing

Approximation Expressions for the Temperature Integral

Gro wth Properties of Typical Water Bloom Algae in Reclaimed Water

Cellular Physiology and Biochemistry

Supporting Information

ER-Tree (Extended R*-Tree)

Accumulation of Soil Arsenic by Panax notoginseng and Its Associated Health Risk

1 h, , CaCl 2. pelamis) 58.1%, (Headspace solid -phase microextraction and gas chromatography -mass spectrometry,hs -SPME - Vol. 15 No.

HIV HIV HIV HIV AIDS 3 :.1 /-,**1 +332

Supporting Information

Μέτρηση της Ρυθµικής Ικανότητας σε Μαθητές Γυµνασίου που Ασχολούνται µε Αθλητικές ραστηριότητες Συνοδευµένες ή Όχι από Μουσική

Table of Contents 1 Supplementary Data MCD

Affinity chromatography for the purification of glutathione S-transferase from Oxya chinensis

Δυσκολίες που συναντούν οι μαθητές της Στ Δημοτικού στην κατανόηση της λειτουργίας του Συγκεντρωτικού Φακού

Supporting Information. Generation Response. Physics & Chemistry of CAS, 40-1 South Beijing Road, Urumqi , China. China , USA

Shiraia sp. Slf14 III

Enzymatic Synthesis of Dithiolopyrrolone Antibiotics Using Cell-Free Extract of Saccharothrix

Reaction of a Platinum Electrode for the Measurement of Redox Potential of Paddy Soil

Science of Sericulture

Research on the Environmental Impact Factors of Electromagnetic Radiation from High - speed Railway

A Systematic Review of Procalcitonin for Early Detection of Septicemia of Newborn

ACTA MATHEMATICAE APPLICATAE SINICA Nov., ( µ ) ( (

Το Βιολογικό Ρολόι: Θεµελιώδης Ρυθµιστής της Φυσιολογίας των Οργανισµών

Basic & Clinical Medicine PLGA MUC1 MUC1 IC 50 MUC1 +

Salmonella produce microrna-like RNA fragment Sal-1 in the infected cells to. facilitate intracellular survival

Free Radical Initiated Coupling Reaction of Alcohols and. Alkynes: not C-O but C-C Bond Formation. Context. General information 2. Typical procedure 2

ΚΛΙΜΑΤΟΛΟΓΙΑ CLIMATOLOGY

8Q5SAC) 8Q5SAC UV2Vis 8500 ( ) ; PHS23C ) ;721 ( ) :1 4. ;8Q5SAC : molπl ;Britton2Robinson Q5SAC BSA Britton2Robinson,


Research on Economics and Management

AΡΙΣΤΟΤΕΛΕΙΟ ΠΑΝΕΠΙΣΤΗΜΙΟ ΘΕΣΣΑΛΟΝΙΚΗΣ ΠΟΛΥΤΕΧΝΙΚΗ ΣΧΟΛΗ ΤΜΗΜΑ ΠΟΛΙΤΙΚΩΝ ΜΗΧΑΝΙΚΩΝ

Study on AgrobacteriunΟmediated transformation of tobacco plant with rol C gene

Development of a Tiltmeter with a XY Magnetic Detector (Part +)

Supporting Information. Asymmetric Binary-acid Catalysis with Chiral. Phosphoric Acid and MgF 2 : Catalytic

BGP TRACP-5b BGP TRACP-5b P 0.05

ΕΘΝΙΚΟ ΜΕΤΣΟΒΙΟ ΠΟΛΥΤΕΧΝΕΙΟ

ΕΦΑΡΜΟΓΗ ΕΥΤΕΡΟΒΑΘΜΙΑ ΕΠΕΞΕΡΓΑΣΜΕΝΩΝ ΥΓΡΩΝ ΑΠΟΒΛΗΤΩΝ ΣΕ ΦΥΣΙΚΑ ΣΥΣΤΗΜΑΤΑ ΚΛΙΝΗΣ ΚΑΛΑΜΙΩΝ

rp, ribosomal protein 60S rp mrna rpl30 rps14 RT-PCR mrna nonsense-mediated mrna decay smg-2 smg-2 mrna rp rpl-1 rpl-1

Schedulability Analysis Algorithm for Timing Constraint Workflow Models

Electronic Supplementary Information DFT Characterization on the Mechanism of Water Splitting Catalyzed by Single-Ru-substituted Polyoxometalates

Introduction to Bioinformatics

Q L -BFGS. Method of Q through full waveform inversion based on L -BFGS algorithm. SUN Hui-qiu HAN Li-guo XU Yang-yang GAO Han ZHOU Yan ZHANG Pan

Study of urban housing development projects: The general planning of Alexandria City

Motion analysis and simulation of a stratospheric airship

ΠΑΝΕΠΙΣΤΗΜΙΟ ΠΕΙΡΑΙΩΣ ΤΜΗΜΑ ΝΑΥΤΙΛΙΑΚΩΝ ΣΠΟΥΔΩΝ ΠΡΟΓΡΑΜΜΑ ΜΕΤΑΠΤΥΧΙΑΚΩΝ ΣΠΟΥΔΩΝ ΣΤΗ ΝΑΥΤΙΛΙΑ

Table S1. Summary of data collections and structure refinements for crystals 1Rb-1h, 1Rb-2h, and 1Rb-4h.

High order interpolation function for surface contact problem

College of Life Science, Dalian Nationalities University, Dalian , PR China.

Metal-free Oxidative Coupling of Amines with Sodium Sulfinates: A Mild Access to Sulfonamides

þÿ Ç»¹º ³µÃ ± : Ãż²» Ä Â

D-Glucosamine-derived copper catalyst for Ullmann-type C- N coupling reaction: theoretical and experimental study

Study of In-vehicle Sound Field Creation by Simultaneous Equation Method

17 min R A (2009) To probe into the thermal property the mechanism of the thermal decomposition and the prospective

Electronic Supplementary Information (ESI)

Supporting Information

Octretide joint proton pump inhibitors in treating non-variceal gastrointestinal bleeding a Metaanalysis

Distribution of Mercury and Selenium in the Proteins of Porcine Liver and Kidney Under Different Mercury Exposure Level

Main source: "Discrete-time systems and computer control" by Α. ΣΚΟΔΡΑΣ ΨΗΦΙΑΚΟΣ ΕΛΕΓΧΟΣ ΔΙΑΛΕΞΗ 4 ΔΙΑΦΑΝΕΙΑ 1

Prey-Taxis Holling-Tanner

ΕΘΝΙΚΟ ΜΕΤΣΟΒΙΟ ΠΟΛΥΤΕΧΝΕΙΟ ΣΧΟΛΗ ΠΟΛΙΤΙΚΩΝ ΜΗΧΑΝΙΚΩΝ ΤΟΜΕΑΣ ΜΕΤΑΦΟΡΩΝ ΚΑΙ ΣΥΓΚΟΙΝΩΝΙΑΚΗΣ ΔΙΠΛΩΜΑΤΙΚΗ ΕΡΓΑΣΙΑ

Μαρία Κατσιφοδήμου. Ο ρόλος της έκκρισης HLA-G από τα ανθρώπινα έμβρυα στην επιτυχία της εξωσωματικής γονιμοποίησης. Μεταπτυχιακή Διπλωματική Εργασία

Emulsifying Properties of Egg Yolk as a Function of Diacylglycerol Oil

Study on Purification Technology and Antioxidant Activity of Total Flavonoid from Eriobotryae Folium

ΤΕΧΝΟΛΟΓΙΚΟ ΠΑΝΕΠΙΣΤΗΜΙΟ ΚΥΠΡΟΥ ΣΧΟΛΗ ΕΠΙΣΤΗΜΩΝ ΥΓΕΙΑΣ ΤΜΗΜΑ ΝΟΣΗΛΕΥΤΙΚΗΣ

Transcript:

13 5 Vol13 No5 2009 10 Life Science Research Oct 2009 2009 MACF1,,,,, * 710072 : (MACF1) (MG-63 MC3T3) /, MACF1,, MACF1 ; B MACF1,, MACF1 sirna-macf1 MG-63 MACF1, ; MACF1 : 1; ; ; ; : Q291 : A :1007-7847(2009)05-0382-06 Association of Microtubule Actin Crosslinking Factor 1 with Cytoskeleton in Osteoblast QIAN Ai-rong HU Li-fang DI Sheng-meng ZHANG Wei GAO Xiang SHANG Peng * Institute of Special Environment Biophysics Key Laboratory for Space Biosciences & Biotechnology Faculty of Life Sciences : 2009-02-10 : 2009-06-03 Northwestern Polytechnical University Xi an 710072 Shaanxi China Abstract The association of microtubule actin crosslinking factor1 MACF1 with actin filaments AFs microtubule MT and focal adhesion were examined using laser scanning confocal microscopy LSCM Results showed that MACF1 aligned along MT filaments and partly co-localized with the AFs and MT in the Cytoplasm In many osteoblast anti-macf1 labeling could be found in regions of focal adhesions cytochalasin B caused translocation of MACF1 to the perinuclear region or nucleus in contrast colchicines had no obvious effects on the association of MACF1 with cytoskeleton AFs were discrete and disrupted and MTs were disorganized in MG-63 cells tranfected with sirna-macf1 compared with that in control cells These results indicate that MACF1 plays an important role not only in linking cytoskeleton proteins but in stabilizing the cytoskeleton structure The association of MACF1 with cytoskeleton primarily depends on the integrity of the actin network Key words microtubule actin crosslinking factor 1 actin filaments microtubule focal adhesion osteoblast : 30840030 30970706 Life Science Research 2009 13 5 382~387 : 1973- Tel 029-88491671 E-mail qianair@nwpueducn * 1964- Tel 029-88460391 E-mail shangpeng@nwpueducn

5 :MACF1 383 1 11 MACF1 Abnova ACF7 Liem RH α-tubulin FITC-IgG rhodamine- IgG KPL α-tubulin Plakin vinculin B MACF1 Calbiochem phalloidin- rhodamine ACF7 Actin cross-linking family 7 620 kda actin-binding protein GFP-siRNA-MACF1 Macrophin-1 OFC4 Trabeculin-α [1~4] Plakin GFP-siRNA Eppendorf [5~8] 12 MACF1 / ACF7 MG-63 MC3T3 MACF1 / ACF7 5 10 5 [9~11] MACF1 MEM 10% 37 5% CO 2 18 h 24 h [10] ACF7 kakapo - 24 h [12] kakapo / ACF7 13 αβ1 [15] MACF1 [13] Kodama [13] ACF7 / MACF1 - ACF7 / MACF1 1 MACF1 MACF1-siRNA - 5 -AATTCAAAAAGCTGTGGTCAGAGTCGCT ACF7 ACF7 GATTCTCTTGAAATCAGCGACTCTGACCACAGC GGG- 3 5 -GATCCCCGCTGTGGTCAGAGTCGCTGAT MACF1 TTCAAGAGAATCAGCGACTCTGACCACAGCTTT TTG- 3 MACF1 2 Scramble sirna 5 -AATTCAAAAAAAAGGTCGTGGCAATCTG MACF1 TACTTCTCTTGAAAGTACAGATTGCCACGACCTT MACF1 GGG [14] MACF1 5 - GATCCCCAAGGTCGTGGCAATCTGTACT TTCAAGAGAAGTACAGATTGCCACGACCTTTTTT TTG-3 MACF1 TaKaRa Invitrogen Lecia MEM DNA Ligation Kit Solution I psiren-retroq-zsgreen BamH / EcoR

384 2009 Ecoli DH5α PBS 2 4% 37 05% 8 PCR phalloidin- rhodamine α-tubulin 1 100 14 MG-63 PBS GFP-siRNA 8 10 5 10 μg 543 nm sirna- MACF1 2 mm scramble sirna MG-63 400 μl 4 10 min Eppendorf 200 V 4 2 37 10 min 35 mm 72 h 21 MACF1 15 MG-63 MC3T3 5 1 MG-63 MACF1 10 5 / ml MEM 1A C E MC3T3 10% 37 5% CO 2 24 h 4% 20 min 05% 1B D F MG-63 MC3T3 15 min TBS 3 2% BSA 01% Triton X-100 01% Azide MACF1 actin 1A B MACF1 tubulin 1 100 ACF7 vinculin 1 100 4 TBS 3 1 100 α- MACF1 1 100 1C D MACF1 FITC-IgG 1 100 22 B MACF1 FITC-IgG phalloidin- rhodamine rhodamine- IgG FITC-IgG 1 h TBS 3 Leica TCS SP5 B 30 min actin FITC 60 min Anti- 488 nm rhodamine MACF1 543 nm 16 B MACF1 MG-63 MC3T3 min 60 min MACF1 24 h 1 μmol / L B 1 μmol / L 30 min 60 min 4% 05% 23 MACF1 B MACF1 MG-63 MC3T3 1 μmol / L rhodamine - IgG 1 100 488 nm MACF1 MACF1 actin 1E F MG-63 MC3T3 1 μmol / L B MACF1 actin 2 2 B MG-63 B 30 C D MC3T3 MACF1 30 min 60 min 17 sirna-macf1 MG-63 MACF1 3 3 A B MG-63 sirna-macf1 scramble 30 min 60 min MACF1 sirna MG-63 72 h C D MC3T3

5 :MACF1 385 MACF1 E F 1 MG-63 MC3T3 MACF1, 25 μm Fig1 The association of MACF1 with actin vinculin and tubulin in MG-63 and MC3T3-E1 cells Insets are higher magnification of regions within dotted white boxes Bar 25 μm 2 B MG-63 MC3T3 MACF1 25 μm Fig2 The association of MACF1 with actin filaments in MG-63 and MC3T3-E1 cells treated with cytochalasin B Bar 25 μm

386 2009 24 sirna-macf1 MG-63 4B sirna-macf1 MG-63 scramble sirna sirna- sirna-macf1 MACF1 MG-63 scramble sirna 4D 3 MG-63 MC3T3 MACF1 25 μm Fig3 The association of MACF1 with microtubule filaments in MG-63 and MC3T3-E1 cells treated with colchicines Bar 25 μm 4 si-macf1 MG-63 (A B) (C D) A, C: ; B, D: ; 25 μm Fig4 The effects of si-macf1 on actin filaments A B and microtubule filaments C D in MG-63 and MC3T3 cells by laser confocal microscopy A C MG-63 and MC3T3 cell transfected with scramble sirna D MG-63 and MC3T3 cell transfected with si-macf1 Bar 25 μm 3 MACF1 MCF-7 [16] MACF1 MACF1 MACF1 MACF1 MACF1 MACF1 kakapo / ACF7 Lin [15] MACF1 MACF1b [12,17] MACF1 MACF1b

5 :MACF1 387 [17] B MACF1 [J] MACF1 of MACF1[J] 2 187-190 MACF1 Kodama [13] ACF7 / MACF1 - ACF7 ACF7 disease[j] Exp Cell Res 2007 313 10 versatile cytolinker proteins[j] Karakesisoglou [16] 1 37-45 ACF-7 ACF-7 Cell Biol 2004 5 7 542-553 ACF-7 ACF-7 MACF1 sirna-macf1 MG-63 sirna-macf1 MG-63 MACF1 MACF1 MACF1 MACF1 MACF1 ATPase [18] MACF1 MACF1 30 7 545-555 (References): [1] LEUNG C L SUN D ZHENG M et al Microtubule actin cross-linking factor MACF a hybrid of dystonin and dystrophin that can interact with the actin and microtubule cytoskeletons [J] J Cell Biol 1999 147 6 1275-1286 [2] BERNIER G MATHIEU M DE REPENTIGNY Y et al 500-504 [4] 1 QIAN Ai-rong HU Li-fang SHANG Peng Recent advances on the structure and functions Chinese Journal of Cell Biology 2008 30 [5] CHEN H J LIN C M LIN C S et al The role of microtubule actin cross-linking factor 1 MACF1 in the Wnt signaling pathway [J] Genes Dev 2006 20 14 1933-1945 [6] SONNENERG A LIEM R K Plakins in development and 2189-2203 [7] LEUNG C L GREEN K J LIEM R K Plakins a family of Trends Cell Biol 2002 12 [8] JEFFERSON J J LEUNG C L LIEM R K Plakins goliaths that link cell junctions and the cytoskeleton[j] Nat Rev Mol [9] BERNIER G POOL M KLLCUP M et al Acf7 MACF is an actin and microtubule linker protein whose expression predominates in neural muscle and lung development [J] Dev Dyn 2000 219 2 216-225 [10] SUN D LEUNG C L LIEM R K Characterization of the microtubule binding domain of microtubule actin crosslinking factor MACF identification of a novel group of microtubule associated proteins[j] J Cell Sci 2001 114 Pt 1 161-172 [11] SUN Y ZHANG J KRAEFT S K et al Molecular cloning and characterization of human trabeculin-alpha a giant protein defining a new family of actin-binding proteins[j] J Biol Chem 1999 274 47 33522-33530 [12] STRUMPF D VOLK T Kakapo a novel cytoskeletalassociated protein is essential for the restricted localization of the neuregulin-like factor vein at the muscle-tendon junction site[j] J Cell Biol 1998 143 5 1259-1270 [13] KODAMA A KARAKESISOGLOU I WONG E et al ACF7 an essential integrator of microtubule dynamics [J] Cell 2003 115 3 343-354 [14] QIAN A R HU L F GAO X et al Large gradient high magnetic field affects the association of MACF1 with Actin and microtubule cytoskeleton[j] Bioelectromagnetics 2009 [15] LIN C M CHEN H J LEUNG C L et al Microtubule actin crosslinking factor 1b a novel plakin that localizes to the Golgi complex[j] J Cell Sci 2005 118 Pt 16 3727-3738 [16] MACF1 [J] QIAN Ai-rong ZHANG Bo SHANG Peng et al Bioinformatics analysis and cellular localization of Microtubule Actin Cross-Linking Factor 1[J] Journal of the Fourth Military Medical University 2009 30 1 33-36 [17] KARAKESISOGLOU I YANG Y FUCHS E An epidermal Cloning and characterization of mouse ACF7 a novel member of the dystonin subfamily of actin binding proteins[j] Genomics 1996 38 1 plakin that integrates actin and microtubule networks at cellular junctions [J] J Cell Biol 2000 149 1 195-208 19-29 [18] WU X Y KODAMA A FUCHS E ACF7 regulates [3] BYERS T J BEGGS A H MCNALLY E M et al Novel cytoskeletal-focal adhesion dynamics and migration and has actin crosslinker superfamily member identified by a two step ATPase activity [J] Cell 2008 135 137-148 degenerate PCR procedure[j] FEBS Lett 1995 368 3