16S23S rrna 197 16S23S rrna (, 100050) : 16S23S rrna,, 2, 16S23S rrna,3 3 (ATCC10248 NCPPB 947 NCPPB3580) 1 B. phenazinium (LMG2247) 8 ( HN2y Co14 Co8 Co36 Sx8801 90-3 56 (2) 56 (2) ) 16S 23S rrna,( GenBank) 16S23S rrna, 2,,DNA,, :;, ;, rrna ; ; Study on Comparison of 16S23S rrna Gene ISR Sequence of Pseudomonas cocovenenans subsp farinofermentans Strains and B urkholderia gladioli Strains J IAO Zhen2quan, CAO Wei, YU Dong2min, LIU Xiu2mei, WANG Xiao2ying (National Institute for Nutrition and Food safety, Chinese CDC, Beijing 100050, CHina) Abstract : Objective To study and analyze the differences among the strains in the genus Burkholderia at gene levels by comparing 16S23S rrna gene intergenic spacer region ( ISR) sequences of Pseudomonas cocovenenans subsp farinofermentans strains isolated in Chinese foods and Burkholderia gladioli model strains. The phylogenetic relationships of them were expounded. Method Two pairs of specific primers for the genus Burkholderia were designed and 16S23S rrna gene ISR sequences were amplified for the strains. 16-23S rrna gene ISR sequences of 3 international reference strains representative of the three different pathogenic strains of Burkholderia gladioli ( ATCC10248, NCPPB 947, NCPPB3580), and 1 strain of B. phenazinium (LMG2247) and 8 strains of Pseudomonas cocovenenans subsp farinofermentans isolates ( HN2yCo14Co8Co36Sx8801 90-356 (2) 56 (2) ) from the different samples of food2poisoning in China were determined. The total sequences were compared and analyzed with the relative strain sequences in the GenBank by the molecular biological analyzing software. Results Two highly variable ISR regions and the DNA specific sequences associated with isolate strains produced the Bongkrekic acid were found. The results of the DNA sequences were submitted to the GenBank. The phylogenetic tree of the isolates and the Burkholderi gladioli were illustrated. Conclusion New and reliable theory and technology supports were provided for the further study of the identification of Pseudomonas cocovenenans subsp farinofermentans isolates produced Bongkrekic acid, research into their mechanisms in molecular levels and their phylogenetic relationships. Key word : Pseudomonas ; Burkholderia gladioli ; Genes, rrna ; Research ; Metched2Pair Analysis ( Pseudomonas cocovenenans subsp f arinofermentans),, : (30571575) : :, 41180 %,, (Bongkrekic Acid, BA),
198 CHINESE JOURNAL OF FOOD HYGIENE 2008 20 3,, 4104 %, 8121 %, 1999, 3,,,,,, 16S 23S rrna ( Intergenic Spacer Region, ISR) [1 ],,, 16S23S rrna,, PCR, DNA,, 1 111 11111 3, 16 ( B. gladioli pv gladioli) 10248 9450 (American Type Culture Collection, ATCC) ( National Collection of Industrial Bacterial,NCIB), 2 ( B1 gladioli pv alliicola B1 gladioli pv agaricicola) 947 3580 ( National Collection of Plant Pathogenic Bacteria,NCPPB), B phenazinium LMG2247, 52922 (CTCC),10 1, (PDA),37 1824 h,4 1 ( ) 1 ATCC 10248 Leaf ( ) a 2 NCPPB 947 ( ) a 3 NCPPB 3580 ( ) a 4 NCIB 9450 + a 5 HN2y + a 6 Co14 + a 7 Co8 + a 8 Co36 + a 9 1A + a 10 90-3 + a 11 Sx8801 + a 12 1(2) ( ) a 13 56(2) ( ) a 14 56(5) ( ) a 15 LMG 2247 - b 16 52922 CTCC - b : a (TCL),[2,3,43 ] ;b CTCC:
16S23S rrna 199 11112 10 PCR Taq dntps DNA DNA Promega ; ( EB ) Sigma ; ABI PRISM R BigDye TM Terminator Cycle Sequencing Ready Reastion kit with Amplitaq R DNA polymerase FS PERKIN ELMER ;Pgla 2-16S Pgla 1-23S, 2 ; PCR Whatman Biometra ; Bio - Rad ;THZ - 82 ;ABI PRISM TM 377XL DNA sequencer PERKIN ELMER ; DYY - III - 5 ; MS2 IKA 11113 DNAman 510 TreView32 Lynnon Biosoft 112 11211 PCR 16S 23S rdna, DNAman, 16S23S rrna,, 2 Pgla 1-16SΠPgla 2-23S Pgla 2-16SΠ Pgla 1-23S, 2, 745 bp 699 bpdna 2 Pgla 1-16S 16S rdna 5> ATC AGC ATG CCG CGG TGA AT < 3 Pgla 2-16S 16S rdna 5> CGT CAC ACC ATG GGA GT < 3 Pgla 1-23S 23S rdna 5> TCC ACC ACA TGC ACT TGT TC < 3 Pgla 2-23S 23S rdna 5> CCA CAT GCA CTT GTT CGC TT < 3 11212 DNA 011 ml - 80 PDA,35 24 48 h,,dna, DNA 1 l PCR 11213 PCR PCR (50 l) :5 l 10 PCR 1 l 25 mmolπl 012 l Taq 1 l 10 mmolπl dntps 1 l 10 mmolπl 1 l DNA 4018 l, DNA PCR :94 5 min ; 33 :94 30 s,55 30 s,72 1 min, 72 10 min 11214 PCR, 10 l,100 bp DNA Ladder EB [10] 75 V (5 VΠcm) 2 h,eb (015 gπml), 258 nm, 11215 PCR PCR,Chromas PCR PCR,,DNAman DNA 11216 Chromas,Genbank DNAman,, Genbank, DNA Star Treview, 2 211 PCR 2 Pgla 1-16SΠPgla2-23S Pgla 2-16SΠPgla 1-23S,25922, ATCC 10248 2 NCPPB 947 NCPPB 3580 3 HN2y Co14 Sx8801, PCR,,PCR,,, Pgla 2-16SΠPgla 1-23S, 1,,Pgla 2-16SΠPgla 1-23S Co14 212 PCR,Pgla 2-16SΠPgla 1-23S, PCR,16S23S rrna DNA,PCR 2 213 16S23S rrna
200 CHINESE JOURNAL OF FOOD HYGIENE 2008 20 3 M: DNA marker,100 bp ladder ; 1 2 3 4 5 6 7 ATCC10248 HN2y Co14 Sx8801 NCPPB 947 NCPPB 3580 25922 1 PCR M DNA marker,100 bp ladder ; 1 2 10 ATCC 10248NCIB 9450 LMG 2247 ;3 4 5 6 7 8 9 Co8 Co36 Co14 56 (2) HN2y 56 (5) 1 (2) ;11 25922 2 PCR ATCC 10248 NCPPB 947 NCPPB 3580 LMG 2247 Sx8801 HN2y 56 (2) 56 (5) 90-3 Co8 Co14 Co36 PCR, DNA ( GenBank), 3 : http :ΠΠwww. ncbi. nlm. nih. govπbankitπnph2bankit. cgi 3 12 16S23S rrna (bp) EF 552059 Sx8801 773 EF 552060 HN2y 681 EF 552061 56(2) 716 EF 552062 56(5) 716 EF 552063 90-3 687 EF 552064 Co8 717 EF 552065 Co14 770 EF 552066 Co36 725 EF 552067 LMG 2247( B1 phenazinium) 692 EF 552068 NCPPB 3580( B1 gladioli pv agaricicola) 715 EF 552069 NCPPB 947( B1 gladioli pv alliicola) 724 EF 552070 ATCC 10248( B1 gladioli pv gladioli) 715 214 16S23S rrna DNA 21411 16S23S rdna 16S23S rdna, DNA 89187 %,2, 3 a b 466485 bp609676 bp HN2y Sx8801 Co14 Co36 1 - TGATGAGTACACAAGTGTATT -, HN2y Co8 90-3 421 bp 1 A ; Sx8801 Co14 2 - GTAACTACTCCC TTCGGGAGTGGGACCAGAGTAAGCGCTAAAGCGCTAA CTCTGGCCGACATCAAT - ATCC 10248 DNA 9213 %, ;( ) 56 (2) 56 (5) ATCC 10248 99186 %glad alli agri ATCC 10248 NCPPB 947 NCPPB 3580 16S 23S rrna,l28156 L28157 21412 16S23S rdna ( GenBank) 14 8 16S23S rrna, DNA 71167 %,, DNA ;,4 a b c d e,, ( ) 405494 bp,,,460485 bp 12, 215, DNA Star Treview 32, 16S23S rrna,,, 5
16S23S rrna 201 a 410419 bp466485 bp ; b 609676 bp 3 16S - 23S rdna ATCC 10248 ;agri alli glad phen NCPPB 3580 NCPPB 947 ATCC 10248 LMG 2247 ;L28151L28165 GenBank 16S23S rrna ;, 3, I Co36 HN2y Co14 Sx8801 NCPPB 947, Co8 90-3 ( ) 56 (2) 56 (5) ATCC 10248 3,16S rrna,16s rrna, 16S 23S rrna ISR 16S rrna 10 [1 ] 16S23S rrna ISR,, 16S rrna 23S rrna 5S rrna ISR [5 ] 16S23S rrna ISR, trna, 16S23S rrna ISR trna Ala trna Ile, trna Glu 1987 Co8 Co14, (NCIB 9450 ) ( ), [4 ],,,,1989 ATCC, ATCC 10248 ; [6,7 ] rdna, ; [2,8,9 ] 16S rrna,,
202 CHINESE JOURNAL OF FOOD HYGIENE 2008 20 3 a b c d e 137207 bp 295403 bp 401501 bp 525633 bp 679785 bp 4 16S23S rdna
16S23S rrna 203 ), [2-4,6-9 ], 16S23S rrna, 5 16S23S rrna DNA,,, ( [1 ] SIMON L J, STUBBS L, JON, et al. PCR targeted to the 16S - 23S rrna gene intergenic spacer region of clostridium difficile and construction of a library consisting of 116 different PCR ribotypes [J ]. Journal of Clinical Microbiology, 1999, 37 (2) : 4612463. [2 ]. [ D ].,1999. [3 ]. [D].,1995. [4 ]. [M]. :,1988 : 3842395. [5 ] PAUL W, WHITBYL, LAUREN C, et al. Species2Specific PCR as a Tool for the Identification of Burkholderia gladioli [ J ]. Journal of Clinical Microbiology, 2000, 38 (1) :2822285. [6 ],,. rdna [J ]., 1996, 30 (4) : 2312233. [7 ],,. rdna [J ]., 1998, 27 (1) : 572 60. [8 ],. 16s rdna [J ].,1999,28 (4) :2322235. [9 ] J IAO Z, KAWAMURA Y, MISHIMA N, et al. Need to differentiate lethal toxin2producing strains of Burkholderia gladioli, which cause severe food poisoning : description of B. gladioli pathovar cocovenenans and an emended description of B. gladioli [J ]. Microbiol Immunol. 2003, 47 (12) :9152925. [10 ],. PCR [J ].,2003,32 (3) :2282231. [ :2008-03 - 02 ] :R15 ; R379 ; Q949132 :A :1004-8456 (2008) 03-0197 - 07 (),,, 50 %,10 % 50 %WHO, 90 %,, 75 %,,,