M. marburgensis DX01 M. thermoautotrophicus M. marburgensis Marburg. MCR I mrna

Σχετικά έγγραφα
Optimizing Microwave-assisted Extraction Process for Paprika Red Pigments Using Response Surface Methodology

Mean bond enthalpy Standard enthalpy of formation Bond N H N N N N H O O O

Antimicrobial Ability of Limonene, a Natural and Active Monoterpene

SOD SNP % Cu /Zn-SOD. DAM- BE DNAStar % Mn /Fe-SOD. 6 1SNP /17. 9 bp

Science of Sericulture

Supplementary Table 1. Construct List with key Biophysical Properties of the expression

Conductivity Logging for Thermal Spring Well

IL - 13 /IL - 18 ELISA PCR RT - PCR. IL - 13 IL - 18 mrna. 13 IL - 18 mrna IL - 13 /IL Th1 /Th2

α 1 2- Cloning and Expression of alpha 1 2-fucosyltransferase in E. coli BIOTECHNOLOGY BULLETIN

The toxicity of three chitin synthesis inhibitors to Calliptamus italicus Othoptera Acridoidea

College of Life Science, Dalian Nationalities University, Dalian , PR China.

Physical and Chemical Properties of the Nest-site Beach of the Horseshoe Crab Rehabilitated by Sand Placement

Protease-catalysed Direct Asymmetric Mannich Reaction in Organic Solvent

Shiraia sp. Slf14 III

Gateway cdna. cdna. pdest TM ~ cfu/ ml ~ cfu bp

Differences in Contents of Neutral Aroma Components and Sensory Evaluation in Air-cured Burley Leaves from Different Curing Barns

JOURNAL OF MICROBIOLOGY May 2011 Vol. 31 No. 3. PCR bp BCCP. pet-28a Escherichia coli BL21 DE3 Ni-NTA

Nucleotide Sequence of Cloned cd NA for alpha Subunit of Goat Follicle Stimulating Hormone

9-amino-(9-deoxy)cinchona alkaloids-derived novel chiral phase-transfer catalysts

Γεωπονικό Πανεπιςτήμιο Αθηνών Τμήμα Αξιοποίηςησ Φυςικών Πόρων και Γεωργικήσ Μηχανικήσ

Affinity chromatography for the purification of glutathione S-transferase from Oxya chinensis

Μελέτη της έκφρασης του ογκοκατασταλτικού γονιδίου Cyld στον καρκίνο του μαστού

Identification of Fish Species using DNA Method

Supporting Information

ΑΡΙΣΤΟΤΕΛΕΙΟ ΠΑΝΕΠΙΣΤΗΜΙΟ ΘΕΣΣΑΛΟΝΙΚΗΣ ΤΜΗΜΑ ΟΔΟΝΤΙΑΤΡΙΚΗΣ ΕΡΓΑΣΤΗΡΙΟ ΟΔΟΝΤΙΚΗΣ ΚΑΙ ΑΝΩΤΕΡΑΣ ΠΡΟΣΘΕΤΙΚΗΣ

8Q5SAC) 8Q5SAC UV2Vis 8500 ( ) ; PHS23C ) ;721 ( ) :1 4. ;8Q5SAC : molπl ;Britton2Robinson Q5SAC BSA Britton2Robinson,

svari Real-time RT-PCR RSV

Effects of Chlorogenic Acid on the Activity of Cultured Osteoblasts in vitro

17 min R A (2009) To probe into the thermal property the mechanism of the thermal decomposition and the prospective

SUPPLEMENTARY INFORMATION

Accumulation of Soil Arsenic by Panax notoginseng and Its Associated Health Risk

Supporting information. An unusual bifunctional Tb-MOF for highly sensing of Ba 2+ ions and remarkable selectivities of CO 2 /N 2 and CO 2 /CH 4

( HN2y Co14 Co8 Co36 Sx (2) 56 (2) ) 16S

Studies on purification and characteristics of glycosyltransferase from an engineering strain

*,* + -+ on Bedrock Bath. Hideyuki O, Shoichi O, Takao O, Kumiko Y, Yoshinao K and Tsuneaki G

Άσκηση 7η Ιστοκαλλιέργεια Παρασκευή και αποστείρωση υποστρώµατος

Laboratory Studies on the Irradiation of Solid Ethane Analog Ices and Implications to Titan s Chemistry

c Key words: cultivation of blood, two-sets blood culture, detection rate of germ Vol. 18 No

http / /xuebao. jxau. edu. cn. orfh79 orfh79 pet - 28a - orfh79 pgex5x orfh79

CONCENTRATIVE PROPERTIES OF AQUEOUS SOLUTIONS: DENSITY, REFRACTIVE INDEX, FREEZING POINT DEPRESSION, AND VISCOSITY

ΑΠΟΜΟΝΩΣΗ, ΤΑΥΤΟΠΟΙΗΣΗ ΜΕΘΑΝΟΤΡΟΦΩΝ ΜΙΚΡΟΟΡΓΑΝΙΣΜΩΝ ΚΑΙ ΒΙΟΛΟΓΙΚΗ ΜΕΤΑΤΡΟΠΗ ΜΕΘΑΝΙΟΥ ΣΕ ΜΕΘΑΝΟΛΗ

ΜΕΤΑΠΤΥΧΙΑΚΗ ΕΡΕΥΝΗΤΙΚΗ ΔΙΑΤΡΙΒΗ

Extract Isolation Purification and Identification of Polysaccharides from Exocarp of Unripe Fruits of Juglans mandshurica

E#ects of Drying on Bacterial Activity and Iron Formation in Acid Sulfate Soils

ΜΟΡΙΑΚΕΣ ΜΕΘΟΔΟΙ ΚΡΙΤΗΡΙΑ ΕΠΙΛΟΓΗΣ ΑΞΙΟΛΟΓΗΣΗ

Αξιολόγηση Ημιαγώγιμων Υμενίων Σεληνιούχου Καδμίου Σε Υπόστρωμα Νικελίου Για Φωτοβολταϊκές Εφαρμογές

Investigation of ORP (Oxidation-Reduction Potential) Measurement on Sulfur Springs and Its Application on Hot Spring Waters in Nozawa Onsen

Molecular evolutionary dynamics of respiratory syncytial virus group A in

Inhibition of mushroom tyrosinase by flavonoid from Sorbus tianschanica Ruper in Xinjiang

ΖΩΝΟΠΟΙΗΣΗ ΤΗΣ ΚΑΤΟΛΙΣΘΗΤΙΚΗΣ ΕΠΙΚΙΝΔΥΝΟΤΗΤΑΣ ΣΤΟ ΟΡΟΣ ΠΗΛΙΟ ΜΕ ΤΗ ΣΥΜΒΟΛΗ ΔΕΔΟΜΕΝΩΝ ΣΥΜΒΟΛΟΜΕΤΡΙΑΣ ΜΟΝΙΜΩΝ ΣΚΕΔΑΣΤΩΝ

1 h, , CaCl 2. pelamis) 58.1%, (Headspace solid -phase microextraction and gas chromatography -mass spectrometry,hs -SPME - Vol. 15 No.

30s 56 60s 72 60s dntp cm s s s 23

Electrolyzed-Reduced Water as Artificial Hot Spring Water

Gro wth Properties of Typical Water Bloom Algae in Reclaimed Water

ΠΑΝΕΠΙΣΤΗΜΙΟ ΘΕΣΣΑΛΙΑΣ

,,, (, ) , ;,,, ; -

Neutralization E#ects of Acidity of Rain by Cover Plants on Slope Land

ΠΑΡΑΜΕΤΡΟΙ ΕΠΗΡΕΑΣΜΟΥ ΤΗΣ ΑΝΑΓΝΩΣΗΣ- ΑΠΟΚΩΔΙΚΟΠΟΙΗΣΗΣ ΤΗΣ BRAILLE ΑΠΟ ΑΤΟΜΑ ΜΕ ΤΥΦΛΩΣΗ

Διπλωματική Εργασία. Μελέτη των μηχανικών ιδιοτήτων των stents που χρησιμοποιούνται στην Ιατρική. Αντωνίου Φάνης

A/A Είδος Προδιαγραφές

BL21 (D E3)2p E T28a ( + )2bgl 2

Salmonella produce microrna-like RNA fragment Sal-1 in the infected cells to. facilitate intracellular survival

Copper-catalyzed formal O-H insertion reaction of α-diazo-1,3-dicarb- onyl compounds to carboxylic acids with the assistance of isocyanide

BGP TRACP-5b BGP TRACP-5b P 0.05

ΠΕΡΙΛΗΨΗ. Λέξεις κλειδιά: Υγεία και συμπεριφορές υγείας, χρήση, ψυχότροπες ουσίες, κοινωνικό κεφάλαιο.

Supporting Information

Chalkou I. C. [PROJECT] Ανάθεση εργασιών.

High mobility group 1 HMG1

stability and aromaticity in the benzonitrile H 2 O complex with Na+ or Cl

ΑΚΑ ΗΜΙΑ ΕΜΠΟΡΙΚΟΥ ΝΑΥΤΙΚΟΥ ΜΑΚΕ ΟΝΙΑΣ ΣΧΟΛΗ ΜΗΧΑΝΙΚΩΝ ΠΤΥΧΙΑΚΗ ΕΡΓΑΣΙΑ

Site-Selective Suzuki-Miyaura Cross-Coupling Reactions of 2,3,4,5-Tetrabromofuran

[ΥΡΖΖ ΦΤΗΚΑ ΚΑΗ ΥΖΜΗΚΑ

ΙΩΑΝΝΗ ΑΘ. ΠΑΠΑΪΩΑΝΝΟΥ

TGFp FSH INH INH

Lewis Acid Catalyzed Propargylation of Arenes with O-Propargyl Trichloroacetimidate: Synthesis of 1,3-Diarylpropynes

Ποιοτική Αξιολόγηση ενός Προγράμματος Διδασκαλίας Δεξιοτήτων Ζωής στη Φυσική Αγωγή

[11].,, , 316 6, ,., 15.5%, 9.8%, 2006., IDF,, ,500, 2,830.,, ,200.,,, β, [12]. 90% 2,,,,, [13-15].,, [13,

Vol. 38 No Journal of Jiangxi Normal University Natural Science Nov. 2014

MSM Men who have Sex with Men HIV -

Medicago marina 2012

Isotopic and Geochemical Study of Travertine and Hot Springs Occurring Along the Yumoto Fault at North Coast of the Oga Peninsula, Akita Prefecture

P450 CYP4G19. Prokaryotic Expression of German cockroach Cytochrome P450 CYP4G19 Gene and Preparation of Polyclonal Antibody , ; 2.

1 (forward modeling) 2 (data-driven modeling) e- Quest EnergyPlus DeST 1.1. {X t } ARMA. S.Sp. Pappas [4]

Supporting Information

Supporting Information. Asymmetric Binary-acid Catalysis with Chiral. Phosphoric Acid and MgF 2 : Catalytic

Direct Transformation of Ethylarenes into Primary Aromatic Amides with N-Bromosuccinimide and I 2 -aq NH 3

«ΠΡΟΜΗΘΕΙΑ ΕΞΟΠΛΙΣΜΟΥ ΕΡΓΑΣΤΗΡΙΟΥ»

ph Maillard MRPs maillard reaction products Maillard ph kDa Maillard Maillard DOI /j. issn

HIV HIV HIV HIV AIDS 3 :.1 /-,**1 +332

Copper-Catalyzed Oxidative Dehydrogenative N-N Bond. Formation for the Synthesis of N,N -Diarylindazol-3-ones

In vitro και in vivo φαρμακοκινητική ανάλυση των παραγώγων ανθρακινόνης σε φυτικά σκευάσματα

Heterobimetallic Pd-Sn Catalysis: Michael Addition. Reaction with C-, N-, O-, S- Nucleophiles and In-situ. Diagnostics

ACTA SCIENTIAE CIRCUMSTANTIAE. 16S rrna PNAN5 ( Rhodococcus sp. strain PNAN5). 20. ( Institute of Microbiology, Chinese Academy of Sciences,

J. Dairy Sci. 93: doi: /jds American Dairy Science Association, 2010.

Journal of Ningxia Medical University. Annexin P19 mrna P < AnnexinA2 P19 mrna. AnnexinA2 P19 mrna. PCR 1.

ΜΔΛΔΣΖ ΔΝΓΟΣΡΑΥΤΝΖ Δ ΥΑΛΤΒΔ ΘΔΡΜΖ ΔΛΑΖ

ΘΕΡΜΟΚΗΠΙΑΚΕΣ ΚΑΛΛΙΕΡΓΕΙΕΣ ΕΚΤΟΣ ΕΔΑΦΟΥΣ ΘΡΕΠΤΙΚΑ ΔΙΑΛΥΜΑΤΑ

Study on AgrobacteriunΟmediated transformation of tobacco plant with rol C gene

Comparison of HPLC fingerprint between enzymatic Calculus bovis and natural Calculus bovis

Τα αναλώσιμα μαζί με τα τεχνικά χαρακτηριστικά τους περιγράφονται αναλυτικά ανά ομάδα:

Transcript:

2010 32 4 0797-0801 http / /xuebao. jxau. edu. cn Acta Agriculturae Universitatis Jiangxiensis E - mail ndxb7775@ sina. com DX01 1 2 2* 1. 337000 2. 310058 DX01 Methanothermobacter marburgensis DX01 DX01 M I 70 PCR M I M I M. marburgensis DX01 M. thermoautotrophicus M. marburgensis Marburg 97. 6% 99. 2% PCR M I MCR I mrna MCR I mrna DX01 M I M Q936 A 1000-2286 2010 04-0797 - 05 Clone and Expression Analysis of An Anti - stress Protein from Methanothermobacter marburgensis DX01 DING Xia 1 MIN Hang 2 Yang Wei-jun 2* 1. College of Life Sciences Nanchang University Nanchang 337000 China 2. College of Life Sciences Zhejiang University Hangzhou 310058 China Abstract Thermophilic methanogen Methanothermobacter marburgensis DX01 was isolated from a hot spring in China. The optimal temperature for its growth is 65. In order to identify the gene potentially involved in the anti - stress protein in M. marburgensis DX01 prorein expression profiles in response to different growth temperature were investigated. The protein up - regulated expression at 70 obviously was cleaved out and sequenced by N - terminal amino acid sequences which corresponded to Methyl - coenzyme M reductase I MCR I gamma subunit. Phylogenetic analysis showed that amino acid sequences of MCR I gene were conservative in the evolvement of methanogen and consistent with the relationships that were established by 16S rrna gene analysis on the whole. To examine the role s of MCR I of M. marburgensis DX01 in response to temperature the MCR I mrna expressions at different temperature were conducted using real - time PCR analysis. The MCR I mrna expression increased highly at the culture temperatures 70 and was significantly lower at 50. The results suggest that MCR I in M. marburgensis DX01 is temperature - dependent transcript and conservative in the evolvement of methanogen. 2010-05 - 12 2010-06 - 17 2009GQN0091 GJJ10048 1978 - E - mail dingxia97@ ncu. edu. cn * E - mail w_jyang52@ yahoo. com

798 32 Key words archaea Methanothermobacter marburgensis DX01 Methyl - coenzyme M reductaseⅠ stress 1-3 Methanogen H 2 CO 2 CH 4 65 4-5 H 2 CO 2 CH 4 MVH FRH F420 - MDH H2 - MDH MCR 6 M MCR 7 M 300 ku α 2 β 2 γ 2 3 8 M H 2 CO 2 CH 4 9 65 DX01 1 1. 1 hungate 10 g /L K 2 HPO 4 1. 5 NH 4 Cl 1. 5 MgCl 2 6H 2 O 0. 1 yeast extract 1 sodium cysteine 0. 5 NaHCO 3 1. 0 sodium resazurin 0. 001 trace element solutions 10 ml g L - 1 MgSO 4 7H 2 O 3 MnSO 4 4H 2 O 0. 5 NaCl 10 FeSO 4 7H 2 O 0. 1 CoCl 2 6H 2 O 0. 1 CaCl 2 2H 2 O 0. 1 ZnSO 4 7H 2 O 0. 1 CuSO 4 0. 01 KAl SO 4 2 12H 2 O 0. 01 H 3 BO 3 0. 01 Na 2 MoO 4 2H 2 O 0. 01 NiCl 2 6H 2 O 0. 025 NaSeO 3 6 H 2 O 0. 000 3 ph 7. 0 121 20 min H 2 CO 2 = 80 20 1. 2 SDS - PAGE 40 50 60 70 12% SDS - PAGE 1. 3 N SDS - PAGE PVDF ABI 1. 4 M I MCR I M I gammma F / R gammma F 5 - ATGATATGG CACAATACT A - 3 gammma R 5 - TAGATTAT- GGCTGACAAAT - 3 M. marburgensis DX01 Taq DNA PCR 95 5 min 95 30 s 54 30 s 72 30 s 30 72 10 min TA GenBank EU807736 1. 5 RNA 50 ~ 100 mg Trizol RNA

4 DX01 799 1. 6 RT cdna SuperscripTM /First - strand cdna synthesis kit 200 μl RNase - free 1 μg RNA 0. 5 μl DEPC 3. 5 μl 70 5 min 2. 5 μl M - MLV 5 buffer 2. 5 μl 10 mm dntps 0. 5 μl RNase inhibitor 0. 5 μl M - MLV - RT 3 μl DEPC 42 1 h PCR - 20 1. 7 Real - time PCR MCRF 5 - ATACCCAAGTGTTCACCCACCACT - 3 MCRR 5 - ATGCCCT- TGACCTCACATATGGCT - 3 178 bp 16S 16S - TA MCR - TA QIAquick plasmid Mini kit 10 μl 10 5 10 6 10 7 10 8 10 9 5 PCR 3 PCR 94 2 min 94 15 s 60 15 s 72 10 s 38 72 72 10 min PCR 2 2. 1 40 50 60 70 SDS - PAGE 70 30 ku 37 ku 1A 2. 2 SDS - PAGRE 30 ku ABI N M Ⅰ gamma 1B 2. 3 M I Arrow labled the targed proteins. 1 DX01 Fig. 1 SDS - PAGE of M. marburgensis DX01 at different cultured temperature M I gammma F /R M. marburgensis DX01 M I M I M. marburgensis DX01 M. thermoautotrophicus ΔH T M. marburgensis Marburg 97. 6% 99. 2% 2A Methanosphaera stadtmanae MCR I 16S rdna MCR I 16S rdna 2 2. 4 M I MCR I mrna PCR M I mrna 50 65 70 MCR I mrna 3B 65 70 MCR I mrna 65 3

800 32 Fig. 2 2 M I Alignment of the methyl - coenzyme M reductase I gamma subunit protein sequences A DX01 B DX01 MCR I mrna MCR I mrna 16S mrna MCR I mrna 65 MCR I mrna 1 ± SEM A Growth curve of M. marburgensis DX01 at different cultured temperature. B The level of MCR I mrna was normalized by 16S rrna levels and indicated in the respective growth temperature. The value of 65 was set to 1 and the rest of the value normalized. The results were expressed as means ± SEM. Fig. 3 3 DX01 MCR I mrna MCR I mrna expression in M. marburgensis DX01 analysed by real - time PCR 50 MCR I mrna MCR I mrna MCR I mrna 3

4 DX01 801 CO 2 Hungate DX01 M. marburgensis DX01 11 DX01 3 DX01 70 70 M Ⅰ MCR Ⅰ gamma M MCRⅠ MCRⅡ H 2 ph 9 MCRⅠ 70 DX01 M N 1 Macario A J Lange M Ahring B K et al Stress genes and proteins in the archaea J. Microbiol Mol Biol Rev 1999 63 4 923-967. 2 Eckburg P B Lepp P W Relman D A. Archaea and their potential role in human disease J. Infect Immun 2003 71 2 591-596. 3 Ding X Lv Z M Zhao Y et al. MTH1745 a protein disulfide isomerase - like protein from thermophilic archaea Methanothermobacter thermoautotrophicum involving in stress response J. Cell Stress Chaperones 2008 13 2 239-246. 4 Jones W J Nagle D P J r et al. Methanogens and the diversity of archaebacteria J. Microbiol Rev 1987 51 1 135-177. 5 Morgan R M Pihl T D Nolling J et al. Hydrogen regulation of growth growth yields and methane gene transcription in Methanobacterium thermoautotrophicum deltah J. J Bacteriol 1997 179 3 889-898. 6 Pennings J L Vermeij P de Poorter L M et al. Adaptation of methane formation and enzyme contents during growth of Methanobacterium thermoautotrophicum strain deltah in a fed - batch fermentor J. Antonie Van Leeuwenhoek 2000 77 3 281-291. 7 Bokranz M Baumner G Allmansberger R et al. Cloning and characterization of the methyl coenzyme M reductase genes from Methanobacterium thermoautotrophicum J. J Bacteriol 1988 170 2 568-577. 8 Ermler U Grabarse W Shima S et al. Crystal structure of methyl - coenzyme M reductase the key enzyme of biological methane formation J. Science 1997 278 5342 1457-1462. 9 Bonacker L G Baudner S Thauer R K. Differential expression of the two methyl - coenzyme M reductases in Methanobacterium thermoautotrophicum as determined immunochemically via isoenzyme - specific antisera J. Eur J Biochem 1992 206 1 87-92. 10 Balch W E Fox G E Magrum L J et al. Methanogens reevaluation of a unique biological group J. Microbiol Rev 1979 43 2 260-296. 11 Zeikus J G Wolfe R S. Fine structure of Methanobacterium thermoautotrophicum effect of growth temperature on morphology and ultrastructure J. J Bacteriol 1973 113 1 461-467.