2009 6 9 6 [ ] 1672-3619(2009)06-0591-06 591 P450 CYP4G19 1,2 1,2*,, 2, 2, 2, 2 1, (1., 518060; 2., 518020) P450 CYP4G19, CYP4G19 RT-PCR CYP4G19, T-A, pet-28a, BL21 (DE3),,,, ELISA Western-blot cdna 771bp, 32000 Mr P450, 1 10 6 Western-blot 32000 Mr, P450 CYP4G19 CYP4G19, CYP4G19 ; P450; ; CYP4G19 ; :R384.9 :A Prokaryotic Expression of German cockroach Cytochrome P450 CYP4G19 Gene and Preparation of Polyclonal Antibody ZHAO Xia 1,2, ZHANG Ren-li 1,2*, GEN Yi-jie 2, HUANG Da-na 2, GAO Shi-tong 2, LI Xiao-hen 2, HU Zhang-li 1 (1. College of Life Science, Shenzhen University, Shenzhen 518060; 2.Shenzhen Center for Diseases Control and Prevention, Shenzhen 518020, China) Abstract Objective To construct prokaryotic expression vector carrying a partial German cockroach cytochrome P450 CYP4G19 gene, and to express the recombinant protein in E. coil. Using the purified fusion protein for the production of polyclonal antibody. Method Part of the CYP4G19 gene was amplified by RT-PCR. PCR products were ligated to the cloning vector pgem T-easy. The positive clones were sequenced and then subcloned into prokaryotic expression vector pet-28a. The constructed pet-28a-cyp4g19 vetor was transformed to E.coil BL21 (DE3) and the recombinant P450 protein (rp450) was expressed. rp450 was then purified using Ni + affinity column chromatography. Balb / c mice were then immunized using the purified rp450 and the titer of the polyclonal antibody was determined by ELISA. The specificity of the antibody was confirmed by Western-blot. Result A hydrophilic fragment of 771bp was cloned from the German cockroach cdna. The recombinant protein with a relative molecular weight of 32000 Mr was expressed as inclusion bodies. The protein was then purified and renatured for immunization. The titer of the polyclonal antibody was greater than 1 10 6. Western-blot analysis indicated that the antibody specifically reacted with rp450 and recognized the native German cockroach microsome P450. Conclusion The expressed CYP4G19 fusion protein was antigenic. The CYP4G19 polyclonal antibody may be used for further characterization of the German cockroach CYP4G19 protein, especially for the further studies of the development of pesticide resistance. Key words German cockroach; cytochrome P450; prokaryotic expression; CYP4G19 recombination protein; polyclonal antibody : (No.8151802003000002) : (1983-),,, * : (1963-),,,,E-mail:renlizhang@tom.com
592 Journal of Tropical Medicine Vol.9 No.6 Jun. 2009,, 1.2.2 GenBank CYP4G19, (AA020251.1)ExPASy ProtScale [1],,, 100~350 (mixed-function oxidase,mfo), 750bp P450(cytochrome P450,CYP450), CYP4G19 cds (AY176056.1) P450 GATATTGAGTT 3,( Nhe );, MFO,CYP4G19 R:5 CGGGAATTCTTAGTCATGACCCTCA 3, P450 ( EcoRI ), 1.2.3 cdna [2] P450, CYP4G19 F CYP4G19 R, 2 Taq, Platinum PCR Master Mix PCR,PCR, 94 5 min,94 1 min,55 1 min,72 1 min, P450, 30 ;72 10 min PCR 1%, Promega Wizard 誖 SV, P450 PCR pgem-t Easy 4 NCBI P450, Top10, 7, (100 μg / ml) LB, CYP4G19 2003 Pridgeon [3 ] PCR, Invitrogen (selected subtractive hybridization,ssh) NCBI Blast P450, CYP4G19 1.2.4 NheI EcoRI, CYP4G19 pgem-t / CYP4G19 pet-28a, 1 1.1 1.1.1 1.2.5 pet-28a / CYP4G19 1.1.2 2 Taq Platinum PCR Master Mix TIANGEN ;T 4 DNA Nhe EcoRI ( ) ;AxyPrep Multisource Total RNA Miniprep Kit Axygen ;Super Script TM First- Strand Synthesis System for RT-PCR Invitrogen ; Wizard 誖 SV Gel and PCR Clean-Up System Promega ; Plasmid Miniprep Kit Omega ; His, SDS-PAGE Sigma ;IgG Pierce ; 1.2.6 pet-28a Top10 BL21(DE3) TIANGEN ;pgem-t easy,, 8 Promega ; pet-28a mmol / L (50 mmol / L Tris-HCl, 200 mmol / L, CYP4G19 F:5 GTTGCTAGCCCAAGG PCR CYP4G19 16, Top10, (50 μg / ml) LB, PCR BL21(DE3), (50 μg / ml) LB,37 1% LB, 37 220 r / min (OD 600 0.5~1.0), 1 ml, IPTG 0.5 mmol / L,37 180 r / min,,50 mmol / L Tris-HCl, His 6 NaCl, ph 8.0), 1.2 100 mmol / L, 1.2.1 4~5, 500 mmol / L AxyPrep Multi-source Total RNA, Washing Miniprep Kit RNA 1 μg RNA 10 μl Buffer Elution Buffer,Invitrogen cdna 1.2.7
2009 6 9 6 593 (2 mol / L,50 mmol / L Tris-HCl,1 mmol / L EDTA,20 mmol / L β-me,ph7.4),4 3 h, (20 mmol / L Tris-HC1,1 mmol / L EDTA,pH7.4),, 1.2.8 Western-blot SDS- (CYP4G19 CDS 1025 ) PAGE PVDF, 5%,G A(2), His (1 2000 ),, HRP IgG (1 2000 ),,DAB 1.2.9 P450 8 Balb / c 10 P450 3, 50 μg /,,2,,2, PBS 2,,,,-20 1.2.10 ELISA rcyp4g19, 5 μg / ml 1 PCR, 100 μl,, PBST Fig.1 Amplification of goal gene from German cockroach cdna, M: DL2000 DNA marker; 1: PCR product of goal gene., HRP IgG (5000 ), ELISA (HRP-TMB),2.2,, Nhe I EcoRI, 1% 450 / 630nm OD, OD 450, 771bp OD 450 2.1, OD 450 / OD 450 >2.1 pet-28a (3) 1 10 3 10 1 10 6 2.3 1.2.11 1~2 IPTG, 12% SDS-PAGE,,,2 ml /,32000 Mr, (0.1 mol / L,pH7.5),4 (4),, 30 min 4,11000 g, 10 min,, 4,106000 g, 60 min, Ni 2+ -NTA, 0.6 ml (30% ) (5), 10 ml, 2.4 Western-blot -70 1.2.12 Western-blot rp450, 32000 Mr (6) 10%SDS,, 2.5 CYP4G19 (1 2000 ) 2, ELISA HRP (1 2000 ), 1 10 6, rp450 DAB 2.6 rp450 Western-blot, CYP4G19, rp450, 32000 Mr 2 2.1 cdna, PCR, 771bp DNA ( 1) Invtrogen,GenBank ( AY176056.1) 99%, 5000bp, His, (7), 2.7 Western-blot
594 Journal of Tropical Medicine Vol.9 No.6 Jun. 2009 Fig.2 2 CYP4G19 Blast Blast analysis between the CYP4G19 clone gene and the GenBank report Fig.3 3 Nhe I EcoRI Identification of positive clone with goal gene by double enzyme digestion M: DL2000 DNA marker; 1: Goal gene; 2:pET-28a plasimid; 3, 4: Result of double enzyme digestion of positive clone. 4 DS-PAGE (rp450) Fig.4 Expression analysis of rp450 induced by IPTG CYP4G19 M:Prestained protein ladder; 1: Inducation of pet-28a without, 62000 Mr P450 gene; 2: Noninducation of pet-28a with P450 gene; 3,4:, 62000 Mr Inducation of pet-28a with P450 gene for 4 h,6 h; 5:Inducation, (8) of pet-28a with P450 gene overnight.
2009 6 9 6 595 Fig.5 5 rp450 SDS-PAGE DS-PAGE analysis of rp450 purification M: Unstained protein molecular weight marker ; 1: Total protein; 2: Flow-through; 3: Wash; 4: Elution; 5: Renaturation. 8 CYP4G19 Western-blot Fig.8 Western-blot analysis of German cockroach CYP4G19 polyclonal antibody and microsome protein reactive specificity M: Prestained protein ladder ; 1: Microsome protein of German cockroaches;2: Western-blot analysis of microsome protein with nonimmune serum as first antibody ;3: Western-blot anaysis of microsome protein with ployclonal antibody as first antibody. 3 6 Fig.6 rp450 Western-blot Western-blot analysis of purified rp450 M: Prestained protein ladder ; 1: Inducation of pet-28a without P450 gene; 2: Purified rp450. 7 Fig.7 CYP4G19 Western-blot Western-blot analysis of German cockroach CYP4G19 polyclonal antibody specificity M: Prestained protein ladder ; 1: Purified rp450; 2: Total protein of pet-28a;a: Western-blot analysis with ployclonal antibody as first antibody;b: Western-blot anaysis with nonimmune serum as first antibody. A B P450, P450 8 (CYP4,CYP6,CYP9, CYP12, CYP15, CYP18, CYP28, CYP48),, P450 P450 P450 CYP4G19 Pridgeon [3] SSH P450, 1638bp, 546 Northern blot [3] mrna, CYP4G19, RNA CYP4G19, P450,, P450 1998,Scharf [4] - (immobilized artificial membrane high performance liquid chro-matography,iam-hplc) Munsyana (MA) P450, P450 MA
596 Journal of Tropical Medicine Vol.9 No.6 Jun. 2009,, DAB, CYP4G19, 62000,, Mr, CYP4G19, ExPAsy CYP4G19, 61825.6 Mr CYP4G19 P450, P450, 62000 Mr CYP4G19,,,, CYP4G19, [5], CYP4G19 CYP4G19, CYP4G19 ExPASy ProtScale, 750bp T-A [ ], GenBank CYP4G19 cds 99%,, 1997, 8(3):236-239. CYP4G19 [2] Scott JG. Cytochromes P450 and insecticide resistance [J]., Insect Biochem Mol Biol, 1999, 29(9):757-777. [3] Pridgeon JW, Zhang L, Liu N. Overexpression of CYP4G19 6 His pet-28a, 6 His associated with a pyrethroid-resistant strain resistant strain of, N the German cockroach, Blattella germanica (L.) [J]. Gene, 2003, 314:157-163. 6 His, Ni 2+ [4] Scharf ME, Neal JJ, Marcus CB, et al. Cytochrome P450, purification and immunological detection in an insecticide CYP4G19 pet-28a resistant strain of German cockroach (Blattella germanica,l.), [J]. Insect Biochem Mol Biol, 1998, 28(1):1-9.,, [5],,,. P450 3A4 ELISA, 2007, 23(1):79-81., 1 10 6, [6],,. PBS OD 32.8, 2.1, 1 10 6,, 2004, 15(3):175-179. [7] Western-blot,,,. P450 [J]., CYP4G19 P450 CYP4G19 2007, 27(12):1722-1725. DAB 32000 Mr [8] Scharf ME, Lee CY, Neal JJ, et al. Cytochrome P450 MA, expression in insecticide-resistant German cockroaches (Dictyoptera:Blattellidae) [J]. J Econ Entomol,1999,92 (4): DAB, : 788-793. 1 P450, ;2 [9],. sige P450 ; 3 [J]., 2007,7(8):726-728. [4,6-8] P450, [10],,,.,P450, [J]., 2007,7(9):856-858. P450 [1],. [J]. [J]. P450 [J]. ( :2008-10-24; :2009-02-06)