P450 CYP4G19. Prokaryotic Expression of German cockroach Cytochrome P450 CYP4G19 Gene and Preparation of Polyclonal Antibody , 518060; 2.

Σχετικά έγγραφα
α 1 2- Cloning and Expression of alpha 1 2-fucosyltransferase in E. coli BIOTECHNOLOGY BULLETIN

Shiraia sp. Slf14 III

JOURNAL OF MICROBIOLOGY May 2011 Vol. 31 No. 3. PCR bp BCCP. pet-28a Escherichia coli BL21 DE3 Ni-NTA

, SLC26A4 HEK 293. The construction of wild-type SLC26A4 gene expression vector and the expression in HEK293 cells

Journal of Shanghai Normal University Natural Sciences Feb SNAT2. HEK293T Western blot SNAT2 - HA Q 31 A

JEV C RNA 11kb 3. Japanese encephalitis virus JEV JEV C 7. C E prm C 1 RNA. Gold pgbkt7 pgadt7- T pgbkt7-53 pgbkt7- JEV C PCR JEV C cdna

svari Real-time RT-PCR RSV

«ΠΡΟΜΗΘΕΙΑ ΕΞΟΠΛΙΣΜΟΥ ΕΡΓΑΣΤΗΡΙΟΥ»

(Pseudorabies,PR) , ge. , ( Pichia pastoris) ppic9k, ,Multi2Copy Pichia Expression Kit Invitrogen, Vol. 42 October No. 5

CHAPTER INTRODUCTION... 1 CHAPTER REVIEW OF LITERATURE...

30s 56 60s 72 60s dntp cm s s s 23

Affinity chromatography for the purification of glutathione S-transferase from Oxya chinensis

1., Specificity and Epitope Mapping of Four Monoclonal Antibodies. against SARS-CoV Nucleocapsid Protein

Studies on purification and characteristics of glycosyltransferase from an engineering strain

ΜΟΡΙΑΚΕΣ ΜΕΘΟΔΟΙ ΚΡΙΤΗΡΙΑ ΕΠΙΛΟΓΗΣ ΑΞΙΟΛΟΓΗΣΗ

Copper-catalyzed formal O-H insertion reaction of α-diazo-1,3-dicarb- onyl compounds to carboxylic acids with the assistance of isocyanide

Angioarrestin( harp1) C FD

Vol. 39 No Journal of Jiangxi Normal University Natural Science Jan Western blot %. 40 kda

Ara h 2. pet - 32a + Origami. Western blotting ELISA SDS - PAGE Ara h 2 F - Ara h 2. IgE

Nucleotide Sequence of Cloned cd NA for alpha Subunit of Goat Follicle Stimulating Hormone

Study on AgrobacteriunΟmediated transformation of tobacco plant with rol C gene

Supporting Information. Asymmetric Binary-acid Catalysis with Chiral. Phosphoric Acid and MgF 2 : Catalytic

IL - 13 /IL - 18 ELISA PCR RT - PCR. IL - 13 IL - 18 mrna. 13 IL - 18 mrna IL - 13 /IL Th1 /Th2

SCIENTIA SILVAE SINICAE. a/ b. oldhamii). The length of cab2bo1 ( GenBank accession

Science of Sericulture

Chinese Journal of Biochemistry and Molecular Biology CK2 252

SOD SNP % Cu /Zn-SOD. DAM- BE DNAStar % Mn /Fe-SOD. 6 1SNP /17. 9 bp

http / /cjbmb. bjmu. edu. cn Chinese Journal of Biochemistry and Molecular Biology

Extract Isolation Purification and Identification of Polysaccharides from Exocarp of Unripe Fruits of Juglans mandshurica

Molecular Cloning of MUC1ΠY and Soluble Expression of Its

Studies on the Binding Mechanism of Several Antibiotics and Human Serum Albumin

http / /xuebao. jxau. edu. cn. orfh79 orfh79 pet - 28a - orfh79 pgex5x orfh79

CK2, Basic Medical Sciences and Clinics (4) ( Π ) pt727 ( CIP), (TSR) 6 ( POP6) ( IPTG),, A,

A Systematic Review of Procalcitonin for Early Detection of Septicemia of Newborn

Gateway cdna. cdna. pdest TM ~ cfu/ ml ~ cfu bp

Expression and Purification of HIV-1 Protease and the Establishment. of a Method for Protease Inhibitor Screening

TGFp FSH INH INH

Optimizing Microwave-assisted Extraction Process for Paprika Red Pigments Using Response Surface Methodology

BL21 (D E3)2p E T28a ( + )2bgl 2

Αθήνα, 15 Οκτωβρίου 2014 Αρ. Πρωτ.: 2988

Πρόσκληση υποβολής προσφοράς

Supplementary Table 1. Construct List with key Biophysical Properties of the expression

BGP TRACP-5b BGP TRACP-5b P 0.05

Resistance monitoring and target gene cloning of Bemisia tabaci Q-biotype from Jiangsu Province

, DYY-8B, ; : Centrifuge 11 R. min

The toxicity of three chitin synthesis inhibitors to Calliptamus italicus Othoptera Acridoidea

8Q5SAC) 8Q5SAC UV2Vis 8500 ( ) ; PHS23C ) ;721 ( ) :1 4. ;8Q5SAC : molπl ;Britton2Robinson Q5SAC BSA Britton2Robinson,

High mobility group 1 HMG1

Tan Xiaofeng Chen Hongpeng Zhang Dangquan Zeng Yanling Li Wei Jiang Yao Xie Lushan Hu Xiaoyi Hu Fangming. and Technology Changsha )

MSM Men who have Sex with Men HIV -

Supporting Information

Identification of Fish Species using DNA Method

Humanization of Ovarian Carcinoma Anti2idiotype Single2chain

Antimicrobial Ability of Limonene, a Natural and Active Monoterpene

DNA G7444A, 2. Study on a new point mutation of nt7444 G A in the mitochondrial DNA in a type 2 diabetes mellitus family

(bovine herpesvirus type 1, BHV1,. (infectious bovine rhinotracheitis, IBR) (infectious pustular vulvovaginitis, IPV) 3, 1.1, 1.2a 1.2b [5].

1 h, , CaCl 2. pelamis) 58.1%, (Headspace solid -phase microextraction and gas chromatography -mass spectrometry,hs -SPME - Vol. 15 No.

Abstract... I. Zusammenfassung... II. 1 Aim of the work Introduction Short overview of Chinese hamster ovary cell lines...

Chinese Journal of Biochemistry and Molecular Biology. ( OsSUT2) 6314 kd, E2mail : edu. cn

Accumulation of Soil Arsenic by Panax notoginseng and Its Associated Health Risk

A facile and general route to 3-((trifluoromethyl)thio)benzofurans and 3-((trifluoromethyl)thio)benzothiophenes

http / / cjbmb. bjmu. edu. cn Chinese Journal of Biochemistry and Molecular Biology H 2 O 2 AKT2 TUNEL DNA ladder AKT2 sirna PI3K / AKT

Free Radical Initiated Coupling Reaction of Alcohols and. Alkynes: not C-O but C-C Bond Formation. Context. General information 2. Typical procedure 2

BD OptEIA ELISA Sets ELISA

,HLA2B2704,, The Technique of Producing HLA2B2704 Gene Transgenic Mice. Chinese Journal of Biochemistry and Molecular Biology HLA2 B2704 ,1,2 Q33,Q78

LfcinB. Expression and Iden tif ica tion of Lfc inb Gene in P ich ia pastoris

Mandelamide-Zinc Catalyzed Alkyne Addition to Heteroaromatic Aldehydes

Supplementary Material

*,* + -+ on Bedrock Bath. Hideyuki O, Shoichi O, Takao O, Kumiko Y, Yoshinao K and Tsuneaki G

College of Life Science, Dalian Nationalities University, Dalian , PR China.

CorV CVAC. CorV TU317. 1

PCR. Site-directed Mutagenesis of Sumf 1 Gene of Mouse Based on Overlap Extension PCR and Construction of Eukaryotic Expression Vector

Comparison of HPLC fingerprint between enzymatic Calculus bovis and natural Calculus bovis

Basic & Clinical Medicine PLGA MUC1 MUC1 IC 50 MUC1 +

A/A Είδος Προδιαγραφές

Preparation and Characterization of a Novel Recombinant Imaging Agent Directing Thrombus

HIV HIV HIV HIV AIDS 3 :.1 /-,**1 +332

NOVEL INTEGRAL MEMBRANE PROTEINS OF THE INNER NUCLEAR MEMBRANE

1 (forward modeling) 2 (data-driven modeling) e- Quest EnergyPlus DeST 1.1. {X t } ARMA. S.Sp. Pappas [4]

ACTA SCIENTIAE CIRCUMSTANTIAE. 16S rrna PNAN5 ( Rhodococcus sp. strain PNAN5). 20. ( Institute of Microbiology, Chinese Academy of Sciences,

ΟΔΗΓΟΣ ΓΙΑ ΤΗΝ ΑΠΟΣΤΟΛΗ ΔΕΙΓΜΑΤΩΝ SEQUENCING. Sample Requirements

Escherichia coli (LFD1).

M. marburgensis DX01 M. thermoautotrophicus M. marburgensis Marburg. MCR I mrna

* ** *** *** Jun S HIMADA*, Kyoko O HSUMI**, Kazuhiko O HBA*** and Atsushi M ARUYAMA***

Cellular Physiology and Biochemistry

9-amino-(9-deoxy)cinchona alkaloids-derived novel chiral phase-transfer catalysts

Protease-catalysed Direct Asymmetric Mannich Reaction in Organic Solvent

PrP C. PrP SC PrP. PrP. mrna

Οδηγίες χρήσης Elucigene TRP

ΤΕΧΝΟΛΟΓΙΚΟ ΠΑΝΕΠΙΣΤΗΜΙΟ ΚΥΠΡΟΥ ΣΧΟΛΗ ΓΕΩΠΟΝΙΚΩΝ ΕΠΙΣΤΗΜΩΝ ΒΙΟΤΕΧΝΟΛΟΓΙΑΣ ΚΑΙ ΕΠΙΣΤΗΜΗΣ ΤΡΟΦΙΜΩΝ. Πτυχιακή εργασία

Identification of Salmonella,Campylobacter jejuni and Enterohemorrhagic E.coli by Denaturing High-performance Liquid Chromatography

Supporting Information

Divergent synthesis of various iminocyclitols from D-ribose

Εθνικό Μετσόβιο Πολυτεχνείο ΑΝΑΠΤΥΞΗ ΤΕΧΝΙΚΗΣ ΜΕΤΡΗΣΗΣ ΕΚΚΡΙΣΗΣ ΠΡΩΤΕΪΝΩΝ ΚΟΝΤΑ ΣΤΗ ΚΥΤΤΑΡΙΚΗ ΕΠΙΦΑΝΕΙΑ

Supporting Information

Metal-free Oxidative Coupling of Amines with Sodium Sulfinates: A Mild Access to Sulfonamides

ΠΡΟΣΚΛΗΣΗ ΕΚΔΗΛΩΣΗΣ ΕΝΔΙΑΦΕΡΟΝΤΟΣ ΠΡΟΜΗΘΕΙΑ ΑΝΤΙΔΡΑΣΤΗΡΙΩΝ ΕΡΓΑΣΤΗΡΙΟΥ (CPV: )

Chinese Journal of Biochemistry and Molecular Biology ERR . I2 (TNNI2) GST2TNNI2, 1. 1

http / / cjbmb. bjmu. edu. cn Chinese Journal of Biochemistry and Molecular Biology T7Select10-3b MCS cdna 3' 6 cdna.

Ειδικό πρόγραμμα ελέγχου για τον ιό του Δυτικού Νείλου και την ελονοσία, ενίσχυση της επιτήρησης στην ελληνική επικράτεια (MIS )

Transcript:

2009 6 9 6 [ ] 1672-3619(2009)06-0591-06 591 P450 CYP4G19 1,2 1,2*,, 2, 2, 2, 2 1, (1., 518060; 2., 518020) P450 CYP4G19, CYP4G19 RT-PCR CYP4G19, T-A, pet-28a, BL21 (DE3),,,, ELISA Western-blot cdna 771bp, 32000 Mr P450, 1 10 6 Western-blot 32000 Mr, P450 CYP4G19 CYP4G19, CYP4G19 ; P450; ; CYP4G19 ; :R384.9 :A Prokaryotic Expression of German cockroach Cytochrome P450 CYP4G19 Gene and Preparation of Polyclonal Antibody ZHAO Xia 1,2, ZHANG Ren-li 1,2*, GEN Yi-jie 2, HUANG Da-na 2, GAO Shi-tong 2, LI Xiao-hen 2, HU Zhang-li 1 (1. College of Life Science, Shenzhen University, Shenzhen 518060; 2.Shenzhen Center for Diseases Control and Prevention, Shenzhen 518020, China) Abstract Objective To construct prokaryotic expression vector carrying a partial German cockroach cytochrome P450 CYP4G19 gene, and to express the recombinant protein in E. coil. Using the purified fusion protein for the production of polyclonal antibody. Method Part of the CYP4G19 gene was amplified by RT-PCR. PCR products were ligated to the cloning vector pgem T-easy. The positive clones were sequenced and then subcloned into prokaryotic expression vector pet-28a. The constructed pet-28a-cyp4g19 vetor was transformed to E.coil BL21 (DE3) and the recombinant P450 protein (rp450) was expressed. rp450 was then purified using Ni + affinity column chromatography. Balb / c mice were then immunized using the purified rp450 and the titer of the polyclonal antibody was determined by ELISA. The specificity of the antibody was confirmed by Western-blot. Result A hydrophilic fragment of 771bp was cloned from the German cockroach cdna. The recombinant protein with a relative molecular weight of 32000 Mr was expressed as inclusion bodies. The protein was then purified and renatured for immunization. The titer of the polyclonal antibody was greater than 1 10 6. Western-blot analysis indicated that the antibody specifically reacted with rp450 and recognized the native German cockroach microsome P450. Conclusion The expressed CYP4G19 fusion protein was antigenic. The CYP4G19 polyclonal antibody may be used for further characterization of the German cockroach CYP4G19 protein, especially for the further studies of the development of pesticide resistance. Key words German cockroach; cytochrome P450; prokaryotic expression; CYP4G19 recombination protein; polyclonal antibody : (No.8151802003000002) : (1983-),,, * : (1963-),,,,E-mail:renlizhang@tom.com

592 Journal of Tropical Medicine Vol.9 No.6 Jun. 2009,, 1.2.2 GenBank CYP4G19, (AA020251.1)ExPASy ProtScale [1],,, 100~350 (mixed-function oxidase,mfo), 750bp P450(cytochrome P450,CYP450), CYP4G19 cds (AY176056.1) P450 GATATTGAGTT 3,( Nhe );, MFO,CYP4G19 R:5 CGGGAATTCTTAGTCATGACCCTCA 3, P450 ( EcoRI ), 1.2.3 cdna [2] P450, CYP4G19 F CYP4G19 R, 2 Taq, Platinum PCR Master Mix PCR,PCR, 94 5 min,94 1 min,55 1 min,72 1 min, P450, 30 ;72 10 min PCR 1%, Promega Wizard 誖 SV, P450 PCR pgem-t Easy 4 NCBI P450, Top10, 7, (100 μg / ml) LB, CYP4G19 2003 Pridgeon [3 ] PCR, Invitrogen (selected subtractive hybridization,ssh) NCBI Blast P450, CYP4G19 1.2.4 NheI EcoRI, CYP4G19 pgem-t / CYP4G19 pet-28a, 1 1.1 1.1.1 1.2.5 pet-28a / CYP4G19 1.1.2 2 Taq Platinum PCR Master Mix TIANGEN ;T 4 DNA Nhe EcoRI ( ) ;AxyPrep Multisource Total RNA Miniprep Kit Axygen ;Super Script TM First- Strand Synthesis System for RT-PCR Invitrogen ; Wizard 誖 SV Gel and PCR Clean-Up System Promega ; Plasmid Miniprep Kit Omega ; His, SDS-PAGE Sigma ;IgG Pierce ; 1.2.6 pet-28a Top10 BL21(DE3) TIANGEN ;pgem-t easy,, 8 Promega ; pet-28a mmol / L (50 mmol / L Tris-HCl, 200 mmol / L, CYP4G19 F:5 GTTGCTAGCCCAAGG PCR CYP4G19 16, Top10, (50 μg / ml) LB, PCR BL21(DE3), (50 μg / ml) LB,37 1% LB, 37 220 r / min (OD 600 0.5~1.0), 1 ml, IPTG 0.5 mmol / L,37 180 r / min,,50 mmol / L Tris-HCl, His 6 NaCl, ph 8.0), 1.2 100 mmol / L, 1.2.1 4~5, 500 mmol / L AxyPrep Multi-source Total RNA, Washing Miniprep Kit RNA 1 μg RNA 10 μl Buffer Elution Buffer,Invitrogen cdna 1.2.7

2009 6 9 6 593 (2 mol / L,50 mmol / L Tris-HCl,1 mmol / L EDTA,20 mmol / L β-me,ph7.4),4 3 h, (20 mmol / L Tris-HC1,1 mmol / L EDTA,pH7.4),, 1.2.8 Western-blot SDS- (CYP4G19 CDS 1025 ) PAGE PVDF, 5%,G A(2), His (1 2000 ),, HRP IgG (1 2000 ),,DAB 1.2.9 P450 8 Balb / c 10 P450 3, 50 μg /,,2,,2, PBS 2,,,,-20 1.2.10 ELISA rcyp4g19, 5 μg / ml 1 PCR, 100 μl,, PBST Fig.1 Amplification of goal gene from German cockroach cdna, M: DL2000 DNA marker; 1: PCR product of goal gene., HRP IgG (5000 ), ELISA (HRP-TMB),2.2,, Nhe I EcoRI, 1% 450 / 630nm OD, OD 450, 771bp OD 450 2.1, OD 450 / OD 450 >2.1 pet-28a (3) 1 10 3 10 1 10 6 2.3 1.2.11 1~2 IPTG, 12% SDS-PAGE,,,2 ml /,32000 Mr, (0.1 mol / L,pH7.5),4 (4),, 30 min 4,11000 g, 10 min,, 4,106000 g, 60 min, Ni 2+ -NTA, 0.6 ml (30% ) (5), 10 ml, 2.4 Western-blot -70 1.2.12 Western-blot rp450, 32000 Mr (6) 10%SDS,, 2.5 CYP4G19 (1 2000 ) 2, ELISA HRP (1 2000 ), 1 10 6, rp450 DAB 2.6 rp450 Western-blot, CYP4G19, rp450, 32000 Mr 2 2.1 cdna, PCR, 771bp DNA ( 1) Invtrogen,GenBank ( AY176056.1) 99%, 5000bp, His, (7), 2.7 Western-blot

594 Journal of Tropical Medicine Vol.9 No.6 Jun. 2009 Fig.2 2 CYP4G19 Blast Blast analysis between the CYP4G19 clone gene and the GenBank report Fig.3 3 Nhe I EcoRI Identification of positive clone with goal gene by double enzyme digestion M: DL2000 DNA marker; 1: Goal gene; 2:pET-28a plasimid; 3, 4: Result of double enzyme digestion of positive clone. 4 DS-PAGE (rp450) Fig.4 Expression analysis of rp450 induced by IPTG CYP4G19 M:Prestained protein ladder; 1: Inducation of pet-28a without, 62000 Mr P450 gene; 2: Noninducation of pet-28a with P450 gene; 3,4:, 62000 Mr Inducation of pet-28a with P450 gene for 4 h,6 h; 5:Inducation, (8) of pet-28a with P450 gene overnight.

2009 6 9 6 595 Fig.5 5 rp450 SDS-PAGE DS-PAGE analysis of rp450 purification M: Unstained protein molecular weight marker ; 1: Total protein; 2: Flow-through; 3: Wash; 4: Elution; 5: Renaturation. 8 CYP4G19 Western-blot Fig.8 Western-blot analysis of German cockroach CYP4G19 polyclonal antibody and microsome protein reactive specificity M: Prestained protein ladder ; 1: Microsome protein of German cockroaches;2: Western-blot analysis of microsome protein with nonimmune serum as first antibody ;3: Western-blot anaysis of microsome protein with ployclonal antibody as first antibody. 3 6 Fig.6 rp450 Western-blot Western-blot analysis of purified rp450 M: Prestained protein ladder ; 1: Inducation of pet-28a without P450 gene; 2: Purified rp450. 7 Fig.7 CYP4G19 Western-blot Western-blot analysis of German cockroach CYP4G19 polyclonal antibody specificity M: Prestained protein ladder ; 1: Purified rp450; 2: Total protein of pet-28a;a: Western-blot analysis with ployclonal antibody as first antibody;b: Western-blot anaysis with nonimmune serum as first antibody. A B P450, P450 8 (CYP4,CYP6,CYP9, CYP12, CYP15, CYP18, CYP28, CYP48),, P450 P450 P450 CYP4G19 Pridgeon [3] SSH P450, 1638bp, 546 Northern blot [3] mrna, CYP4G19, RNA CYP4G19, P450,, P450 1998,Scharf [4] - (immobilized artificial membrane high performance liquid chro-matography,iam-hplc) Munsyana (MA) P450, P450 MA

596 Journal of Tropical Medicine Vol.9 No.6 Jun. 2009,, DAB, CYP4G19, 62000,, Mr, CYP4G19, ExPAsy CYP4G19, 61825.6 Mr CYP4G19 P450, P450, 62000 Mr CYP4G19,,,, CYP4G19, [5], CYP4G19 CYP4G19, CYP4G19 ExPASy ProtScale, 750bp T-A [ ], GenBank CYP4G19 cds 99%,, 1997, 8(3):236-239. CYP4G19 [2] Scott JG. Cytochromes P450 and insecticide resistance [J]., Insect Biochem Mol Biol, 1999, 29(9):757-777. [3] Pridgeon JW, Zhang L, Liu N. Overexpression of CYP4G19 6 His pet-28a, 6 His associated with a pyrethroid-resistant strain resistant strain of, N the German cockroach, Blattella germanica (L.) [J]. Gene, 2003, 314:157-163. 6 His, Ni 2+ [4] Scharf ME, Neal JJ, Marcus CB, et al. Cytochrome P450, purification and immunological detection in an insecticide CYP4G19 pet-28a resistant strain of German cockroach (Blattella germanica,l.), [J]. Insect Biochem Mol Biol, 1998, 28(1):1-9.,, [5],,,. P450 3A4 ELISA, 2007, 23(1):79-81., 1 10 6, [6],,. PBS OD 32.8, 2.1, 1 10 6,, 2004, 15(3):175-179. [7] Western-blot,,,. P450 [J]., CYP4G19 P450 CYP4G19 2007, 27(12):1722-1725. DAB 32000 Mr [8] Scharf ME, Lee CY, Neal JJ, et al. Cytochrome P450 MA, expression in insecticide-resistant German cockroaches (Dictyoptera:Blattellidae) [J]. J Econ Entomol,1999,92 (4): DAB, : 788-793. 1 P450, ;2 [9],. sige P450 ; 3 [J]., 2007,7(8):726-728. [4,6-8] P450, [10],,,.,P450, [J]., 2007,7(9):856-858. P450 [1],. [J]. [J]. P450 [J]. ( :2008-10-24; :2009-02-06)