ISSN 100727626 CN 1123870ΠQ 2001 10 Chinese Journal of Biochemistry and Molecular Biology 17 (5) :541 546 ( H2 ) 3 ( 650118) ( H2 ) (HAVH2K7) KMB17 28 d 14 d 22 1 1024 lgccid 50 ( ml) 7183 6 22 AC2PCR PCR p GEM2T cdna 2 HAVH2K7 6 6 0107 % 3 VP2 (A2S) ;2C(N2H) ;3A(R2C) 22 18 0124 % 13 5 (5 UTR) 5 7 4 6 (2C Q2P ;3A A2S ;3C T2A ;3D V2G) 2C 4 6 3 1 5 UTR 2C H2 R512 Q754 Sequencing and Comparison of Two2passage Genomes of Fast2growth Isolates of Attenuated Hepatitis A Virus( H2 Strain) in KMB17 Cells HU Ning2zhu HU Yun2zhang 3 SHI Hai2jing QU Su SHAO Cong2wen LIU Guo2dong ( Institute of Medical Biology Chinese Academy of Medical Sciences Peking Union Medical College Kunming 650118 China) Abstract The complete genomes of two2passage isolates of live attenuated hepatitis A virus(hav H2 Strain) in KMB17 cells were sequenced and compared in order to study the mechanism of cellular adaptation of HAV During 222passage adaptation the replicating cycle was shortened from 28 days to 14 days antigenic and infec2 tious titer increased with increasing passages At passage 22 antigenic titer and infectious titer (lgccid 50 per ml) reached 1 1024 and 7 83 respectively The sequence alignment of passages 6 ( HAVH2 K7P6) and 22 ( HAVH2 K7P22) with original passage ( HAVH2 K7) showed that mutations of genomes increased with increas2 ing passages and most of the mutations were concentrated in 5 untranslated region (5 UTR) and 2C coding re2 gion HAVH2K7P6 showed only difference of 0 07 % with HAVH2K7 and only six nucleotide mutations in the whole genome all in open reading frame (ORF) resulting in the three amino acids exchanges A to S exchange in structural protein VP2 ;N to H exchange in nonstructural protein 2C ;R to C exchange in nonstructural pro2 tein 3A However there were eighteen nucleotide mutations in the genome of HAVH2 K7P22 five mutations in :2001203215 ; :2001205214 3 Tel : (0871) 8334483 E2mail :huyunz @21cn com 1961 7 Received :March 15 2001 ;Accepted :May 14 2001 3 Corresponding author Tel : (0871) 8334483 E2mail :huyunz @21cn com
542 17 5 UTR thirteen in ORF resulting in seven amino acids exchanges four mutations were new in addition to three common mutations with HAVH2K7P6 one Q to P exchange in 2C protein ;A to S in 3A ;T to A in 3C ;V to G in 3D In addition to 5 UTR the 2C coding region was more mutating region with four nucleotide mutations re2 sulting in one amino acid exchange The analysis showed that 5 UTR and 2C coding region play an important role in adaptation of HAVH2K7 in KMB17 cells Key words live attenuated hepatitis A virus H2 strain cellular adaptation fast growth genome sequence analysis (hepatitis A virus HAV) 113 10 HAV ( Picornavirus) 110 mlπ (25 cm 2 ) KMB17 ( Hepatovirus) RNA 4 37 2 h 35 24 28 HAV 715 kb d 3 ELISA HAV (ORF) 2227 Reed2Muench 5 2P12P22P323 P1 4 ELISA (VP4 VP2 VP3 VP1) P2 P3 114 [10 ] 7 (2A 2B 2C 3A 3B 3C 3D) 5 H2 Goldkey 3 5 (5 UTR) (Table 1) Fig 1 734 ;3 (3 UTR) 63 115 AC2PCR RT2PCR Poly(A) [1 5 ] HAV HAVK7P6) (22 HAVK7P22) PCR ( AC2PCR) PCR 2HAV Eppendorf 1 2 HAV H 2 PBS 60 1 10 1 10 PCR (500 mmolπl KCl 100 [6 ] mmolπl Tris2HCl ph8 3 15 mmolπl MgCl 2 0 1 %Gel2 HAV 5 UTR 2B 2C 3A atin) 16 1 1 25 mmolπl dntp 100 ng 2BΠ2C (polyt) 98 3 5 min [7 9 ] HAV RNA 1 1 RNasin HAV ( H2M20K7) ( Promega) 1 1 M2MLV RT ( Gibco BRL) 37 1 h cdna 100 ng 0 5 1 Taq DNA PCR PCR : 95 30 s 55 30 s 72 60 90 s 30 PCR 112 % 1 111 116 PCR HAV(H2 ) cdna ( TaKaRa) H2M20K7 ; T4 DNA ( TaKaRa) p GEM2T ( Pro2 KMB17 mega) DH5 X2gal IPTG 24 35 LB 37 112 ABI377 KMB17 27 d 7 PCR 2 2 3 H2M20K7 KMB17 OMEGA 35 14 d 22 KMB17 ( 6
5 : (H2 ) 543 Fig 1 Sequencing strategy of HAV genome A2I represent 9 amplified fragments of HAV Table 1 The primers used for amplification of HAV genomic RNA Cloned fragments Primers Sequences A(0 8 kb) A1 5 22CGCCGGCGTTCAAGAGGGGTGTCCGGAG223 A2 5 22GAATCTCAATGCCAAATCTTGC223 B(0 5 kb) B1 5 22TCTGAGGTACTCAGGGGC223 B2 5 22CAGTCAATGATGCTATAGAACC223 C(1 1 kb) C1 5 22CCAACAGGGGGGATTGATC223 C2 5 22CGTTAGAAGGAGAGGTCAATC223 D(1 0 kb) D1 5 22CCCTGGATTTCTGACACTC22C3 D2 5 22CAGTGGATAACATGGCATTTG223 E(1 1 kb) E1 5 22GTCTGTCACAGAACAATCAGA22G3 E2 5 22GATCCCAGAACAGATATCTCTTAA223 F(1 2 kb) F1 5 22GTTAAGAGATATCTGTTCTGGATC223 F2 5 22CCATCCTCCAACGAGCACTCC223 G(1 2 kb) G1 5 22CAGTTCTTTAGTCATGACAGTTG223 G2 5 22GCCATTGGATCAATTTCAGC223 H(1 1 kb) H1 5 22GAGTCCCATTTATCATCACA223 H2 5 22GTCCAATCAGATCAAGATTATC223 I(0 5 kb) I1 5 22GATTCTCTGTTATGGAGATG223 1) A2I represent 9 amplified fragments of HAV 2) 1 and 2 represent positively and negatively oriented primers respectively 2 I2 5 22TTTTTTTTTTTTTTTTTTTTTATTT223 211 HAV( H2) K7 HAV ( H2) K7 KMB17 28 d 35 14 d 6 1 7 1 22 8 1 1 ( 14 d) 9 1 10 1 (lgccid 50 ml) 5183 1 16 6 11 1 12 1 (P6) lgccid 50 ( ml) 6177 1 64 13 1 22 (P22) lgccid 50 ( ml) 14 7183 1 1 1024 ( Table 2) P22 16 1 2 4 6 8 10 12 d 14 d lgccid 50 ( ml) 7187 (Table 3) Table 2 Titers of different passages of HAVH2K7 in KMB17 for 14 days Passages Antigen titers Infectious titers(lgccid 50 per ml) 1 1 16 5183 2 1 8 515 3 1 16 5167 4 1 32 610 5 1 32 615 64 6177 64 6167 64 615 64 6167 128 6183 128 710 256 710 256 7117 256 710 15 1 256 7117 256 710 17 1 512 7117 18 1 512 7133 19 1 512 715 20 1 512 7167 21 1 1024 7167 22 1 1024 7183
544 17 Table 3 One2step growth dynamics of HAVH2K7P22 in KMB17 cells Post inoculation days Antigen titers Infectious titers(lgccid 50 per ml) 2 1 8 ND 3 4 1 16 610 6 1 32 6167 8 1 128 7117 10 1 512 715 12 1 1024 718 14 1 1024 7117 16 1 1024 710 18 1 1024 710 20 1 1024 6183 22 1 1024 710 24 1 1024 618 26 1 2048 615 3 Not determined 212 100 %) HAVH2K7 KMB17 HAV (14 d) 5 UTR 2C HAVH2K7 VP4 VP3 VP1 2A 3 UTR 28 d 14 d 2C 4968 A C N 6 22 6 VP2 858 1178 ; 2B 4022 3D 7256 6 5 UTR 5 2C 3 3A 1 3C 2 3D 2 13 22 5 (VP2 1178 2B 4022 2C 4802 3C 5336 3D 7256 ) ; 2C 4558 3A 5217 3C 5715 3D 6427 ( Table 4) 13 22 5 UTR 2C (Table 5) VP4 PV3 VP1 2A 3 UTR 6 22 ( 3 6 6 [10 HAVH2K7 99193 % 6 HAVH2 ] VP2 (2 ) 2B 2C 3A 3D [11 ] 1 2 VP2 HAVH2K7 858 G T A S HAV H 3A 5193 C T R C 3 [12 ] 0 07 % HAVH2K7P6 6 H2 KMB17 5 UTP ( 28 d 14 d) 22 22 18 HAVH2K7 22 14 d 99176 % 5 5 UTR VP2 (2 ) 2B (1 ) 2C(4 ( HAVH2K7P6) (HAVH2K7P22) ) 3A 3C 3D 1 6 (HAVH2K7) 5 UTR 5 ; : (1) ; 13 7 7 14 d ; (2) 54 % 18 9 HAV (5 UTR 5 UTR 2C P1 P2 P3 3 UTR) 5 UTR 2C
5 : (H2 ) 545 Table 4 Differences in the genome sequences and amino acids of the HAVH2K7 with that of HAVH2K7P6 and HAVH2K7P22 Nucleotide position Location Nucleotide HAVH2K7 HAVH2K7P6 HAVH2K7P22 33 5 UTR C C T 263 5 UTR T T C 378 5 UTR T T C 591 5 UTR A A G 646 5 UTR A A T Amino acids HAVH2K7 HAVH2K7P6 HAVH2K7P22 858 VP2 G T T A S S 1178 VP2 C T T I I I 4022 2B T C C I I I 4558 2C A A C Q Q P 4802 2C T T C A A A 4949 2C A A T T T T 4968 2C A C C N H H 5193 3A C T T R C C 5217 3A G G T A A S 5336 3C G G A L L L 5715 3C A A G T T A 6427 3D T T G V V G 7256 3D A T T A A A Table 5 Identity comparisons of nucleotide sequence of HAVH2K7 with that of HAVH2K7P6 and HAVH2K7P22 Genomic region HAVH2K7P6 ( %) HAVH2K7P22 ( %) Genome 99193 99176 5 UTR 100 99132 VP4 100 100 VP2 99171 99171 VP3 100 100 VP1 100 100 2A 100 100 2B 99174 99174 2C 9919 9916 3A 99142 98184 3B 100 98153 3C 100 99185 3D 99194 99186 3 UTR 100 100 2C HAVH2K7 6 2B 1 HAVH2K7 2C 1 1 (HAVH2K7P6) 6 22 6 2C 0107 % 3 (VP2 A2S ;2C 3 1 HAVH2 K7P22 N2H ;3A R2C) ( HAVH2K7P22) 2C 18 0124 % 7 4 3A HAVH2K7 6 1 HAVH2K7P6 (2C Q2P ; 3A A2S ; 3C T2A ;3D V2G) HAV 5 UTR [13 ] HAV 5 UTR 730 3 400 500 (internal ribosome entry segment IRES) [14 5 UTR ] HAVH2K7P6 5 UTR HAVH2K7P22 5 UTR 5 IRES Emerson [9 ] 2B 2C 2B 1 (R2C) 22
546 17 1 1 (A2S) 3C HAVH2K7P6 22 2 1 3D 6 1 22 1 (V2G) HAV 1999 42 :63 68 RNA 5 UTR 3 UTR P1 P2 P3 2B 2C 5 UTR [9 ] HAV HAV [8 9 ] to cell culture Virology 1993 194 :475 480 HAVH2K7 5 UTR RNA IRES 2B [8 9 ] HAVH2K7P22 5 11 UTR 2C 2B 1 5 UTR 2C HAVH2K7 KMB17 KMB17 ( References) 1 Najarian R Caput O Gee W Potter S J Renard A Merryweather J Van Nest GDina D Primary structure and gene organization of human hepa2 titis A virus Proc Natl Acad Sci USA 1985 82 :2627 2631 2 Cohen I J Tichehurst R J Purcell H R Burckler2White A Baroudy B M Complete nucleotide sequence of wild2type hepatitis A virus :Compar2 ison of different strains of hepatitis A virus and other picornaviruses J Virol 1987 61 :50 59 3 Paul V A Tada H von der Helm KWissel T Kiehn R Wimmer E Deinhardt E The entire nucleotide sequence of the genome of human hepatitis A virus (isolate MBB) Virus Res 1987 8 :153 171 4 Graff J Normann A Feinstone S M Flehmig B Nucleotide sequence of wild2type hepatitis A virus GBM in comparison with two cell culture2ada2 pted variants J Virol 1994 68 :548 554 5 Totsuka A Moritsugu Y Hepatitis A virus proteins Intervirology 6 Graff J Kasang C Normann A Pfisterer2Hunt M Feinstone M S Fleh2 mig B Mutational events in consecutive passages of hepatitis A virus strain GBM during cell culture adaptation Virology 1994 204 :60 68 7 Day S P Murphy P Brown E A Lemon S M Mutations within the 5 nonstructural region of hepatitis A virus RNA which enhance replication in BS2C21 cells J Virol 1992 66 :6533 6540 8 Emerson S U Huang Y KMcrill C Lewis M Purcell R H Mutations in both the 2B and 2C genes of hepatitis A virus are involved in adaptation to growth in cell cuture J Virol 1992 66 :650 654 9 Emerson S U Huang Y KPurcell R H 2B and 2C mutations are essen2 tial but mutations throughout the genome of HAV contribute to adaptation 10 11 (B ) (Mao Jiang2sen Xie Ru2 ying Huang Hai2ying Study on live attenuated hepatitis A vaccine I The experiment of different attenuated strains in rhesus monkeys Science in China Ser B 1987 (6) :625 630 H2 K7 ( ) ( Zhou De2jiu Cao Yi2yun Huang Xiao2qin Dong De2xiang Analysis of complete genome of live attenuated hepatitis A vaccine H2 strain K7 J Yunnan Univ) 1999 21 :170 174 12 Cohen I E Rosenblum Ticehurst R J Daemer J R Feinstone M S Pur2 cell H R Complete nucleotide sequence of an attenuated hepatitis A vir2 us :Comparison with wild2type virus Proc Natl Acad Sci USA 1987 84 : 2497 2501 13 Zhang H Chao Shi2fong Ping Li2hua Grace KClarke B Lemon M S An infectious cdna clone of a cytopathic hepatitis A virus : Genomic re2 gions associated with rapid replication and cytopathic effect Virology 1995 212 :686 697 14 Glass J M Jia X Summers F D Identification of the hepatitis A virus in2 ternal ribosome entry site : In Vitro and in vivo analysis of bicistronic RNAs containing the 5 noncoding region Virology 1993 193 :842 852