Re search Paper HPV112L1 HPV11 HPV HPV11. HPV11 VLPs, HPV(Human Papillomavirus, HPV) ( Papovaviridae), DNA, HPV( HPV16, 18) HPV HPV ,HPV ,90 %

Σχετικά έγγραφα
The present status and significance in implementation of prophylactic human papillomavirus vaccine in Japan

ER-Tree (Extended R*-Tree)

Comparison of carbon-sulfur and carbon-amine bond in therapeutic drug: -S-aromatic heterocyclic podophyllum derivatives display antitumor activity

8Q5SAC) 8Q5SAC UV2Vis 8500 ( ) ; PHS23C ) ;721 ( ) :1 4. ;8Q5SAC : molπl ;Britton2Robinson Q5SAC BSA Britton2Robinson,

Extract Isolation Purification and Identification of Polysaccharides from Exocarp of Unripe Fruits of Juglans mandshurica

Rapid determination of soluble reactive silicate in seawater by flow injection analysis with spectrophotometric detection and its application

LUO, Hong2Qun LIU, Shao2Pu Ξ LI, Nian2Bing

( ) , ) , ; kg 1) 80 % kg. Vol. 28,No. 1 Jan.,2006 RESOURCES SCIENCE : (2006) ,2 ,,,, ; ;

Antimicrobial Ability of Limonene, a Natural and Active Monoterpene

IL - 13 /IL - 18 ELISA PCR RT - PCR. IL - 13 IL - 18 mrna. 13 IL - 18 mrna IL - 13 /IL Th1 /Th2

MSM Men who have Sex with Men HIV -

ΒΑΣΙΛΙΚΟ ΚΟΛΛΕΓΙΟ ΜΑΙΕΥΤΗΡΩΝ ΚΑΙ ΓΥΝΑΙΚΟΛΟΓΩΝ ΣΥΜΒΟΥΛΕΥΤΙΚΗ ΕΠΙΣΤΗΜΟΝΙΚΗ ΟΜΑΔΑ ΟΔΗΓΙΑ 9 - ΦΕΒΡΟΥΑΡΙΟΣ 2007

HIV HIV HIV HIV AIDS 3 :.1 /-,**1 +332

Supporting Information

Quick algorithm f or computing core attribute

ΠΣΤΥΙΑΚΗ ΔΡΓΑΙΑ. Μειέηε Υξόλνπ Απνζηείξσζεο Κνλζέξβαο κε Τπνινγηζηηθή Ρεπζηνδπλακηθή. Αζαλαζηάδνπ Βαξβάξα

Study on the Strengthen Method of Masonry Structure by Steel Truss for Collapse Prevention

VSC STEADY2STATE MOD EL AND ITS NONL INEAR CONTROL OF VSC2HVDC SYSTEM VSC (1. , ; 2. , )

α 1 2- Cloning and Expression of alpha 1 2-fucosyltransferase in E. coli BIOTECHNOLOGY BULLETIN

,,, (, ) , ;,,, ; -

Optimizing Microwave-assisted Extraction Process for Paprika Red Pigments Using Response Surface Methodology

Angioarrestin( harp1) C FD

Resurvey of Possible Seismic Fissures in the Old-Edo River in Tokyo

Electrolyzed-Reduced Water as Artificial Hot Spring Water

BMI/CS 776 Lecture #14: Multiple Alignment - MUSCLE. Colin Dewey

Arbitrage Analysis of Futures Market with Frictions

Conductivity Logging for Thermal Spring Well

Πανδηµική γρίπη A(H1N1) 2009 και η σηµασία του εµβολιασµού στη συλλογική ανοσία. Συλλογική ανοσία. (herd immunity) ιασπορά της µόλυνσης: όλοι επίνοσοι

Quantum dot sensitized solar cells with efficiency over 12% based on tetraethyl orthosilicate additive in polysulfide electrolyte

Molecular evolutionary dynamics of respiratory syncytial virus group A in

A research on the influence of dummy activity on float in an AOA network and its amendments

Salmonella produce microrna-like RNA fragment Sal-1 in the infected cells to. facilitate intracellular survival

1., Specificity and Epitope Mapping of Four Monoclonal Antibodies. against SARS-CoV Nucleocapsid Protein

Gro wth Properties of Typical Water Bloom Algae in Reclaimed Water

*,* + -+ on Bedrock Bath. Hideyuki O, Shoichi O, Takao O, Kumiko Y, Yoshinao K and Tsuneaki G

Cellular Physiology and Biochemistry

1 h, , CaCl 2. pelamis) 58.1%, (Headspace solid -phase microextraction and gas chromatography -mass spectrometry,hs -SPME - Vol. 15 No.

Supporting Information

(Pseudorabies,PR) , ge. , ( Pichia pastoris) ppic9k, ,Multi2Copy Pichia Expression Kit Invitrogen, Vol. 42 October No. 5

Nov Journal of Zhengzhou University Engineering Science Vol. 36 No FCM. A doi /j. issn

Supporting Information. Asymmetric Binary-acid Catalysis with Chiral. Phosphoric Acid and MgF 2 : Catalytic

, Litrrow. Maxwell. Helmholtz Fredholm, . 40 Maystre [4 ], Goray [5 ], Kleemann [6 ] PACC: 4210, 4110H

ΤΕΧΝΟΛΟΓΙΚΟ ΠΑΝΕΠΙΣΤΗΜΙΟ ΚΥΠΡΟΥ ΣΧΟΛΗ ΕΠΙΣΤΗΜΩΝ ΥΓΕΙΑΣ ΤΜΗΜΑ ΝΟΣΗΛΕΥΤΙΚΗΣ

Accumulation of Soil Arsenic by Panax notoginseng and Its Associated Health Risk

Studies on the Binding Mechanism of Several Antibiotics and Human Serum Albumin

Biapenem BIPM Lot No g mg

Shiraia sp. Slf14 III

Introduction to Bioinformatics

Chinese Journal of Biochemistry and Molecular Biology ERR . I2 (TNNI2) GST2TNNI2, 1. 1

Archive of SID. (Tg)

ΜΟΡΙΑΚΕΣ ΜΕΘΟΔΟΙ ΚΡΙΤΗΡΙΑ ΕΠΙΛΟΓΗΣ ΑΞΙΟΛΟΓΗΣΗ

HPV εµβολιασµός εναντίον κονδυλωµάτων. Α.ΠΑΠΑΝΙΚΟΛΑΟΥ Αναπληρωτής Καθηγητής Μαιευτικής & Γυναικολογίας Α Μαιευτική και Γυναικολογική Κλινική Α.Π.Θ.

c Key words: cultivation of blood, two-sets blood culture, detection rate of germ Vol. 18 No

Q L -BFGS. Method of Q through full waveform inversion based on L -BFGS algorithm. SUN Hui-qiu HAN Li-guo XU Yang-yang GAO Han ZHOU Yan ZHANG Pan

High order interpolation function for surface contact problem

E#ects of Drying on Bacterial Activity and Iron Formation in Acid Sulfate Soils

College of Life Science, Dalian Nationalities University, Dalian , PR China.

Πρακτικά 33ου Επιστηµονικού Συνεδρίου της Ελληνικής Εταιρείας Βιολογικών Επιστηµών ΕΔΕΣΣΑ Μαΐου 2011

CorV CVAC. CorV TU317. 1

Research on Economics and Management

Strain gauge and rosettes

P450 CYP4G19. Prokaryotic Expression of German cockroach Cytochrome P450 CYP4G19 Gene and Preparation of Polyclonal Antibody , ; 2.

ΡΥΠΑΝΣΗ ΕΠΙΦΑΝΕΙΑΚΩΝ Υ ΑΤΩΝ ΑΠΟ ΙΑΘΕΣΗ ΒΑΡΕΩΝ ΛΥΜΑΤΩΝ (ΛΥΜΑΤΩΝ ΑΡΝΗΤΙΚΗΣ ΑΝΩΣΗΣ)

Comparison of HPLC fingerprint between enzymatic Calculus bovis and natural Calculus bovis

ΜΕΛΕΤΗ ΑΠΟΤΙΜΗΣΗΣ ΠΑΡΑΓΟΜΕΝΗΣ ΕΝΕΡΓΕΙΑΣ Φ/Β ΣΥΣΤΗΜΑΤΩΝ ΕΓΚΑΤΕΣΤΗΜΕΝΩΝ ΣΕ ΕΛΛΑ Α ΚΑΙ ΤΣΕΧΙΑ

«ΑΓΡΟΤΟΥΡΙΣΜΟΣ ΚΑΙ ΤΟΠΙΚΗ ΑΝΑΠΤΥΞΗ: Ο ΡΟΛΟΣ ΤΩΝ ΝΕΩΝ ΤΕΧΝΟΛΟΓΙΩΝ ΣΤΗΝ ΠΡΟΩΘΗΣΗ ΤΩΝ ΓΥΝΑΙΚΕΙΩΝ ΣΥΝΕΤΑΙΡΙΣΜΩΝ»

Mitomycin C application for the prevention of postoperative synechiae formation at the anterior commissure.

ΤΕΧΝΟΛΟΓΙΚΟ ΠΑΝΕΠΙΣΤΗΜΙΟ ΚΥΠΡΟΥ ΣΧΟΛΗ ΕΠΙΣΤΗΜΩΝ ΥΓΕΙΑΣ

30s 56 60s 72 60s dntp cm s s s 23

2 PbO 2. Pb 3 O 4 Sn. Ti/SnO 2 -Sb 2 O 4 -CF/PbO x SnO 2 -Sb PbO 2. Sn-Sb 1:1. 1 h. Sn:Sb=10:1. PbO 2 - CeO 2 PbO 2. [8] SnO 2 +Sb 2 O 4 _

ΠΕΡΙΕΧΟΜΕΝΑ. Μάρκετινγκ Αθλητικών Τουριστικών Προορισμών 1

ΕΦΑΡΜΟΓΗ ΕΥΤΕΡΟΒΑΘΜΙΑ ΕΠΕΞΕΡΓΑΣΜΕΝΩΝ ΥΓΡΩΝ ΑΠΟΒΛΗΤΩΝ ΣΕ ΦΥΣΙΚΑ ΣΥΣΤΗΜΑΤΑ ΚΛΙΝΗΣ ΚΑΛΑΜΙΩΝ

A Systematic Review of Procalcitonin for Early Detection of Septicemia of Newborn

E62-TAB AC Series Features

Why We All Need an AIDS Vaccine? : Overcome the Challenges of Developing an AIDS Vaccine in Japan

ΓΕΩΠΟΝΙΚΟ ΠΑΝΕΠΙΣΤΗΜΙΟ ΑΘΗΝΩΝ ΤΜΗΜΑ ΑΓΡΟΤΙΚΗΣ ΟΙΚΟΝΟΜΙΑΣ & ΑΝΑΠΤΥΞΗΣ

ΜΕΤΑΠΤΥΧΙΑΚΗ ΕΡΕΥΝΗΤΙΚΗ ΔΙΑΤΡΙΒΗ

New Cytotoxic Constituents from the Red Sea Soft Coral Nephthea sp.

Ara h 2. pet - 32a + Origami. Western blotting ELISA SDS - PAGE Ara h 2 F - Ara h 2. IgE

Development of the Nursing Program for Rehabilitation of Woman Diagnosed with Breast Cancer

Congruence Classes of Invertible Matrices of Order 3 over F 2

BGP TRACP-5b BGP TRACP-5b P 0.05

BL21 (D E3)2p E T28a ( + )2bgl 2

Επιβλέπουσα Καθηγήτρια: ΣΟΦΙΑ ΑΡΑΒΟΥ ΠΑΠΑΔΑΤΟΥ

Quantitative chemical analyses of rocks with X-ray fluorescence analyzer: major and trace elements in ultrabasic rocks

encouraged to use the Version of Record that, when published, will replace this version. The most /BCJ BIOCHEMICAL JOURNAL

Screening of Respiration-deficient Saccharomyces cerevisiae Strains with Sugar-and Thermo-tolerances

ΚΛΙΜΑΤΟΛΟΓΙΑ CLIMATOLOGY

FENXI HUAXUE Chinese Journal of Analytical Chemistry. Savitzky-Golay. n = SG SG. Savitzky-Golay mmol /L 5700.

An HBsAg Binding Protein Expressed in Pichia pastoris Can be Used as an HBV Vaccine Adjuvant

Influence of Flow Rate on Nitrate Removal in Flow Process

Design and Fabrication of Water Heater with Electromagnetic Induction Heating

Metal-free Oxidative Coupling of Amines with Sodium Sulfinates: A Mild Access to Sulfonamides

A strategy for the identification of combinatorial bioactive compounds. contributing to the holistic effect of herbal medicines

Supporting Information

A facile and general route to 3-((trifluoromethyl)thio)benzofurans and 3-((trifluoromethyl)thio)benzothiophenes

Electronic Supplementary Information

Isolation, purification and partial characterization of the 2N2acetyl2D2 glucosaminidase from the pupae of Helicoverpa armigera

Appendix to On the stability of a compressible axisymmetric rotating flow in a pipe. By Z. Rusak & J. H. Lee

Motion analysis and simulation of a stratospheric airship

Transcript:

Re search Paper Acta Microbiologica Sinica 49 (11) :1527-1533 ; 4 November 2009 ISSN 0001-6209 ; CN 11-1995ΠQ http :ΠΠjournals. im. ac. cnπactamicrocn 11,,,,,,,, 3, (,,, 361005) :11 (HPV11 VLPs), ER2566 HPV112L1,, HPV112L1,,, HPV HPV11 VLPs HPV112L1, 95 % HPV112L1 DTT, 50 nm VLPs, ( ED 50 ) 01031 g, 10 6, HPV6, HPV18, HPV16, HPV11 VLPs, HPV11 : 11 ; ; ; ; :R37 :A :000126209 (2009) 1121527207 HPV(Human Papillomavirus, HPV) ( Papovaviridae), DNA, HPV( HPV16, 18) HPV,,,90 % HPV6, 11 [1 ], HPV11, HPV, HPV [2 ],HPV,, (Virus2like Particle, VLP) : 863 (2006AA020905) ; (30500092) ; (2005DC105006) ; (NCET20520567) 3 Tel : + 86259222184110 ; Fax : + 86259222181285 ; E2mail : zhangj @xmu. edu. cn : (1983 - ),,,, E2mail : yangchunyan @xmu. edu. cn :2009204213 ; :2009206211

1528 Chunyan Yang et al. ΠActa Microbiologica Sinica (2009) 49 (11) HPV [3 ] HPV Gardasil Cervarix VLP HPV11 L1,, VLP, HPV11 VLP 1 111 11111 :pmd182t TaKaRa, Taq T4 DNA TaKaRa Marker PIERCE FPLC GE CENTRASETTE 5 PALL, 30 kda DynaPro MSΠX ( ) Protein Solutions J EM2100 EPICS XL BeckmanCoulter SPF BAL BΠc, 11112 :pto2t7 [4 ] ( Escherichia coli) DH5 ER2566 HPV6,11,16 D9 Christensen HPV11 p11l1h p11l2h Schiller 112 HPV112L1 NCBI GenBank, AF33560311 HPV112L1, 113 pto2t72hpv112l1 11311 : HPV11L1 H11NF : 5 2AGTATCTCATATGTGGCGGCCTAG2 CGAC23 ; H11CR : 5 2ACTGGTCGACTTAC2 TTTCTGGTTTTGGTACG23 NdeI Sal ( ) 11312 PCR : HPV112L1 PCR, :95 5 min PCR, :95 1 min, 57 1 min,72 1 min, 25 ; 72 10 min 11313 : 2 % PCR pmd182t, pmd182t2hpv112l1 Nde ΠSal pmd182t2hpv112l1 HPV112L1, pto2t7, pto2t72hpv112 L1, ( ) 114 HPV112L1 1 L pto2t72hpv112l1 (0115 mgπml) 40 L ER2566, OD 600 015, IPTG 015 mmolπl,25 8 h 1Π10 (20 mmolπl Tris ph712,150 mmolπl NaCl), 30 %, 4 4 h, 0122 m, AKTA explorer 100 CM Sepharose 4 Fast Flow, 500 mmolπl NaCl,800 mmolπl NaCl NaCl 2 molπl, Butyl Sepharose 4 Fast Flow, 20 mmolπl NaCl SDS2PAGE Western2blotting, Western2blotting HPV6, 11,16 D9 115 HPV11 VLPs HPV112L1 DTT 100 mmolπl,37 2 h (PALL ) PBS, 10, DTT, VLPs 116 HPV11 VLPs 11611 : HPV11 VLPs 0122 m,, Regulation 11612 : HPV11 VLPs 2 % ph710, 25000, 117 HPV11 VLPs 11711 HPV11 VLP : [5 ] HPV11 293FT ( Invitrogen) 96 (115 10 4 Π ) 5 h, 10 %DMEM,

: 11.Π (2009) 49 (11) 1529 50 L 50 L 10 %DMEM HPV11 (moi = 011), HPV11 [5 ] 4 1 h 293FT 96, 37 72 h,, = (1 - Π ) 100 % : 50 % 50 50 % 11712 HPV112L1 VLP : (1) ( ED 50 ) : 3 4 BAL BΠc,HPV11 VLPs, 01100 gπ,3, 4, 10,,5,,,100, Reed2 Muench ( ED 50 ) (2) HPV6Π11Π16Π18 : 3 4 BAL BΠc HPV11 VLPs, HPV11 VLPs,, 100 gπ, 2 4, 100 g Π,,, HPV6Π11Π16Π18 118 HPV6 11 16 18 33 45 52 58 L1 GCG (licensed No1 85852, Accelrys Inc1) CLUSTAL W HPV L1 HPV, HPV6 ( AF09293211), HPV11 ( AF33560311 ), HPV16 ( AF47250811 ), HPV18 ( AY26228211), HPV33 ( M1273211), HPV45 ( X7447911 ), HPV52 ( X7448111 ), HPV58 (D9040011), 8 HPV L1, (distance methods) (Neighbor2 joining), Kimura protein distance,, GCG,, 100 2 211 HPV112L1 1, HPV11 L1 (Lane 1) (Lane 2), 55 kda, 5 VLPs ( ),, (Lane 3), (Lane 5) (Lane 6), 95 %, VLPs 1 HPV112L1 SDS2PAGE( A) Western blot( B) Fig. 1 SDS2PAGE(A) and Western blot (B) analysis of expression and purification of HPV112L11 A, 10 % reduced SDS2PAGE; B, Western2 blotting with D9 monoclonal antibody ; M, Protein Molecular Weigh mark ; 1, Cell lysate precipitation ; 2, Cell lysate supernatant ; 3, Ammonium sulfate precipitation ; 4, Sample for CM chromatography ; 5, Interest fraction of CM chromatography ; 6, Interest fraction of Butyl chromatography.

1530 Chunyan Yang et al. ΠActa Microbiologica Sinica (2009) 49 (11) 212 HPV11 VLPs HPV11 L1 100 %, ( 2),, HPV11 HPV11 VLPs, 3, 100 %,, 50 nm, 30 nm, 1717 % HPV, 2 HPV11 Fig. 2 Dynamic light scattering analysis of HPV11L1 VLPs1 1 HPV11 VLPs ( ED 50 ) Table 1 Half2Effective Dose ( ED 50 ) of HPV11 VPLs in mice Dose Π g Positive Total Rate of SeroconversionΠ% 01100 8 10 80 01033 6 10 60 ED 50 Π g 01011 1 10 6 01031 01004 0 10 0 01000 0 10 3 HPV112L1 VLP ( 25000 ) Fig. 3 Transmission Electron Micrograph of HPV11L1 VLPs (25000 ). 213 HPV11 VLPs 21311 HPV11 VLPs : 1,01100 g 80 %, 01004 g,01011 g 01033 g 6 % 60 %,Reed2Muench ED 50 01031 g, HPV11 VLPs 21312 HPV11 VLPs 4, 4,,,, 7, 10 6 4 HPV11 VLP Fig. 4 Neutralizing antibody titers of antiserum after vaccination1 HPV16Π18Π6Π11, 5,HPV11 HPV6, HPV18, HPV16 8 HPV(6 11 16 18 33 45 52 58 )L1

: 11.Π (2009) 49 (11) 1531 6, HPV11 HPV6, HPV18, HPV16, HPV11 VLPs 5 HPV11VLP HPV6, HPV16, HPV18 VLP Fig. 5 Cross2neutralization titer of anti2hpv11vlp serum to HPV 6Π16Π 18 VLP1 3 HPV VLP, VLP HPV Merck Gardasil [6-7 ],GSK Cervarix [8 ] HPVL1, VLP, [9-10 ], HPV,, HPV, HPV HPV VLP, HPV11 HPV VLP L1,,,,, HPV2L1 HPV pto2 T7 (25 ) pto2t7 T7,, [4 ],, 6 GCG HPV L1 Fig. 6 Phylogenetic tree of L1 sequences of eight HPV types produced by GCG software. The GenBank accession number of L1 sequences of HPV types in GenBank was shown in parentheses1 The length of each branch indicates the evolutionary distances between different L1 sequences1 Bar, 10 substitutions per 100 residues1

1532 Chunyan Yang et al. ΠActa Microbiologica Sinica (2009) 49 (11),,, [ 5 ]. ( Chinese Journal of Biotechnology), 2000, 16 : 578-581.,,,. 16. ( Chinese Journal of Biotechnology), 2006, 22 (6) : 990 -,,SDS, 995., [ 6 ] Ruiz W, Mcclements WL Jansen KU, et al. Kinetics and, isotype profile of antibody responses in rhesus macaques, 95 %, ( ),, HPV112L1 VLPs,,, [ 7 ] induced following vaccination with HPV 6, 11, 16 and 18 L12virus2like particles formulated with or without Merck aluminum adjuvant. Journal of Immune Based Therapies and Vaccines, 2005, 3 (1) : 2. Villa LL, Costa RL Petta CA, et al. High sustained efficacy of a prophylactic quadrivalent human papillomavirus types 6Π 11Π16Π18 L1 virus2like particle vaccine through 5 years of follow2up. British Journal of Cancer, 2006, 95 (11) : 1459 HPV,HPV VLP - 1466. [ 8 ] Harper DM, Franco EL, Wheeler C, et al. Efficacy of a [11-12 ], VLP [13 ], HPV11 VLPs, bivalent L1 virus2like particle vaccine in prevention of infection with human papillomavirus types 16 and 18 in young women : a randomised controlled trial. Lancet, 2004, 364 (9447) : 1757-1765. HPV11 VLPs HPV6 HPV18 [ 9 ] Rose RC, Reichman RC, Bonnez W. Human, HPV6 papillomavirus ( HPV ) type 11 recombinant virus2like, particles induce the formation of neutralizing antibodies and detect HPV2specific antibodies in human sera. Journal of HPV11 HPV6 90 %, VLPs General Virology, 1994, 75 (8) : 2075-2079., HPV11 [ 10 ] Cook JC, Joyce J G, George HA, et al. Purification of VLPs, HPV virus2like particles of recombinant human papillomavirus type 11 major capsid protein L1 from Saccharomyces [ 1 ] Insinga RP, Dasbach EJ, Elbasha EH, et al. Incidence and duration of cervical human papillomavirus 6, 11, 16, and 18 infections in young women : an evaluation from multiple analytic perspectives1 Cancer Epidemiol Biomarkers Prevention, 2007, 16 (4) : 709-715. [ 2 ] Roden RB, Greenstone HL, Kirnbauer R, et al. In vitro generation and type2specific neutralization of a human papillomavirus type 16 virion pseudotype. Journal of Virology, 1996, 70 (9) :5875-5883. [ 3 ] Zhou J, Sun XY, Stenzel Dj, et al. Expression of vaccinia recombinant HPV 16 L1 and L2 ORF proteins in epithelial cells is sufficient for assembly of HPV virion2like particles. Virology, 1991, 185 (1) : 251-257. [ 4 ],,,. cerevisiae. Protein Expression and Purification, 1999, 17 (3) : 477-484. [11 ] Orozco JJ, Carter JJ, Koutsky LA, et al. Humoral immune response recognizes a complex set of epitopes on human papillomavirus type 6 11 capsomers. Journal of Virology, 2005, 79 (15) :9503-9514. [12 ] Carter JJ, Wipf GC, Madeleine MM, et al. Identification of human papillomavirus type 16 L1 surface loops required for neutralization by human sera. Journal of Virology, 2006, 80 (10) : 4664-4672. [13 ] Da Silva DM, Pastrana DV, Schiller JT, et al. Effect of preexisting neutralizing antibodies on the anti2tumor immune response induced by chimeric human papillomavirus virus2 like particle vaccines. Virology, 2001, 290 ( 2) : 350-360.

: 11.Π (2009) 49 (11) 1533 Expression, purification and immunogenicity of human papillomavirus type 11 virus2like particles from Escherichia coli Chunyan Yan, Shaowei Li, Jin Wang, Minxi Wei, Bo Huang, Yudi Zhuang, Zhongyi Li, Huirong Pan, J un Zhang 3, Ningshao Xia (National Institute of Diagnostics and Vaccine Development in infectious diseases, Life Science School, Key Laboratory of the Ministry of Education for Cell Biology and Tumor Cell Engineering, Xiamen University, Xiamen 361005, China) Abstract :[ Objective] To produce human papillomavirus type 11 virus2like particles ( HPV11 VLPs) from Escherichia coli and to investigate its immunogenicity and type cross neutralization nature. [ Methods ] We expressed the major capsid protein of HPV11 ( HPV112L1) in Escherichia coli ER2566 in non fusion fashion and purified by amino sulfate precipitation, ion2exchange chromatography and hydrophobic interaction chromatography, sequentially. Then we removed the reductant DTT to have the purified HPV112L1 self2assemble into VLPs in vitro. We investigated the morphology of these VLPs with dynamic light scattering and transmission electron microscopy. We assayed the immunogenicity of the resultant HPV11 VLPs by vaccinations on mice and evaluated by HPV6Π11Π16Π18 pseudovirion neutralization cell models. [ Results] We expressed HPV11 L1 in Escherichia coli with two forms, soluble and inclusion body. The soluble HPV11 L1 with over 95 % purity can self assemble to VLPs in high efficiency. Morphologically, these VLPs were globular, homogeneous and with a diameter of 50 nm, which is quite similar with native HPV11 virions. The half effective dosage ( ED 50 ) of HPV11 VLPs is 0. 031 g, and the maximum titer of neutralizing antibody elicited is averaged to 10 6. The cross neutralization activity (against HPV6Π16Π18) of the anti2hpv11 serum was found to have exact correlation to the inter2type homology in amino acid alignment. [ Conclusion] We can provide HPV11 VLPs with highly immunogenicity from prokaryote expression system, which may pave a new way for research and development of prophylactic vaccine for HPV11. Keywords : human papillomavirus type 11 ; Escherichia coli ; virus2like particle ; immunogenicity ; cross neutralization ( : ) Supported by the National Programs for High Technology Research and Development of China (2006AA020905), the National Natural Science Foundation of China (30500092), the Project in National Engineering Research Center (2005DC105006) and the Program for New Century Excellent Talents in University (NCET20500567) 3 Corresponding author. Tel : + 86259222184110 ; Fax : + 86259222181258 ; E2mail : zhangj @xmu. edu. cn Received :13 April 2009ΠRevised : 11 June 2009