BIOTECHNOLOGY BULLETIN 2009 3 116015 PCR multiplex PCR mpcr denaturing high-performance liquid chromatography DHPLC O157 H7 fimy gyra O157 H7 rfbe 3 O157 H7 PCR 284 159 499 bp PCR O157 H7 1.5 CFU/ ml 15 CFU/ ml O157 H7 15 CFU/ ml 226 7 10 1 O157 H7 PCR -DHPLC O157 H7 O157 H7 Identification of Salmonella,Campylobacter jejuni and Enterohemorrhagic E.coli by Denaturing High-performance Liquid Chromatography Xu Junyi Cao Jijuan Zheng Qiuyue Liu Shuyan Xu Yang Liaoning Entry-Exit Inspection and Quarantine Bureau of China Dalian 116015 AbstractA new molecular technique for the analysis of Salmonella Campylobacter jejuni and enterohemorrhagic E.coli based on the separation of PCR -amplified target fragments by denaturing high-performance liquid chromatography DHPLCwas reported. A multiplex PCR mpcrassay was developed by using 3 sets of primers that specifically amplify segments of the fimy gyra and rfbe genes the PCR Products of which were 284 159 and 499 bp respectively. Analysis of 22 strains demonstrated that this PCR system was specific. The detection limit of the mpcr was 1.5 CFU/ ml for Salmonella 15 CFU/ ml for Campylobacter jejuni and 15 CFU/ ml for enterohemorrhagic E.coli 0157:H7. 10 of Campylobacter jejuni and 1 of O157 H7 were detected in 226 chicken meat samples. These results indicated that the multiplex PCR -DHPLC assay can be used for specific and sensitive detection of salmonella Campylobacter jejun and enterohemorrhagic E.coli O157 H7. Key wordssalmonella Campylobacter jejun Enterohemorrhagic E.coli O157 H7 liquid chromatography Denaturing high-performance 50%,,,, :2008-09-10 : (2006BAK02A13) : (1979-),,, ;E-mail:skyxjy@yahoo.com
128 Biotechnology Bulletin 2009 3 [1] [4],,,,, (HUS) (TTP),, PCR,, (DHPLC) [2] 90%, DHPLC,, [3] Reiter s,, [5],, PCR, DHPLC,, 3 1, 1.1 1.1.1 DNA, ; ATCC, (CMCC)(1) 42, (5% O 2 10% CO 2 85% N 2 )24 h; (5% O 2 10% CO 2 85% N 2 ), (TSA) 37, 24 h 1 Campylobacter jejuni ATCC 33291 1 DNA Campylobacter jejuni genomic DNA ATCC 33560D-5 1 Campylobacter coli ATCC 43478 1 DNA Campylobacter coli genomic DNA ATCC BAA-1061D 1 Campylobacter fetus ATCC 27374 1 DNA Campylobacter lari genomic DNA ATCC BAA-1060D 1 Escherichia coli ATCC 25922 1 Enteropathogenic E.coli ATCC 43887 1 Enterotoxigenic E.coli ATCC 35401 1 Enterohemorrhagic E.coli ATCC 35150 1! Enteroinvasive E.coli ATCC 43893 1 "#$% Salmonella enteritidis ATCC 13076 1 & (#$% Salmonella. typhimurium ATCC 49416 1 )*+#$% Salmonella. cholerae ATCC 10708 1,-. (#$% Salmonella. enterica paratyphi A ATCC 9150 1 /012 Proteus vulgaris CMCC 49027 1 3"456% Yersinia enterocolitica ATCC 9610 1.78 Vibrio parahaemolyticus ATCC 17802 1 *+8 Vibrio cholerae CMCC 93-3 1 9:;<=>% Listeria innocua ATCC 33090 1?@ABCD<=>% Liateria monocytogenes ATCC 19111 1 EFGHIJ Staphylococcus aureus ATCC 29213 1
2009 3 : 129 1.1.2 DNA PE 24000 (PerkinElmer, ); (TakaRa MiniBEST Bacterial Genomic DNA Extraction kit),taq PCR Centrifuge 5804(Eppendorf, ) ( ) ; (Campylo- 1.2 NAV-99-4500(Transgenomic, ); bacter Agar Base) BD ; GenBank, Primer Premier 5.0 3, 1.1.3 MART-II fimy gyra (Mart Microbiology B.V., ); PCR rfbe (2) 53 bp Salmonella Campylobacter jejuni Enterohemorrhagic E.coli fimy gyra rfbe ( ) 1.3 2 GTGAAATTATCGCCACGTTCGGGCAA TCATCGCACCGTCAAAGGAACC CAAATAAAGTTAGAGGTAGAATGT CCATAAGCACTAGCTAGCTGAT ATTGCGCTGAAGCCTTTG CGAGTACATTGGCATCGTG 42 24 h 41.8% A,58.2% B;6.8 min, 37 38.2% A,61.8% B;9.9 min,, 5 ml 8.5%, 0.5 ( 1.5 10 8 CFU/ml), 10 1 10 7 min;: ( :150W Xenon, CFU/ml 1 10 6 CFU/ml 1 10 5 CFU/ml :15 nm, :15.3 nm, 1.4 DNA 2 1 DNA, DNA 1.5 PCR 1.6 DHPLC DNA 1.5 PCR(multiplex PCR,mPCR)1.8 PCR :10 PCR 1.3 3 μl, (10 μmol/l) 1 μl,dntp (10 mmol/ L)4 μl,taq DNA (5 U/μl)0.25 μl, DNA 2 μl, ddh 2 O 25 μl : 1.5 10 5 CFU/ml, 10 94 3 min;94 60 s,56 60 s,72 60 s,35 ;72 7 min ;4 DNA, PCR 1.6 DHPLC :PS-DVB & C18 DNASep (4.6 mm 50 mm, 3 μm); 50 :0.0 284 159 499 min,55% A,45% B;0.5 min, 50.2% A,49.8% B;3.6 min, 36.3% A,63.7% B;13 min, 35% A,65% B :0.9 ml/ : 350 nm 2 s); :PCR 5 μl 1.7 PCR mpcr-dhplc ATCC 33291 ATCC 13076 ATCC 35150, 1.9 PCR-DHPLC 226,
130 Biotechnology Bulletin 2009 3 2 2.1, 2 3 PCRDHPLC 1 22 DNA mpc- 2.2 R-DHPLC, PCR 1.3 DHPLC 1 PCR ATCC 33291 ATCC 13076 (159 bp) ATCC 35150, (284 bp) 1.5 10 5 CFU/ml, 10 (499 bp) DNA, PCR 1.5 10 5 1.5 10 4 1.5 10 3 1.5 10 2 1.5 10 1 1.5 10 0 CFU/ml, mpcr-dhplc DNA, PCR-DHPLC 1.5 CFU/ml, 15 CFU/ml, 15 CFU/ml(3) 3 PCR-DHPLC PCR-DHPLC 1. ATCC33291, ATCC CFU/ml 13076, ATCC 35150;A. ;B. ;C. 1.510Á + + + ;2. ATCC 1.510Â + + + 43478;3. ATCC 25922;4. 1.510Ã + + + ATCC 43887;5. ATCC 35401;6. 1.510Ä + + + ATCC 43893;7. CMCC 49027;8. 1.510Å + + + ATCC9610;9. ATCC 1.510Æ + - - 17802;10. ATCC19111 1 PCR-DHPLC (min ) (A ) (min ) (B ) (min ) (C ) 2.3 PCR-DHPLC 226, PCR-DHPLC 7 mpcr-dhplc GB A. ;B. ;C. 2 3 PCR DHPLC (%) 3.1 4.4 0.4 3.1 1.8 0.4 4 mpcr-dhplc GB 3 226 226 226 226 226 226 7 10 1 7 4 1
2009 3 : 131 10, 1,, 1% 7,4 Franciosa [6],1 A B E F PCR-DHPLC, DHPLC, Hurtle [7] DHPLC, rrna, (VIDAS) (API), (Yersinia pestis) (Bacillus anthracis) (4), 2 [8] 3 DHPLC,, DHPLC, PCR-DHPLC,, PCR- PCR (VIDAS), API,, PCR-,,,, ; mpcr- PCR,, DHPLC, ;VIDAS,,, ;API, 1. 2006 22 86~88. ; 2 Nataro JP Kaper JB. Clin Microbiol 1998 11 132~201.,,, 3 Allos BM. Clin Infect Dis 2001 32 1201~1206. ; 4 Mckay AM. Lett Appl Microbiol 1992 14 129~135., 5 Colosimo A Guida V Flex E et al. Biotechniques 2003 34, 706~708., 6 Franciosa G Pourshaban M De Luca A et al. Appl Environ Microbiol 2004 70 4170~4176. 7 Hurtle W Bode E Kaplan RS et al. J Clin Microbiol 2003 41 10 4758~4766. (DHPLC) 8. 2008 29 50~53.