Sar1B-mediated Regulation of Triglyceride and Cholesterol

FIGURE S1. Comparing Sar1A- and Sar1B-flag Over-expression on RNA Profiles of McArdle RH7777 cells. RNA was prepared from two Sar1B:H79G-flag cell lines and two control cell lines plus two Sar1B-flag and one Sar1A-flag cell lines (a minimum of three replicates from each line). Biotinlabelled crnas were hybridized to Affymetrix Rat Expression Arrays containing 31,0099 probe-sets. Data were analyzed as described in the Methods Sections. (A) At a false discovery rate (FDR) of 0.000313 and a delta (Δ) of 6.8, SAM identified 89 probe-sets that returned significantly different expression values following hybridization to Sar1A-flag cell line crna. Expression values of three probe-sets were unaltered by Sar1B-flag (n=11,118; FDR 0.015, Δ 2.0) and Sar1B:H79G-flag expression (n=10,384; FDR 0.003, Δ 2.8). (B) At a FDR of 0.000282 and a Δ of 6.9, 916 probe-sets were altered by Sar1B-flag expression, including 70 that were unaltered by Sar1A-flag (n=5148; FDR 0.009, delta 1.9) and Sar1B:H79G -flag expression (n=10,384; FDR 0.003, delta 2.8). FIGURE S2. ApoB and Mttp knock-down does not decrease representative cholesterol biosynthesis gene expression. McArdle-Rh7777 cells were transfected with the specified sirnas. Levels of representative mrnas were assayed by RT-qPCR. Data (mean±sem) are from three independent experiments. FIGURE S3. Constitutively Active Sar1B and Sar1B-Deficiency do not Alter precursor (P), but or mature (M) ATF6 Levels in McArdle-RH7777 cells (A-B) Precursor (P) and mature (M) ATF6 protein in stably over-expressing Sar1B:H79G and empty vector control cells, insert panels show Western blot data from the same gel.. (C-D) Precursor (P) and mature (M) ATF6 protein in Sar1a and Sar1a+Sar1b knock-down and control McArdle-RH7777 cells. (E-F) Sar1b knock-down has no significant effect on ATF6 protein. (A-F) Data (mean±sem) are from a minimum of three independent experiments. 1

Table S1. Custom Primers used for RT-qPCR Gene Forward Primer Reverse Primer Cells assayed Hmgcr * AAGTGGTCCCACGAATGAAG CGTGCATTTTCTCCAGGATT CHO Hmgcs1 * GTCACACAAGATGCCACACC GTGTGTCCTCCCTGAGCTTC CHO Lec35 * GGCCAGCTTTCAGCTATCAC CACAAAGACTCCAGCCATGA CHO Rps13 * CTGACGACGTGAAGGAACAA ACCAGTCACAAAACGGACCT CHO Idi1 * GCGCTTAAAAGCTGAATTGG CCGGATTCAAGGTTACGTTC CHO Dhcr7 GCCGAAGACTGCAAATTCAC AGAACAGCTTGAAGTCAAACCA CHO Mvd GACCAGCGTGGAGACCAG CCTGGAGGTGTCATTGAGGT CHO Fdft1 AATCAGACCAGTCGCAGCTT CGGGCTCATAGAGGAAAGTG CHO Sar1a AATGGCTTCAGCAGTGTGC AGCATGTGAAGAAGAGTGGTTTT CHO SAR1A TTGGGCTTTATGGACAGACC CTTGCCTCTTGAGCACACTG Intestinal Biopsies Sar1b TGCTGGCATGACGTTTACA CCCTTTCCTGTTGTCTGACC CHO SAR1B AAGGGGCTGATGCGAACT GGCGACAAGAGGGAAACTCT Intestinal Biopsies Sec23A TCAAGGGAAATAAAGATTTCAGGA AGTTTGAGCATCTGCCCAGT CHO SEC23A GATCGTGGCATGACATTGAC GCTCGATTAGCCAATGCTTC Intestinal Biopsies Sec23B CTTGTGCCCTTGACCAAACT CTTCAGTTCCCGAGAGGTCTT CHO SEC23B ACCTGTATGCTTGGGGACAG GCCAGCTTCTTCAAATGGTC Intestinal Biopsies Sec24D CAACAGGTGCAAAGCCTACA TGTGGTCCAGATGTTGGAAA CHO SEC31A GCCTCCTGGAACAACAGGTA GGGTCATTCCAACCATTCTG Intestinal Biopsies SEC31B GGACCCTTCTCTGGACTTGA CCCAGACCAGCTTGTGAAAC Intestinal Biopsies Srebf1a CTTGACCGACATCGAAGACA CCCAGAGAAGCAGGAGAAGA McArdle RH7777 Srebf1c GAGCCATGGATTGCACATTT CTGTCTCACCCCCAGCATAG McArdle RH7777 * Sequences from Cricetulus griseus were available for Hmgcr (Chin et al., 1984); Hmgcs1 (Gil et al., 1986); Idi1 (AF003836.1), Lec35 (SL15; U55387.2) and Rps13 (NM_001244533.1). In cases where Cricetulus griseus cdna sequences were unavailable, primer sequences were derived from known mammalian sequences using the most conserved regions. References: Chin DJ, Gil G, Russell DW, Liscum L, Luskey KL, Basu SK, Okayama H, Berg P, Goldstein JL, Brown MS. Nucleotide sequence of 3-hydroxy-3-methyl-glutaryl coenzyme A reductase, a glycoprotein of endoplasmic reticulum. Nature. 1984; 308(5960):613-617. Gil G, Goldstein JL, Slaughter CA, Brown MS. Cytoplasmic 3-hydroxy-3-methylglutaryl coenzyme A synthase from the hamster. I. Isolation and sequencing of a full-length cdna. J Biol Chem. 1986; 261(8):3710-3716. 2

Table S2. Fold-Changes in Sec mrna levels in McArdle RH7777 cells over-expressing Sar1 Gene Symbol Microarray RT-qPCR* Probe Affy_ID Sar1B:H79G FDR Sar1B FDR Sar1A FDR Sar1B:H79G # Sar1B # Sar1A # Sec23A 1388755_at 1.652 0.003060 0.644 0.007548 0.856 0.15630 1.649 ± 0.202 0.864 ± 0.098 1.401 ± 0.163 Sec23B 1388857_at 2.002 0.000203 1.371 0.000264 1.206 0.00850 2.003 ± 0.154 1.024 ± 0.101 1.113 ± 0.067 Sec24A 1389383_at 1.318 0.003060 0.906 0.184825 0.793 0.04532 2.384 ± 0.124 1.224 ± 0.110 1.245 ± 0.097 Sec24B 1389455_at 1.162 0.035324 1.189 0.001380 1.087 0.15630 1.434 ± 0.188 1.150 ± 0.161 1.038 ± 0.087 Sec24B 1392211_at 0.454 0.000250 0.585 0.000880 0.599 0.00850 Sec24C 1367474_at 1.479 0.000204 1.059 0.031412 1.055 0.15630 1.999 ± 0.189 1.171 ± 0.073 1.026 ± 0.106 Sec24C 1395802_at 2.031 0.000207 1.503 0.000282 1.575 0.00317 Sec24D 1373610_at 2.640 0.000205 1.189 0.002373 1.130 0.15630 3.086 ± 0.233 1.104 ± 0.085 0.846 ± 0.063 Sec31A 1367753_at 1.782 0.000250 0.962 0.233743 1.077 0.32222 2.900 ± 0.473 0.820 ± 0.059 0.906 ± 0.033 Sec31B 1377087_at 1.020 0.195265 1.025 0.184825 1.021 >0.32222 0.948 ± 0.125 1.241 ± 0.351 0.851 ± 0.107 Sec13 1371437_at 2.477 0.000203 1.392 0.000264 1.000 >0.32222 2.734 ± 0.150 1.222 ± 0.163 0.848 ± 0.071 *RT-qPCRs were performed on RNA prepared from a separate experiment involving three biological observations. Results represent mean fold-changes (±SEM) of two independent cell-lines compared to control cell lines. Fold-change FDR=false detection rate Data from one cell line. 3

Table S3. Enrichment/Under-representation of Gene Ontology (GO) Biological Processes Terms in the Sar1A Differentially Expressed Probe-Set*: Results of DAVID (Database for Annotation, Visualization and Integrated Discovery) Cluster Description GO terms in Cluster Differentially expressed genes (n) Enrichment score P value range Biosynthetic processes 0009058; 0044249 12 1.39 2.8x10-2 -3.8x10-2 Cellular component organisation, biogenesis and intracellular transport 0016043; 0015031; 0051179; 0045184 24 1.39 1.9x10-2 - 4.2x10-2 Organic acid metabolic processes 0019752; 0006082; 0006520 8 1.37 6.7x10-2 - 2.8x10-2 Metabolic processes 0044237; 0044238 36 1.23 2.8x10-2 - 3.1x10-2 Macromolecular complex assembly 0065003 6 1.15 4.0x10-2 Response to metal ion and inorganic substances 0010038; 0010035 3 1.00 3.4x10-2 - 4.0x10-2 Response to organic substance 0010033 4 0.86 2.1x10-2 Regulation of cell proliferation 0042127; 0042060 9 0.62 1.9x10-2 - 3.3x10-2 Positive regulation of cell proliferation & response to organic substances 0008284; 0042127; 0010033 8 0.58 1.9x10-2 - 2.1x10-2 *Probe-sets (n=89) identified by SAM (FDR 0.000313, Δ 6.8) to be differentially expressed compared to control cell lines. 50/82 differentially expressed genes (89 probe-sets) were returned in one or more of an 'Enriched Biological Processes Ontology' category. Bold and underlining denote respectively GO terms returned in Sar1B:H79G-flag and Sar1B-flag differentially expressed gene lists. Grey highlights GO terms enriched/under-represented (i.e. in the opposite direction) in Sar1B:H79G-flag and Sar1B-flag gene lists. Italics indicate GO terms under-represented in Sar1B-flag gene list. 4

Table S4: Enrichment/Under-representation of Gene Ontology (GO) Terms in Sar1B Differentially Expressed Gene List*: Results of DAVID (Database for Annotation, Visualization and Integrated Discovery). Cluster Description (BP) Cellular component organisation, biogenesis and intracellular transport GO terms in Cluster 0016043; 0046907; 0051649; 0051641; 0006810; 0051234; 0051179; 0033036; 0015031; 0008104; 0045184; 0006886 Differentially expressed genes (n) Enrichment Score P value range 235 8.36 1.4x10-15 - 3.3x10-5 Macromolecular complex assembly 0065003; 0006461; 0022607 43 5.91 9.2x10-7 - 1.5x10-6 Vesicle-mediated transport and secretion Macromolecular metabolic process Regulation of cellular, biological and metabolic processes 0016192; 0048193; 0006888; 0032940; 0045045; 0046903 58 5.11 1.4x10-11 - 9.9x10-4 0043170; 0008152; 0044238; 0043283; 0044237; 0019538; 0044260; 0044267; 0043412; 0043687; 0006464 0050794; 0050789; 0065007; 0019222; 0006366; 0016070; 0006139; 0010468; 0006357; :0031323; 0006351; 0032774; 0006355; 0019219; 0045449; 0006350 329 4.3 1.3x10-7 - 2.0x10-3 249 2.76 2.2x10-9 - 3.7x10-2 Cellular developmental processes and apoptosis 0006915; 0012501; 0016265; 0008219; 0030154; 0048869; 0048468; 0042981; 0043067 83 2.57 7.1x10-4 - 1.1x10-2 Positive Regulation of transcription and metabolic processes Cell Cycle Negative regulation of cellular, biological and metabolic processes 0006366; 0045944; 0045893; 0045941; 0048522; 0009893; 0006357; 0045935; 0031325; 0048518 0007049; 0022402; 0051329; 0051325; 0000074; 0051726; 0045786; 0000278; 0022403 74 2.28 1.6x10-3 - 1.5x10-2 40 2.27 6.7x10-5 - 3.1x10-2 0048523; 0048519; 0009892; 0031324; 0045934; 0016481 67 2.27 8.2x10-6 - 1.6x10-2 Protein modification 0043412; 0043687; 0006464; 0006468 80 2.21 5.2x10-4 - 1.6x10-2 TGF-b receptor, transmembrane receptor and protein, threonine kinase pathways Membrane invagination and endocytosis 0007179; 0007178 10 2.02 1.2x10-3 - 3.6x10-3 0016044; 0006897; 0010324 24 2.01 3.0x10-4 - 2.3x10-2 Protein and macromolecular catabolic processes 0006511; 0019941; 0043632; 0044265; 0043285; 0051603; 0044257; 0009057; 0030163 24 1.75 5.6x10-3 - 3.3x10-2 5

Regulation of apoptosis and antiapoptosis Establishment of vesicle and organelle localisation Cytoskeleton and microtubule intracellular transport 0042981; 0043067; 0006916 33 1.66 8.6x10-3 - 1.8x10-2 0051650; 0051648; 0051656; 0051640 5 1.48 1.9x10-2 - 4.2x10-2 0007017; 0030705; 0007018 20 1.39 9.7x10-4 - 1.9x10-2 Regulation of cellular component organization and biogenesis 0051128; 0008064; 0030832; 0051261; 0032535; 0032956; 0051493; 0033043; 0008154; 0051129; 0030029 17 1.34 4.4x10-3 - 3.8x10-2 Ubiquitin cycle 0006512 18 1.3 2.8x10-2 Protein targeting and import into nucleus 0006605; 0000060 17 1.26 1.2x10-2 - 1.3x10-2 RNA processing 0006397; 0016071; 0006396 20 1.21 1.6x10-2 - 3.1x10-2 Regulation of protein metabolic processes 0051246; 0022613; 0022618; 0006413; 0006446 27 1.2 3.4x10-3 - 4.6x10-2 Regulation of cell proliferation 0042127 29 1.13 4.0X10-2 Protein amino acid acylation 0043543 5 1.12 1.1x10-2 Developmental process 0032502 140 0.93 6.3x10-4 Regulation of growth 0040008; 0040007 19 0.93 1.5x10-2 - 3.7x10-2 Regulation of apoptosis 0042981; 0043067 33 0.89 8.6x10-3 - 1.1x10-2 Negative regulation of cell migration 0030336 4 0.87 3.6x10-2 Photoreceptor cell differentiation 0046530 4 0.78 3.1x10-2 JAK-STAT cascade 0007259 6 0.66 2.5x10-2 Nitrogen compound biosynthetic process NADP metabolism and water-soluble vitamin process Mitotic metaphase/anaphase transition Regulation of cyclin-dependent protein kinase activity 0044271 9 0.61 4.0x10-2 0006739; 0006769; 0019362; 0006767 6 0.6 2.7x10-2 - 4.8x10-2 0007091 3 0.44 3.7x10-2 0000079 5 0.4 4.2x10-2 6

Regulation of biological quality 0065008 46 0.37 2.6x10-2 *Probe-sets (n=916) returned by SAM as differentially expressed at a FDR 0.000282 and Δ 6.9. 513/858 differentially expressed genes (n=916 probe-sets) were returned in one or more of an 'Enriched/Under-represented Gene Ontology' category. BP=biological process Bold and underlining denote respectively GO terms returned in Sar1B:H79G-flag and Sar1A-flag differentially expressed gene lists. Grey and Italic highlight GO terms under-represented in Sar1B:H79G-flag and Sar1A-flag gene lists. 7

Table S5. Collation of RNA Expression Data from Probe-sets Representing (A) Cholesterol Synthesis Genes, Ldlr and Pcsk9, (B) Fatty Acid Metabolism Genes and (C) Triglyceride Biosynthesis, Degradation and Secretion Genes, and RT-qPCR validation for Representative Genes in McArdle RH-7777 Cells Microarray RT-qPCR Sar1B:H79G-flag* Sar1B-flag* Sar1A-flag*, Sar1B:H79G-flag Sar1B-flag Sar1A-flag Affy_ID Gene Name Symbol d.value R.fold FDR d.value R.fold FDR d.value R.fold FDR A 1368126_at Acetoacetyl-CoA synthase Aacs 13.136 1.745 0.000205 2.12 1.082 0.031412-0.654 0.956 0.32222 A 1367763_at Acetyl-coenzyme A acetyltransferase 1 (m) Acat1-0.335 >0.195265 4.274 1.354 0.002373 3.262 1.342 0.0085 A 1372462_at Acetyl-coenzyme A acetyltransferase 2 (c) Acat2-40.71 0.224 0.000203-1.486 0.941 0.233743-1.744 0.892 0.1563 A 1376226_at Acetyl-coenzyme A acetyltransferase 2 (c) Acat2-11.306 0.634 0.195265-1.023 0.974 0.184825-0.467 0.969 0.32222 A 1367932_at HMG CoA synthase 1 (c) Hmgcs1-14.575 0.247 0.000204 0.912 1.076 0.184825 1.692 1.201 0.04532 0.170 ± 0.032 0.616 ± 0.064 0.784 ± 0.039 A 1370310_at HMG CoA synthase 2 (m) Hmgcs2-1.903 0.915 0.035324-2.136 0.911 0.007548-2.158 0.839 0.1563 A 1375852_at HMG CoA Reductase Hmgcr -0.683 0.967 0.195265 4.226 1.33 0.002373 8.039 1.845 0.00313 1.072 ± 0.107 1.088 ± 0.092 1.332 ± 0.121 A 1368232_at Mevalonate Kinase Mvk -13.121 0.726 0.000205 3.949 1.199 0.003811 1.626 1.124 0.04532 0.684 ± 0.061 1.110 ±0.198 1.228 ± 0.104 A 1375401_at Mevalonate Kinase Mvk 3.034 1.208 0.00306 2.357 1.15 0.031412 2.159 1.211 0.01878 A 1387119_at Mevalonate Kinase Mvk -1.932 0.885 0.195265 4.888 1.385 0.00138 3.233 1.322 0.0085 A 1373243_at Phosphomevalonate Kinase Pmvk -13.303 0.655 0.000205 6.588 1.294 0.00048 2.914 1.186 0.0085 A 1368020_at Mevalonate-5-pyrophosphate decarboxylase Mvd -15.151 0.448 0.000204 1.255 1.114 0.105056-1.056 0.915 0.1563 0.227 ± 0.015 1.222 ± 0.103 0.892 ± 0.068 A 1368878_at Isopentenyl-diphosphate delta isomerase Idi1-13.653 0.37 0.000204 6.268 1.531 0.00048 4.317 1.508 0.00392 0.181 ± 0.006 0.926 ± 0.109 0.743 ± 0.045 A 1388872_at Isopentenyl-diphosphate delta isomerase Idi1-6.709 0.52 0.000515 7.504 2.025 0.00036 6.256 2.176 0.00317 A 1376852_at Methylcrotonoyl-Coenzyme A carboxylase 1 (alpha) Mccc1 0.759 1.04 0.195265 4.428 1.322 0.002373 1.988 1.175 0.04532 A 1377060_at Methylcrotonoyl-Coenzyme A carboxylase 1 (beta) Mccc2-1.44 0.919 0.195265 4.93 1.365 0.00138 0.66 1.055 0.32222 A 1367767_at 3-hydroxymethyl-3-methylglutaryl-Coenzyme A lyase Hmgcl 0.252 >0.195265 1.129 1.045 0.105056 0.637 1.035 0.32222 A 1372149_at Methylglutaconyl-CoA hydratase Auh -7.564 0.72 0.00025 2.044 1.14 0.062886 0.653 1.054 0.32222 A 1367667_at Farnesyl diphosphate Synthase Fdps -6.639 0.494 0.000515 3.886 1.466 0.003811 3.686 1.584 0.00539 A 1377866_a_atGeranylgeranyl diphosphate synthetase Ggps1 6.28 1.43 0.000515 4.654 1.286 0.002373 3.124 1.324 0.0085 A 1379556_a_atGeranylgeranyl diphosphate synthetase Ggps1 5.7 1.434 0.000515 2.148 1.102 0.31412 1.462 1.178 0.1563 A 1367839_at Farnesyl diphosphate farnesyl transferase 1 Fdft1-11.606 0.332 0.000207 1.744 1.141 0.062886 3.388 1.403 0.00539 0.210 ± 0.052 0.882 ± 0.060 0.877 ± 0.041 A 1389906_at Farnesyl diphosphate farnesyl transferase 1 Fdft1-8.896 0.491 0.000215 1.868 1.135 0.062886 1.769 1.255 0.04532 A 1387017_at Squalene Epoxidase Sqle -5.58 0.575 0.00306 1.611 1.149 0.062886 1.529 1.174 0.04532 A 1372973_at Lanosterol Synthase Lss -8.476 0.58 0.00025 0.768 1.093 0.184825 2.575 1.265 0.01878 0.259 ± 0.020 1.109 ± 0.078 0.977 ± 0.046 A 1368086_a_atLanosterol Synthase Lss -1.978 0.86 0.195265 1.222 1.093 0.105056 2.807 1.291 0.0085 A 1372012_at 24-dehydrocholesterol reductase (predicted) Dhcr24-11.72 0.479 0.000207 3.347 1.189 0.007548-0.991 0.914 0.32222 A 1387020_at Cytochrome p450 subfamily 51 Cyp51-4.829 0.79 0.00306 2.628 1.125 0.031412 2.358 1.183 0.01878 A 1367979_s_atCytochrome p450 subfamily 51 Cyp51-1.305 0.889 0.195265 5.02 1.479 0.00138 3.044 1.376 0.0085 A 1389725_at Transmembrane 7 superfamily member 2 Tm7sf2-9.838 0.588 0.000215-0.678 0.959 0.233743 0.756 1.062 0.1563 A 1368275_at Sterol-C4-methyl oxidase-like Sc4mol -10.181 0.336 0.000215 1.431 1.112 0.105056 3.726 1.466 0.00539 0.142 ± 0.010 0.517 ± 0.048 0.885 ± 0.077 A 1392604_at NAD(P)-dependent steroid dehydrogeanse-like Nsdhl -14.175 0.477 0.000204 2.539 1.179 0.031412-1.827 0.873 0.1563 A 1387233_at Hydroxysteroid (17-beta) dehydrogenase 7 Hsd17b7-4.046 0.827 0.00306 6.049 1.34 0.000623 1.766 1.236 0.04532 A 1386990_at Phenylalkylamine Calcium antagonist (emopamil) Binding Protein Ebp -33.209 0.378 0.000215-2.743 0.892 0.062886-2.062 0.89 0.04532 A 1390777_at Sterol-c5-desaturase Sc5d -4.489 0.671 0.000203 2.603 1.244 0.031412 0.909 1.118 0.1563 0.734 ± 0.054 1.366 ± 0.094 1.177 ± 0.092 A 1387926_at Sterol-c5-desaturase Sc5d -0.678 0.938 0.195265 6.98 1.721 0.000416 4.428 1.595 0.00392 A 1368189_at 7-Dehydrocholesterol Reductase Dhcr7-19.033 0.266 0.000203 3.013 1.173 0.015484-0.699 0.94 0.32222 A 1388218_at Low density lipoprotein receptor Ldlr -1.988 0.853 0.0033 8.529 1.819 0.000306 5.133 1.630 0.0033 0.231 ± 0.015 1.165 ± 0.074 1.247 ± 0.184 A 1376089_at Low density lipoprotein receptor Ldlr -14.993 0.182 0.000204 6.367 1.318 0.00048 1.413 1.107 0.1563 A 1385640_at Proprotein convertase subtilisin/kexin type 9 Pcsk9-15.585 0.37 0.000204-0.082 >1.040 >0.233743 1.562 1.113 0.04532 B 1368126_at Acetoacetyl-CoA synthetase Aacs 13.136 1.745 0.000205 2.12 1.082 0.031412-0.654 0.956 0.32222 B 1367854_at Atp_citrate lyase Acyl -5.503 0.725 0.00306 2.309 1.137 0.031412 4.601 1.444 0.0035 B 1387538_at Acetyl-coenzyme A carboxylase alpha Acaca 4.018 1.244 0.00306 8.168 1.584 0.000306 6.438 1.703 0.00317 B 1369328_at Acetyl-Coenzyme A carboxylase beta Acacb 2.791 1.099 0.035324 1.538 1.043 0.062886 0.742 1.051 0.1563 B 1367707_at Fatty acid synthase Fasn -0.453 0.974 0.195265 4.676 1.303 0.002373 0.244 1.022 0.32222 8

B 1367708_a_atFatty acid synthase Fasn 0.888 1.047 0.195265 2.822 1.15 0.015484 0.965 1.076 0.1563 B 1370355_at Stearoyl-Coenzyme A desaturase 1 Scd1-13.529 0.294 0.000204 6.6 1.524 0.00048 2.133 1.258 0.01878 0.179 ± 0.038 1.512 ± 0.168 1.023 ± 0.043 B 1367668_a_a Stearoyl-Coenzyme A desaturase 2 Scd2-6.415 0.549 0.000515 5.398 1.357 0.00088 3.679 1.494 0.00539 0.153 ± 0.010 1.135 ± 0.104 1.633 ± 0.066 B 1386889_at Stearoyl-Coenzyme A desaturase 2 Scd2-2.454 0.633 0.035324 7.382 2.761 0.00036 7.061 3.291 0.00313 B 1388108_at ELOVL family member 6, elongation of long chain fatty acids Elovl6-13.963 0.571 0.000204 3.582 1.163 0.007548 2.244 1.196 0.01878 B 1388348_at ELOVL family member 5, elongation of long chain fatty acids Elovl5 0.761 1.033 0.195265 4.062 1.14 0.003811 1.456 1.102 0.1563 B 1387630_at ELOVL family member 5, elongation of long chain fatty acids Elovl5 4.94 1.428 0.00306 7.715 1.706 0.000325 5.656 1.698 0.0032 B 1398360_at Similar to elongation of very long chain fattyacids protein 1 LOC679532 2.443 1.084 0.035324 4.199 1.137 0.002373 1.166 1.075 0.1563 B 1391534_at Elongation of very long chain fatty acids-like 2 Elovl2-18.106 0.292 0.000203-9.633 0.494 0.000306-10.036 0.433 0.00313 B 1385286_at Elongation of very long chain fatty acids-like 3 Elovl3 1.101 1.092 0.195265-0.582 0.964 0.233743-0.003 B 1377729_at Elongation of very long chain fatty acids-like 4 Elovl4-0.801 0.94 0.195265-1.236 0.908 0.184825-0.942 0.904 0.32222 B 1367857_at Fatty acid desaturase 1 Fads1-26.743 0.191 0.000203 3.462 1.267 0.007548 2.04 1.154 0.04532 0.172 ± 0.027 1.174 ± 0.067 1.125 ± 0.093 B 1368453_at Fatty acid desaturase 2 Fads2-15.424 0.523 0.000204-1.664 0.903 0.184825 2.11 1.144 0.01878 0.179 ± 0.009 1.165 ± 0.185 1.455 ± 0.169 B 1367988_at Cytochrome P450, family 2, subfamily c, polypeptide 23 Cyp2c23-3.04 0.838 0.035324-0.106-3.871 0.726 0.00539 B 1384499_at Acyl-CoA synthetase medium-chain family member 1 Acsm1 3.081 1.247 0.035324-2.425 0.858 0.062886-0.697 0.937 0.32222 B 1370939_at Acyl-CoA synthetase long-chain family member 1 Acsl1-9.792 0.56 0.000215-0.838 0.955 0.233743-1.34 0.85 0.1563 B 1388153_at Acyl-CoA synthetase long-chain family member 1 Acsl1-3.857 0.862 0.035324 2.658 1.06 0.031412 1.825 1.122 0.04532 B 1368177_at Acyl-CoA synthetase long-chain family member 3 Acsl3-21.329 0.382 0.000203 5.311 1.239 0.00088 4.267 1.216 0.00392 0.771 ± 0.092 1.210 ± 0.108 1.182 ± 0.140 B 1387101_at Acyl-CoA synthetase long-chain family member 4 Acsl4-4.389 0.754 0.00306 2.164 1.128 0.031412 3.03 1.333 0.0085 B 1386926_at Acyl-CoA synthetase long-chain family member 5 Acsl5 2.213 1.12 0.035324 6.355 1.417 0.00048 2.964 1.248 0.0085 B 1368182_at Acyl-CoA synthetase long-chain family member 6 Acsl6 1.732 1.061 0.195265-0.047 >0.233743-0.767 0.95 0.32222 B 1367923_at Acyl-CoA synthetase bubblegum family member 1 Acsbg1-0.461-2.604 0.942 0.062886 0.003 B 1367789_at Solute carrier family 27 (fatty acid transporter), member 1 (Acsvl4) Slc27a1-0.475 0.982 0.195265-2.492 0.904 0.062886-0.85 0.941 0.32222 B 1368150_at Solute carrier family 27 (fatty acid transporter), member 2 (Acsvl2) Slc27a2-8.652 0.344 0.00025-0.473 0.92 0.233743-1.695 0.757 0.1563 B 1390192_at Solute carrier family 27 (fatty acid transporter), member 3 (Acsvl3) Slc27a3 4.99 1.199 0.00306 3.404 1.169 0.007548 2.442 1.174 0.01878 B 1390211_at Solute carrier family 27 (fatty acid transporter), member 3 (Acsvl3) Slc27a3 2.101 1.094 0.035324-0.352 >0.233743 0.706 1.066 0.32222 B 1377123_at Solute carrier family 27 (fatty acid transporter), member 3 (Acsvl5) Slc27a4 7.508 1.54 0.00025-2.204 0.941 0.062886-0.29 B 1387325_at Solute carrier family 27 (fatty acid transporter), member 3 (Acsvl6) Slc27a5 7.825 1.173 0.00025 3.724 1.074 0.105056 2.38 1.131 0.01878 B 1387183_at Carnitine O-octanoyltransferase Crot -5.687 0.642 0.000515 1.098 1.186 0.105056 1.293 1.138 0.1563 B 1368426_at Carnitine O-octanoyltransferase Crot -15.062 0.332 0.000204-2.696 0.78 0.062886-3.587 0.695 0.0085 B 1367836_at Carnitine palmitoyltransferase 1, liver Cpt1a -1.145 0.854 0.195265 4.095 1.591 0.003811 3.193 1.514 0.0085 B 1386946_at Carnitine palmitoyltransferase 1, liver Cpt1a -8.257 0.456 0.00025-0.673 0.965 0.233743-1.36 0.887 0.1563 B 1367742_at Carnitine palmitoyltransferase 1b, muscle Cpt1b 3.119 1.162 0.035324 1.515 1.064 0.105056 1.291 1.092 0.1563 B 1375033_at Carnitine palmitoyltransferase 1c (predicted), brain Cpt1c_ -0.64 0.986 0.195265-0.126-0.044 B 1367742_at Carnitine palmitoyltransferase 1b, muscle Cpt1b 3.119 1.162 0.035324 1.515 1.064 0.105056 1.291 1.092 0.1563 B 1386927_at Carnitine palmitoyltransferase 2 Cpt2-5.139 0.752 0.00306 2.104 1.147 0.062886-0.36 0.973 0.32222 B Dodecenoyl-Coenzyme A delta isomerase 3,2 trans-enoyl- 1367659_s_at Coenzyme A isomerase (mitochondria) Dci -6.684 0.56 0.000515-0.888 0.945 0.233743-2.446 0.806 0.04532 B 1370818_at 2,4-dienoyl CoA reductase 2, peroxisomal (unsaturated) Decr2-9.571 0.662 0.000215-0.776 0.968 0.233743-2.872 0.849 0.01878 B 1367777_at 2,4-dienoyl CoA reductase 1, mitochondrial (unsaturated) Decr1-5.997 0.738 0.000204 0.711 1.032 0.184825-0.387 0.967 0.32222 B 1386885_at delta(3,5)-delta(2,4)-dienoyl-coa isomerase, mitochondrial Ech1-11.064 0.728 0.000207-3.407 0.892 0.015484-1.647 0.893 0.1563 B 1367897_at Acyl-Coenzyme A dehydrogenase, very long chain Acadvl -3.757 0.888 0.035324-6.34 0.788 0.00088-5.658 0.738 0.0033 B 1367735_at Acyl-Coenzyme A dehydrogenase, long-chain Acadl 0.664 1.068 0.195265 8.421 1.546 0.000306 3.489 1.269 0.00539 B 1373389_at Acyl-Coenzyme A dehydrogenase family, member 9 (unsaturated) Acad9-5.28 0.763 0.00306 3.046 1.177 0.015484 0.695 1.047 0.32222 B 1367702_at Acyl-Coenzyme A dehydrogenase, medium chain Acadm -4.772 0.785 0.00306 4.833 1.194 0.00138-0.067 B 1367828_at Acyl-coenzyme A dehydrogenase, short chain Acads -11.729 0.68 0.000207 2.673 1.105 0.031412-0.94 0.949 0.32222 B 1371775_at Acyl-Coenzyme A dehydrogenase, short/branched chain Acadsb 1.009 1.087 0.195265 1.726 1.179 0.062886 1.104 1.15 0.1563 9

B 1369526_at Acyl-Coenzyme A dehydrogenase, short/branched chain Acadsb 7.153 2.207 0.00025 9.55 2.422 0.000276 7.727 2.523 0.00314 B 1397526_at Glutaryl-Coenzyme A dehydrogenase (lysine metabolism) Gcdh 0.997 1.048 0.195265 8.385 1.712 0.000306 2.324 1.197 0.0085 B 1388788_at Glutaryl-Coenzyme A dehydrogenase (lysine metabolism) Gcdh -7.875 0.734 0.00025 7.706 1.373 0.000325-0.83 0.948 0.32222 B 1368283_at Enoyl-Coenzyme A, hydratase/3-hydroxyacyl Coenzyme A dehydrogenase (unsaturated) Ehhadh 0.117 1.174 1.046 0.105056 1.205 1.106 0.1563 B 1367672_at Peroxisomal multifunctional enzyme type 2 Hsd17b4-2.298 0.897 0.035324 1.536 1.059 0.062886-0.69 0.957 0.32222 B 1370164_at Hydroxyacyl-Coenzyme A dehydrogenase/3-ketoacyl- Coenzyme A thiolase/enoyl-coenzyme A hydratase Hadha 2.134 1.125 0.035324-0.255-2.424 0.882 0.04532 (trifunctional protein), alpha subunit B 1367694_at Hydroxyacyl-Coenzyme A dehydrogenase/3-ketoacyl- Coenzyme A thiolase/enoyl-coenzyme A hydratase Hadhb 13.756 1.958 0.000204 1.287 1.138 0.105056 0.348 1.023 0.32222 (trifunctional protein), beta subunit B 1387271_at Phytanoyl-CoA hydroxylase (peroxisomal) Phyh -13.03 0.585 0.000205 3.758 1.29 0.007548 3.927 1.323 0.00539 B 1368016_at Peroxisomal trans-2-enoyl-coa reductase (phytol degradation) Pecr -15.547 0.489 0.000204 2.403 1.122 0.031412 0.119 B 1367829_at Enoyl Coenzyme A hydratase, short chain, 1, mitochondrial Echs1-0.958 0.908 0.195265 2.407 1.236 0.031412 2.202 1.272 0.01878 B 1367662_at Hydroxysteroid (17-beta) dehydrogenase 10 Hadh2-13.419 0.535 0.000204 1.613 1.072 0.062886-2.822 0.814 0.01878 B 1370237_at Hydroxyacyl-Coenzyme A dehydrogenase Hadhsc -25.971 0.376 0.000203 2.944 1.124 0.184825 0.102 B 1388211_s_atAcyl-CoA thioesterase 2/1 Acot2/1 4.218 1.287 0.00306 0.933 1.053 0.184825-0.169 B 1388210_at Acyl-CoA thioesterase 2/1 Acot2/1 3.42 1.454 0.035324-0.008-1.031 0.861 0.1563 B 1391433_at Acyl-CoA thioesterase 2 (mitochondria) Acot2 4.547 1.495 0.00306-1.765 0.935 0.105056-2.337 0.857 0.04532 B 1384115_at Acyl-CoA thioesterase 2 Acot2 7.141 2.04 0.00025 4.145 1.261 0.00138 1.587 1.144 0.04532 B 1378169_at Acyl-CoA thioesterase 3 (peroxisomal) Acot3-9.893 0.764 0.000215-6.288 0.838 0.00088-1.346 0.931 0.1563 B 1377037_at Acyl-CoA thioesterase 4 (peroxisomal) Acot4-18.004 0.443 0.000203-2.839 0.869 0.00138-0.128 B 1368206_at Acyl-CoA thioesterase 8 (peroxisomal) acot8 4.267 1.169 0.000515-5.87 0.879 0.00138-2.576 0.856 0.01878 B 1370313_at Acyl-CoA thioesterase 7 (long chain) acot7 0.169 1.477 1.1 0.105056-0.998 0.941 0.32222 B 1379262_at Acyl-CoA thioesterase 9 (long chain) Acot9 13.438 1.458 0.000204 6.739 1.404 0.000416 1.275 1.107 0.1563 B 1369485_at Acyl-CoA thioesterase 12 () Acot12 0.215-0.032 0.14 B Acetyl-Coenzyme A acyltransferase 1 (peroxisomal 3-oxoacyl- 1387783_a_at Coenzyme A thiolase) Acaa1-10.157 0.526 0.000215 1.409 1.097 0.105056-0.996 0.907 0.32222 B 1386880_at Acetyl-Coenzyme A acyltransferase 2 (mitochondrial 3-oxoacyl- Acaa2 Coenzyme A thiolase) -8.136 0.717 0.00025 9.062 1.543 0.000282 4.334 1.343 0.00392 B 1369663_at Epoxide hydrolase 2, cytoplasmic Ephx2-4.566 0.822 0.00306-0.162 2.522 1.215 0.01878 B 1371886_at Carnitine acetyltransferase crat 2.649 1.134 0.035324 6.188 1.321 0.000623 1.407 1.124 0.1563 B 1369111_at Fatty acid binding protein 1, liver Fabp1-5.865 0.595 0.000515-3.375 0.725 0.031412-4.112 0.54 0.00539 B 1376522_at Fatty acid binding protein 3 Fabp3 2.448 1.122 0.035324 2.268 1.106 0.031412 1.622 1.126 0.04532 B 1367660_at Fatty acid binding protein 3 Fabp3 1.9 1.06 0.035324 2.433 1.078 0.031412 1.278 1.111 0.1563 B 1370024_at Fatty acid binding protein 7, brain Fabp7-8.778 0.267 0.000215-8.638 0.221 0.00036-0.789 0.902 0.32222 B 1381732_at Fatty acid binding protein 7, brain Fabp7-4.239 0.562 0.00306-2.288 0.703 0.062886 4.355 1.885 0.00392 B 1387357_at Trimethyllysine hydroxylase, epsilon Tmlhe -1.896 0.884 0.195265 7.97 1.519 0.000325 5.56 1.474 0.0033 B 1398249_at Solute carrier family 25 (carnitine/acylcarnitine translocase), member 20 Slc25a20-6.433 0.722 0.000204 1.863 1.133 0.062886-1.671 0.887 0.1563 B 1386901_at Cd36 antigen Cd36-0.365 >0.195265 0.876 1.224 0.184825-2.5 0.845 0.01878 B 1367689_a_atCd36 antigen Cd36 1.396 1.215 0.195265 2.212 1.388 0.031412 0.15 C 1387491_at Glycerol kinase Gyk -3.625 0.721 0.035324-4.833 0.685 0.003811-3.48 0.675 0.0085 C 1391661_at Glycerol kinase Gyk -1.68 0.837 0.195265-0.873 0.927 0.233743-1.919 0.779 0.04532 C 1369758_at Glycerol-3-phosphate acyltransferase, mitochondrial Gpam -1.29 0.915 0.195265 7.361 1.507 0.00036 5.007 1.745 0.0033 C 1384383_at Glycerol-3-phosphate acyltransferase (microsomal) Agpat6 4.867 1.374 0.00306 4.249 1.179 0.002373 3.063 1.25 0.0085 C 1372919_at Glycerol-3-phosphate acyltransferase (microsomal) Agpat6 6.053 1.404 0.000515 5.838 1.195 0.000623 4.437 1.269 0.00392 C 1371748_at 1-acylglycerol-3-phosphate O-acyltransferase 1 Agpat1-2.093 0.878 0.195265-1.04 0.933 0.233743 1.617 1.142 0.04532 C 1392763_at 1-acylglycerol-3-phosphate O-acyltransferase 1 Agpat1 1.189 1.081 0.195265 2.571 1.18 0.031412 4.08 1.534 0.00392 C 1374570_at 1-acylglycerol-3-phosphate O-acyltransferase 2 Agpat2-4.843 0.758 0.00306-1.631 0.931 0.184825-2.638 0.823 0.01878 C 1382041_at 1-acylglycerol-3-phosphate O-acyltransferase 3 Agpat3 5.159 1.279 0.00306 2.117 1.203 0.031412 4.24 1.249 0.00392 C 1380480_at 1-acylglycerol-3-phosphate O-acyltransferase 3 Agpat3 3.174 1.149 0.035324 2.383 1.12 0.031412 1.852 1.124 0.04532 10

C 1382227_at 1-acylglycerol-3-phosphate O-acyltransferase 3 Agpat3-0.102 >0.195265 0.361 >0.233743 0.326 1.027 0.32222 C 1368194_at 1-acylglycerol-3-phosphate O-acyltransferase 4 Agpat4-8.544 0.854 0.00025-8.164 0.81 0.00036-3.552 0.818 0.0085 C 1395940_at 1-acylglycerol-3-phosphate O-acyltransferase 5 Agpat5 4.508 1.484 0.00306 6.36 1.735 0.00048 4.011 1.585 0.00392 C 1393169_at 1-acylglycerol-3-phosphate O-acyltransferase 5 Agpat5 1.37 1.056 0.195265-0.272 >0.233743 0.976 1.061 0.1563 C 1396398_at Lipin 2 Lpin2 3.085 1.107 0.035324 3.209 1.102 0.015484 1.618 1.119 0.04532 C 1376682_at Lipin 3 Lpin3 1.661 1.064 0.195265 5.957 1.169 0.000623 0.318 1.019 0.32222 C 1367915_at Diacylglycerol O-acyltransferase 1 Dgat1 1.582 1.093 0.195265-1.428 0.906 0.184825-1.294 0.886 0.1563 C 1371615_at Diacylglycerol O-acyltransferase homolog 2 Dgat2 12.914 1.687 0.000205 2.486 1.119 0.031412-5.027 0.68 0.00392 1.957 ± 0.187 1.056 ± 0.099 0.708 ± 0.042 C 1391045_at Diacylglycerol O-acyltransferase homolog 2 Dgat2 11.081 1.912 0.000207 4.918 1.318 0.00138-0.276 >0.32222 C 1370831_at Monoglyceride lipase Mgll 1.207 1.057 0.195265 8.132 1.448 0.000306 2.071 1.243 0.04532 C 1388190_at Apolipoprotein B100 Apob -6.231 0.394 0.000515 2.045 1.388 0.062886 0.153 >0.32222 0.381 ± 0.076 1.614 ± 0.139 0.860 ± 0.071 C 1371157_at Apolipoprotein B48 Apob 0.953 1.04 0.195265 3.73 1.179 0.007548 1.849 1.178 0.04532 C 1370009_at Apolipoprotein C-III Apoc3-2.369 0.781 0.035324 2.15 1.31 0.031412-0.978 0.876 0.32222 C 1395041_at Microsomal triglyceride transfer protein Mttp -7.217 0.322 0.000515 6.498 1.325 0.00048-7.859 0.525 0.00314 0.417 ± 0.052 1.161 ± 0.042 0.262 ± 0.046 * Compared to control cells. Significance of Microarray Analysis performed via Comprehensive R-based Microarray Analysis web service (CARMAweb;https:// CARMAweb.genome.tugraz.at /CARMA/ ) Data from one cell line RT-qPCRs were performed on RNA prepared from a separate experiment involving three biological observations. Results represent mean fold-changes (±SEM) of two independent cell-lines compared to control cell lines Affy_ID, affymetrix identification number: FDR, false detection rate; m: mitochondrial; c: cytosolic Italics indicate expression validated by RT-qPCR 11

Table S6. Correlation of SAR1A, SAR1B, APOB and MTTP mrnas with those of Genes Encoding Enzymes in the Cholesterol Biosynthesis and Scavenger* Pathways Liver Dataset 1 (n=427) SAR1A SAR1B APOB MTTP Liver Dataset 2 (n=75) Liver Dataset 1 (n=427) Liver Dataset 2 (n=75) Liver Dataset 1 (n=427) Liver Dataset 2 (n=75) Liver Dataset 1 (n=427) Liver Dataset 2 (n=75) R p-value R p-value R p-value R p-value R p-value R p-value R p-value R p-value HMGCS1 0.056 0.26 0.238 0.04 0.218 1.30E-05-0.412 2.40E-04 0.054 0.33-0.061 0.6 0.249 6.50E-07-0.166 0.16 HMGCR -0.052 0.29 0.179 0.12 0.207 1.70E-05-0.357 1.70E-03 0.179 7.60E-04-0.062 0.6 0.394 5.60E-17-0.148 0.21 MVK 0.014 0.77-0.165 0.16 0.184 1.70E-04 0.292 0.01 0.368 2.00E-12 0.002 0.98 0.242 6.70E-07 0.393 4.90E-04 PMVK -0.005 0.92-0.379 8.10E-04 0.191 1.80E-04 0.065 0.58 0.415 8.80E-15 0.535 7.70E-07 0.39 4.10E-15-0.197 0.09 MVD -0.054 0.26 0.173 0.14-0.046 0.34-0.087 0.46-0.075 0.16-0.016 0.89-0.124 0.01-0.041 0.72 FDPS 0.206 2.00E-05-0.108 0.36 0.394 4.90E-17-0.389 5.70E-04 0.528 2.00E-26-0.142 0.22 0.356 7.80E-14-0.428 1.30E-04 GGPS1 0.076 0.13 0.08 0.49 0.185 2.30E-04-0.26 0.02 0.076 0.16-0.309 7.10E-03 0.158 1.70E-03-0.466 2.50E-05 IDI1-0.133 5.80E-03 0.07 0.55-0.121 0.01-0.364 1.30E-03-0.38 1.50E-13-0.261 0.02-0.346 2.60E-13-0.415 2.20E-04 MCCC1* 0.031 0.52-0.249 0.03 0.388 1.90E-16 0.28 0.01 0.57 2.90E-31 0.247 0.03 0.683 4.70E-58 0.398 4.10E-04 MCCC2* 0.226 2.60E-06-0.314 6.00E-03 0.432 1.10E-20 0.372 1.00E-03 0.588 5.50E-34 0.313 6.30E-03 0.233 1.40E-06 0.381 7.40E-04 AUH* -0.143 3.30E-03 0.025 0.83 0.236 1.10E-06 0.045 0.7 0.383 1.30E-13-0.054 0.64 0.677 6.30E-57 0.107 0.36 HMGCL* -0.444 1.70E-21-0.321 4.90E-03-0.025 0.62 0.36 1.50E-03 0.299 1.40E-08 0.498 5.50E-06 0.634 1.60E-47 0.548 3.70E-07 AACS 0.373 1.90E-15 0.18 0.12 0.268 2.20E-08-0.446 6.10E-05-0.125 0.02-0.465 2.60E-05-0.495 2.70E-27-0.435 9.50E-05 ACSS2 0.077 0.11-0.12 0.31 0.164 7.90E-04 0.009 0.94 0.234 1.00E-05 0.41 2.60E-04 0.215 1.00E-05 0.288 0.01 ACAT2-0.088 0.07-0.081 0.49 0.161 8.90E-04-0.073 0.53 0.12 0.03 0.233 0.04 0.422 1.80E-19 0.159 0.17 FDFT1 0.019 0.7 0.252 0.03 0.128 8.50E-03-0.513 2.50E-06 0.337 8.00E-11-0.139 0.23 0.03 0.54-0.187 0.11 SQLE 0.145 2.70E-03 0.187 0.11 0.342 4.20E-13-0.539 6.20E-07 0.023 0.66-0.393 4.90E-04 0.123 0.01-0.455 4.10E-05 LSS -0.164 1.00E-03-0.011 0.93 0.137 6.40E-03-0.284 0.01 0.278 2.00E-07 0.188 0.11 0.254 3.10E-07-0.016 0.89 CYP51 0.027 0.61 0.13 0.27 0.01 0.85-0.458 3.60E-05 0.151 9.20E-03 0.066 0.58 0.053 0.32-0.049 0.68 TM7SF2-0.112 0.02 0.056 0.63 0.049 0.31-0.247 0.03 0.56 1.40E-30 0.164 0.16 0.454 7.90E-23-0.007 0.95 SC4MOL 0.166 5.90E-04 0.066 0.58 0.389 8.40E-17 0.1 0.4 0.63 2.60E-40 0.299 9.20E-03 0.542 2.20E-33 0.328 4.10E-03 NSDHL 0.219 1.00E-05-0.056 0.63 0.402 6.60E-17-0.361 1.50E-03 0.144 8.00E-03-0.284 0.01 0.2 6.10E-05-0.321 5.00E-03 12

HSD17B7 0.112 0.02 0.019 0.87 0.104 0.04-0.171 0.14-0.204 1.40E-04 0.016 0.89-0.252 2.90E-07-0.158 0.18 DHCR24 0.171 4.30E-04-0.051 0.66 0.398 2.40E-17-0.162 0.16 0.347 3.20E-11 0.292 0.01 0.184 1.60E-04 0.13 0.27 EBP -0.218 6.30E-06 0.067 0.57-0.027 0.58-0.006 0.96 0.019 0.73 0.268 0.02 0.356 7.20E-14 0.195 0.09 SC5DL 0.036 0.46-0.042 0.72 0.482 5.60E-26 0.356 1.70E-03 0.458 1.60E-19 0.429 1.20E-04 0.65 1.50E-51 0.474 1.70E-05 DHCR7 0.104 0.03-0.001 1 0.22 4.90E-06 0.106 0.37 0.238 6.70E-06 0.288 0.01 0.115 0.02 0.435 9.60E-05 Correlations performed using the R2: microarray analysis and visualization platform (http://r2.amc.nl), probes giving the highest signal and two liver datasets (61,62). P-values were corrected for multiple testing using the formula: t=r/sqrt((1-r^2)/(n-2)), where R corresponds to the correlation value and n denotes the number of samples, as described (http://r2.amc.nl). Bold values highlight positive correlation with mrna encoding enzymes on the cholesterol biosynthesis pathway observed in both liver datasets with SAR1B, APOB and MTTP. 13

Table S7. RT-qPCR and Microarray Results for Gene-Products Regulating Cholesterol Biosynthesis in McArdle-RH7777 cells. Over-expressing stable cell lines 1 sirna-mediated knockdown cells 2 Gene Symbol Empty Vector Control Sar1B:H79G (R.fold, FDR)* Sar1A (R.fold, FDR)* Sar1B (R.fold, FDR)* Scrambled Control Sar1a Knockdown Sar1b Knockdown Sar1a & Sar1b Knockdown Srebf2 1.083 ± 0.064 0.372 ± 0.017 0.697 ± 0.059 0.694 ± 0.043 0.999 ± 0.019 0.925 ± 0.051 0.959 ± 0.041 0.976 ± 0.037 (0.680, 0.000215) (0.876, 0.01878) (0.827, 0.000880) Srebf1 1.017 ± 0.036 0.379 ± 0.021 1.169 ± 0.056 0.774 ± 0.061 1.014 ± 0.035 0.864 ± 0.020 ac 0.949 ± 0.019 0.770 ± 0.025 (0.641, 0.000515) (1.407, 0.00539) (1.392, 0.001380) Srebf1a 1.031 ± 0.069 1.166 ± 0.079 1.012 ± 0.053 1.011 ± 0.043 1.004 ± 0.028 0.936 ± 0.047 c 1.100 ± 0.032 1.013 ± 0.037 Srebf1c 1.003 ± 0.040 0.487 ± 0.023 0.834 ± 0.030 0.926 ± 0.032 1.008 ± 0.035 0.958 ± 0.026 0.975 ± 0.022 0.953 ± 0.026 Scap 1.030 ± 0.062 0.511 ± 0.060 0.966 ± 0.047 1.052 ± 0.118 1.007 ± 0.028 0.918 ± 0.029 0.815 ± 0.029 b 0.898 ± 0.034 (0.877, 0.003060) (1.047, ns) (1.068, ns) Insig1 1.033 ± 0.060 0.219 ± 0.020 0.957 ± 0.055 1.024 ± 0.110 1.021 ± 0.070 0.816 ± 0.046 0.995 ± 0.068 0.700 ± 0.051 (0.352, 0.000205) (1.901, 0.00317) (1.912, 0.000271) Insig2 1.016 ± 0.037 1.233 ± 0.171 0.912 ± 0.035 1.111 ± 0.052 1.018 ± 0.049 0.805 ± 0.033 a 0.949 ± 0.043 0.876 ± 0.033 (1.148, ns) (1.000, ns) (0.776, 0.002373) 1. Analyses were performed on RNA prepared from specified McArdle RH7777 cell lines, involving three biological observations. RT-qPCR results (top values) represent mean fold-changes (±SEM) of two independent cell-lines compared to control cell lines, performed in triplicate. Microarray results, on RNA prepared from a separate experiment, as described in the methods, are shown below in brackets. *Indicates differential expression and false detection rates (FDR) <0.05, or ns. 2. RT-qPCR results are expressed as mean ± SEM, are from a minimum of three independent experiments, performed in triplicate for each condition. a p < 0.05 vs. scrambled control, b p < 0.001 vs. scrambled control, c p < 0.05 Sar1a vs. Sar1b. 14

Figure S1 Sar1B-mediated Regulation of Triglyceride and Cholesterol 15

Figure S2 Sar1B-mediated Regulation of Triglyceride and Cholesterol Relative mrna levels 1.5 Hmgcs1 Hmgcr Idi1 Lss 1.0 Dhcr7 0.5 0.0 Scrambled Apob Mttp Apob & Mttp 16

Figure S3 Sar1B-mediated Regulation of Triglyceride and Cholesterol 17